ID: 954294154

View in Genome Browser
Species Human (GRCh38)
Location 3:49664899-49664921
Sequence AGGCACTGGGGGTGGGGGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3092
Summary {0: 1, 1: 7, 2: 55, 3: 450, 4: 2579}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954294140_954294154 -3 Left 954294140 3:49664879-49664901 CCTCTTCTGGGAAAGGCCCGAGG 0: 1
1: 0
2: 0
3: 8
4: 138
Right 954294154 3:49664899-49664921 AGGCACTGGGGGTGGGGGTGGGG 0: 1
1: 7
2: 55
3: 450
4: 2579
954294134_954294154 30 Left 954294134 3:49664846-49664868 CCAGCATGGTGAGTACAAGCAGC 0: 1
1: 0
2: 0
3: 7
4: 113
Right 954294154 3:49664899-49664921 AGGCACTGGGGGTGGGGGTGGGG 0: 1
1: 7
2: 55
3: 450
4: 2579
954294139_954294154 2 Left 954294139 3:49664874-49664896 CCTTGCCTCTTCTGGGAAAGGCC 0: 1
1: 0
2: 1
3: 21
4: 229
Right 954294154 3:49664899-49664921 AGGCACTGGGGGTGGGGGTGGGG 0: 1
1: 7
2: 55
3: 450
4: 2579
954294137_954294154 8 Left 954294137 3:49664868-49664890 CCTGTACCTTGCCTCTTCTGGGA 0: 1
1: 0
2: 0
3: 9
4: 155
Right 954294154 3:49664899-49664921 AGGCACTGGGGGTGGGGGTGGGG 0: 1
1: 7
2: 55
3: 450
4: 2579

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954294154 Original CRISPR AGGCACTGGGGGTGGGGGTG GGG Intronic
Too many off-targets to display for this crispr