ID: 954294153

View in Genome Browser
Species Human (GRCh38)
Location 3:49664898-49664920
Sequence GAGGCACTGGGGGTGGGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2299
Summary {0: 1, 1: 1, 2: 30, 3: 273, 4: 1994}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954294134_954294153 29 Left 954294134 3:49664846-49664868 CCAGCATGGTGAGTACAAGCAGC 0: 1
1: 0
2: 0
3: 7
4: 113
Right 954294153 3:49664898-49664920 GAGGCACTGGGGGTGGGGGTGGG 0: 1
1: 1
2: 30
3: 273
4: 1994
954294139_954294153 1 Left 954294139 3:49664874-49664896 CCTTGCCTCTTCTGGGAAAGGCC 0: 1
1: 0
2: 1
3: 21
4: 229
Right 954294153 3:49664898-49664920 GAGGCACTGGGGGTGGGGGTGGG 0: 1
1: 1
2: 30
3: 273
4: 1994
954294133_954294153 30 Left 954294133 3:49664845-49664867 CCCAGCATGGTGAGTACAAGCAG 0: 1
1: 0
2: 0
3: 10
4: 129
Right 954294153 3:49664898-49664920 GAGGCACTGGGGGTGGGGGTGGG 0: 1
1: 1
2: 30
3: 273
4: 1994
954294140_954294153 -4 Left 954294140 3:49664879-49664901 CCTCTTCTGGGAAAGGCCCGAGG 0: 1
1: 0
2: 0
3: 8
4: 138
Right 954294153 3:49664898-49664920 GAGGCACTGGGGGTGGGGGTGGG 0: 1
1: 1
2: 30
3: 273
4: 1994
954294137_954294153 7 Left 954294137 3:49664868-49664890 CCTGTACCTTGCCTCTTCTGGGA 0: 1
1: 0
2: 0
3: 9
4: 155
Right 954294153 3:49664898-49664920 GAGGCACTGGGGGTGGGGGTGGG 0: 1
1: 1
2: 30
3: 273
4: 1994

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954294153 Original CRISPR GAGGCACTGGGGGTGGGGGT GGG Intronic
Too many off-targets to display for this crispr