ID: 954294857

View in Genome Browser
Species Human (GRCh38)
Location 3:49668605-49668627
Sequence CACAGTAAACAGAGGCGGGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 165}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954294857_954294868 30 Left 954294857 3:49668605-49668627 CCAGCCCGCCTCTGTTTACTGTG 0: 1
1: 0
2: 0
3: 12
4: 165
Right 954294868 3:49668658-49668680 TGGGTGTACTCAGAGCAGAGGGG 0: 1
1: 0
2: 0
3: 24
4: 242
954294857_954294862 10 Left 954294857 3:49668605-49668627 CCAGCCCGCCTCTGTTTACTGTG 0: 1
1: 0
2: 0
3: 12
4: 165
Right 954294862 3:49668638-49668660 CGTTCTTAAGCCATCACCAGTGG 0: 1
1: 0
2: 0
3: 7
4: 56
954294857_954294867 29 Left 954294857 3:49668605-49668627 CCAGCCCGCCTCTGTTTACTGTG 0: 1
1: 0
2: 0
3: 12
4: 165
Right 954294867 3:49668657-49668679 GTGGGTGTACTCAGAGCAGAGGG 0: 1
1: 0
2: 3
3: 17
4: 221
954294857_954294863 11 Left 954294857 3:49668605-49668627 CCAGCCCGCCTCTGTTTACTGTG 0: 1
1: 0
2: 0
3: 12
4: 165
Right 954294863 3:49668639-49668661 GTTCTTAAGCCATCACCAGTGGG 0: 1
1: 0
2: 0
3: 3
4: 80
954294857_954294866 28 Left 954294857 3:49668605-49668627 CCAGCCCGCCTCTGTTTACTGTG 0: 1
1: 0
2: 0
3: 12
4: 165
Right 954294866 3:49668656-49668678 AGTGGGTGTACTCAGAGCAGAGG 0: 1
1: 0
2: 0
3: 13
4: 226

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954294857 Original CRISPR CACAGTAAACAGAGGCGGGC TGG (reversed) Exonic
901092456 1:6651102-6651124 GACAGGAAGCAGAGGCTGGCTGG + Intronic
901692963 1:10985732-10985754 CACACCAAACAGAAGCAGGCAGG + Intergenic
902210805 1:14903162-14903184 CACAGAAATAAGAGGCGGCCAGG - Intronic
902759457 1:18571735-18571757 CACTGTGACCAGAGGTGGGCTGG - Intergenic
903517071 1:23918459-23918481 GAAAGTAAACAGAAGCAGGCCGG + Intergenic
904917092 1:33977901-33977923 AAGAGTCAACAGAAGCGGGCAGG + Intronic
906112272 1:43331977-43331999 CAGAGAAAACGGAGGAGGGCCGG - Intergenic
915580221 1:156808936-156808958 CACAGAAAACAGAGGCCCCCAGG - Intronic
915869087 1:159538741-159538763 CAGAGTCTACAGAGGCAGGCAGG - Intergenic
915971919 1:160361080-160361102 CACAATAGGCAGAGGCAGGCTGG - Intergenic
916535303 1:165698299-165698321 CACAGGAAACGGGGGCTGGCCGG + Intronic
917115334 1:171597367-171597389 CACAGTAAGCAGAGGAGGCAGGG + Intergenic
921262967 1:213400057-213400079 CATAGAAAAAAGAGGTGGGCGGG + Intergenic
1063646622 10:7890193-7890215 CACAGAAAAGAAAGGCAGGCAGG - Intronic
1067748197 10:48952348-48952370 CACTGTAATCAGAGGGAGGCTGG - Intronic
1069479081 10:68764273-68764295 CACAGGAGACGGAGGCTGGCAGG - Intronic
1072475502 10:95756175-95756197 CACAGCAAGCAGAGGCTGGGGGG + Intronic
1072624381 10:97101637-97101659 CACAGCTATCAGAGGAGGGCAGG - Intronic
1083762294 11:64825316-64825338 CACAGTCAACAGAGGAGAACAGG + Intronic
1084343698 11:68528055-68528077 CAGAGAAAACAGAGACAGGCAGG - Intronic
1085413228 11:76303932-76303954 CACAGTAAGAAGATGTGGGCTGG + Intergenic
1085977599 11:81678322-81678344 CACAATAAACAGAGAAGTGCAGG + Intergenic
1086330736 11:85751559-85751581 CTCAGTAAACACCGGTGGGCTGG + Intronic
1086636958 11:89100503-89100525 CACAGGAAATAGAGACAGGCTGG + Intergenic
1089400542 11:118161848-118161870 CACTGCAAAGAGAGACGGGCTGG - Intergenic
1089400809 11:118163606-118163628 CACTGCAAAGAGAGACGGGCTGG - Exonic
1089559842 11:119338269-119338291 CACATTAAACAGAGACTGGAAGG - Intergenic
1089762299 11:120736790-120736812 TTCAGTGAACAGAGGTGGGCAGG - Intronic
1091208598 11:133837321-133837343 CACAGGAAACAGTGCTGGGCAGG + Intergenic
1092869253 12:12791743-12791765 AACACTAAAGAGAGGTGGGCAGG + Intronic
1095662304 12:44751632-44751654 CAAAGTAAACACAGGAGGGAGGG - Intronic
1095787413 12:46124908-46124930 CACTGTAAACTGAGGAGGTCAGG - Intergenic
1096762592 12:53854798-53854820 CACAGTGAACAGTGGAGGGTGGG + Intergenic
1102254845 12:111409569-111409591 CCAAGGAAACTGAGGCGGGCAGG + Intronic
1102422672 12:112816334-112816356 CATAGAAAACACAGGCAGGCTGG + Intronic
1103994583 12:124820777-124820799 CACAGAAAACAGTGGGGGGCAGG + Intronic
1112606402 13:100910759-100910781 CATAGTAAACAAAGGTGGGTGGG + Intergenic
1120218581 14:81706878-81706900 CACAGTAAACATACGTGTGCAGG + Intergenic
1121017757 14:90558708-90558730 CAGTGTGAACAGAGGCCGGCAGG - Intronic
1123668020 15:22624716-22624738 CACAGTTAACAGAGGTGGTTTGG - Intergenic
1124523994 15:30431153-30431175 CACAGTTAACAGAGGTGGTTTGG - Intergenic
1124534672 15:30535063-30535085 CACAGTTAACAGAGGTGGTTTGG + Intergenic
1124763977 15:32472536-32472558 CACAGTTAACAGAGGTGGTTTGG - Intergenic
1124774649 15:32576511-32576533 CACAGTTAACAGAGGTGGTTTGG + Intergenic
1128991311 15:72262751-72262773 CACAGAAGACAAAGGAGGGCAGG - Intronic
1129168822 15:73795613-73795635 CACAGGAAACAGTGGCCTGCAGG + Intergenic
1131152351 15:90054889-90054911 CTCAGGGAAAAGAGGCGGGCAGG + Intronic
1132628843 16:906462-906484 CACAGAAGAAAGATGCGGGCTGG - Intronic
1133514903 16:6499125-6499147 CACAGTAAACAAAGGCTGCCTGG - Intronic
1134018913 16:10907980-10908002 CCCAGAAAAGAGAGGCGGCCGGG - Exonic
1134849336 16:17468203-17468225 CACAGTACAGACAGGCTGGCTGG - Intronic
1138127193 16:54448457-54448479 CGCAGAAAACAGAGGCAGGCAGG - Intergenic
1138343188 16:56304143-56304165 CACAGAACACAGAGGCTGGTGGG + Intronic
1138442115 16:57041430-57041452 CCCACTGAACAGAGGCGGGAAGG - Intronic
1139638588 16:68274693-68274715 CACAGCAAACACAGGTGTGCAGG + Exonic
1141911712 16:87064671-87064693 GAAAGTAAGCAGAAGCGGGCTGG - Intergenic
1142074917 16:88112136-88112158 TGCAGTAAACACAGGCGTGCCGG + Intronic
1142614006 17:1124702-1124724 CAGAGTGAACAGAGGAGGGCTGG + Intronic
1142973249 17:3627405-3627427 CACAGTCAACACAGATGGGCAGG - Intronic
1143526740 17:7477536-7477558 CACAGTAGACAGTGGTGTGCAGG + Intronic
1148072995 17:44919558-44919580 CACAGCAAACAGAGAAGGGTAGG + Intergenic
1148874129 17:50676527-50676549 CACAGTGAAGAGCGGCGTGCTGG - Exonic
1148997487 17:51723885-51723907 CCCAGTAAACATGGGCTGGCTGG - Intronic
1149543998 17:57489537-57489559 CTCAGTGGACAGAGGCCGGCGGG + Intronic
1149646759 17:58246654-58246676 CACCGTGAACAAAGGCAGGCAGG - Intronic
1150135268 17:62691962-62691984 CACAGTAACCAGAGGTAGGATGG + Intronic
1151226250 17:72650474-72650496 CACAGGAAACAGAGGCATGAGGG + Intronic
1151513539 17:74577603-74577625 AACAGTTACCAGAGGCGGGGCGG + Intergenic
1151683404 17:75633615-75633637 AACAGTAAACAGTGGGGAGCTGG - Intronic
1152877596 17:82795948-82795970 CACAACCAACAGAGGCAGGCAGG - Intronic
1154018007 18:10637512-10637534 CACAGTACACAGAGCTTGGCTGG - Intergenic
1157501607 18:48194553-48194575 CAGAGTAAACAGAGGCTTGCAGG + Intronic
1164236039 19:23335424-23335446 CACAGTCTACAGAGGCAGGCAGG + Intronic
925964204 2:9048154-9048176 CACAGCAGTCAGAGGAGGGCTGG + Intergenic
926879793 2:17532027-17532049 CACAGTAAAAAAAGCCGGGGTGG + Intergenic
927856114 2:26528970-26528992 CACAGCCAACAGTGGCAGGCTGG - Intronic
930739397 2:54814504-54814526 CACAGGAAACGGAGGCGGTTGGG - Intronic
931530693 2:63210997-63211019 CAGAGTCTACAGAGGCAGGCAGG - Intronic
931627999 2:64274158-64274180 CCCAGTGATCAGAGGCTGGCTGG + Intergenic
931814296 2:65885572-65885594 CACAGTATACAAAGGCAGGTGGG + Intergenic
932615049 2:73226447-73226469 CCCAGCAAGCAGAGGCGGGCAGG + Exonic
933325879 2:80836239-80836261 TACAGTGAACAGAGGTGGGGAGG + Intergenic
933778824 2:85787681-85787703 CACAGTGAGGAGAGGCTGGCTGG - Exonic
935521042 2:104105453-104105475 CAAAGTAAATAGATGGGGGCAGG + Intergenic
941087601 2:161135440-161135462 CAAAGTAAATAGAGGAGGGAGGG + Intergenic
944878309 2:203985416-203985438 CACAGTAGACACAGGGAGGCAGG - Intergenic
948753157 2:240144040-240144062 TCCAGGAAACAGAGGTGGGCTGG - Intronic
948856079 2:240731287-240731309 CAGACTAAACAGAGGCAGGGAGG + Intronic
1168908220 20:1423677-1423699 CACAGTAAAGAGGGGCCTGCTGG - Intergenic
1172257779 20:33535075-33535097 CACAGTAAAATGAGGTGTGCTGG + Intronic
1172325886 20:34034153-34034175 AGCAGTAAGCAGAGGCAGGCAGG - Intronic
1175042682 20:56070306-56070328 CACAGTAATAATAGGCAGGCAGG + Intergenic
1175130972 20:56789185-56789207 CACAGTACAGAGAGGGGGCCAGG - Intergenic
1179086131 21:38219414-38219436 AACAGTAAACAGAGTTGGGTTGG - Intronic
1179232324 21:39516017-39516039 TACAGTAAACTGAGGCAGGCAGG - Intergenic
1179786570 21:43733673-43733695 CACACTGAACAGAGGCTGGGAGG - Intronic
1180246897 21:46554506-46554528 AACAGTGAACAGAGGCTGGTGGG + Intronic
953186970 3:40646944-40646966 CACAGAAAACATTGGCTGGCTGG - Intergenic
953740301 3:45532935-45532957 CACAGTAAAAAGAGGTGGCCGGG - Intronic
953787284 3:45920713-45920735 CAGAGTAAACAGAGGCATGATGG - Exonic
953907858 3:46877304-46877326 CAGAGAAATCAGAGGGGGGCTGG - Intronic
954294857 3:49668605-49668627 CACAGTAAACAGAGGCGGGCTGG - Exonic
955135497 3:56213557-56213579 CAGAGTCTACAGAGGCAGGCAGG - Intronic
955751646 3:62189881-62189903 CACAGAAAAGACAGGCAGGCAGG - Intronic
959090934 3:101901980-101902002 CAGAGAAAACAGGGGCGGGAAGG - Intergenic
960822384 3:121749001-121749023 CCCAGGAATCAGAGGTGGGCAGG - Intronic
961507922 3:127383755-127383777 CACAGTAAACAGAGGCAACCGGG - Intergenic
964122172 3:153196329-153196351 CAGAGCACACAGAGGCTGGCAGG + Intergenic
964678059 3:159305366-159305388 CAGAGAAAACAGAGGCTGACAGG + Intronic
967189500 3:186973330-186973352 CTCAGAAAACAGAAGAGGGCCGG - Intronic
972231379 4:37076203-37076225 AACAGTTAACAGAGTTGGGCAGG + Intergenic
973296274 4:48524650-48524672 CACAGTAATCAGGGGTGGGGTGG - Intronic
974144835 4:57934331-57934353 CACAGTTAACAGAGAGTGGCTGG + Intergenic
974937032 4:68420720-68420742 TAGAGTATACAGAGGCAGGCAGG - Intergenic
983024903 4:162724518-162724540 CAGGGTAAACAGATGGGGGCTGG - Intergenic
986548546 5:8926524-8926546 CTCAGTAAACACAGGAGTGCAGG - Intergenic
987034921 5:14009638-14009660 TACAGGAAACAGAGGAGGACTGG + Intergenic
987458775 5:18180748-18180770 CAGAGTAAACAGAGGTGGTAAGG - Intergenic
987560874 5:19518583-19518605 CACAGGAAAAAGACGAGGGCCGG - Intronic
988753378 5:34215988-34216010 CACAGTAATCACAGGCTGGTTGG - Intergenic
990946746 5:61257074-61257096 CACAGTGAATGGAGGCTGGCTGG + Intergenic
991741160 5:69676834-69676856 CACAGTAATCACAGGCTGGTTGG - Intergenic
991756458 5:69877608-69877630 CACAGTAATCACAGGCTGGTTGG + Intergenic
991792734 5:70256571-70256593 CACAGTAATCACAGGCTGGTTGG - Intergenic
991820620 5:70552907-70552929 CACAGTAATCACAGGCTGGTTGG - Intergenic
991835860 5:70753521-70753543 CACAGTAATCACAGGCTGGTTGG + Intergenic
991885184 5:71256879-71256901 CACAGTAATCACAGGCTGGTTGG - Intergenic
996337033 5:122395663-122395685 CACACAAAACAGAAGGGGGCAGG - Intronic
998232317 5:140368582-140368604 CACAGGGAACAGAGGCTGACAGG + Exonic
1004156704 6:13175555-13175577 CTCAGTTAACAGAGGTGTGCTGG - Intronic
1005551546 6:26922809-26922831 CACAGTAATCACAGGCTGGTTGG - Intergenic
1006553653 6:34846431-34846453 CACAAGAAACTGAGGAGGGCTGG - Intronic
1007382930 6:41502416-41502438 CAGAGTGAACAGGAGCGGGCAGG + Intergenic
1007439607 6:41846919-41846941 CACTGAAAACAGAGGAGAGCAGG + Intronic
1007567836 6:42866263-42866285 CACAGTGTACAGAGGAGGCCGGG + Exonic
1007568564 6:42872454-42872476 GACAGTAAAAAGAGCAGGGCCGG + Intergenic
1010853785 6:80812422-80812444 CAAAGTAATTAGAGGTGGGCAGG + Intergenic
1012519436 6:100103297-100103319 CACAGTAAACTGAGGTGAGTAGG + Intergenic
1012649980 6:101740691-101740713 CACAAGAAGCAGAGGCTGGCTGG - Intronic
1012754175 6:103203756-103203778 CACAATAAACATACGCGTGCAGG - Intergenic
1012978855 6:105809071-105809093 CAAAGTAAACAGAGTTGGCCTGG - Intergenic
1012983334 6:105852515-105852537 CACAGTAAAATGAGGTGTGCTGG + Intergenic
1019521952 7:1464845-1464867 CACAGCAATCAGAGGCAGGCTGG - Intergenic
1019917116 7:4140636-4140658 CACAGTAAACAGGGCAGGGCTGG - Intronic
1022161880 7:27719268-27719290 CACATTAAACAGAGCAGGGAAGG + Intergenic
1022479438 7:30733422-30733444 CACAGTCAACAGGGGCAGTCAGG - Intronic
1026722243 7:72841987-72842009 CCCAATAAAGAGAGGCTGGCCGG + Intergenic
1028159087 7:87465442-87465464 CAGAGTCTACAGAGGCAGGCAGG - Intronic
1029348762 7:99997880-99997902 CTCAGGAAACAAAGGGGGGCCGG - Intergenic
1033630080 7:143148958-143148980 CAGAGTGAACAGAGGGGTGCAGG - Intergenic
1036036623 8:5027523-5027545 CACAGTGAAAAGAGGTGGGATGG - Intergenic
1036775638 8:11610877-11610899 TACAATAAACAGAGGAGTGCAGG - Intergenic
1038503418 8:28063896-28063918 CGCGGTAAACAGAGGCGCTCTGG - Intronic
1040687157 8:49888111-49888133 AACAGTAAACAGAAGAGAGCTGG - Intergenic
1041648229 8:60275365-60275387 CAGAGTAAACAGAGACAGGTAGG + Intronic
1044997329 8:97849819-97849841 CACAGGAACCGGGGGCGGGCAGG - Intronic
1052338846 9:27345614-27345636 CAAAGTCAACAGAGTCAGGCAGG - Intronic
1053296451 9:36917689-36917711 CACAGTAAAATGAGGTGTGCTGG - Intronic
1053442953 9:38130844-38130866 CACAGCTATCAGAGCCGGGCAGG + Intergenic
1060308573 9:122438713-122438735 CACAGGAAAAAGATGTGGGCTGG + Intergenic
1061954574 9:133955169-133955191 CACAGGAAGCAGAGTCTGGCTGG - Intronic
1062043073 9:134412907-134412929 CACAGGAAGCAAAGGCAGGCAGG - Intronic
1062142283 9:134966206-134966228 CACAGTAAAGAGAAGCCTGCAGG - Intergenic
1185456959 X:315650-315672 CACAGTAAACACATCCCGGCAGG + Intronic
1185456972 X:315829-315851 CACAGTAAACACATCCCGGCAGG + Intronic
1185456981 X:315955-315977 CACAGTAAACACATCCCGGCAGG + Intronic
1185456990 X:316081-316103 CACAGTAAACACATCCCGGCAGG + Intronic
1190654069 X:52595912-52595934 CACTGTAAACTGAGGGAGGCTGG + Intergenic
1198278141 X:135116907-135116929 CACAGGAATCAGAGGCTGACTGG - Intergenic
1198292821 X:135255609-135255631 CACAGGAATCAGAGGCTGACTGG + Intronic
1198581844 X:138073937-138073959 CAGAGTCTACAGAGGCAGGCAGG - Intergenic
1199506767 X:148571298-148571320 CACAGTAATCATAGGCAGGAGGG - Intronic
1200058782 X:153474851-153474873 CAAAGGAAACGGCGGCGGGCGGG + Intronic
1201366628 Y:13213507-13213529 CACAATAAACAGATGTAGGCCGG - Intergenic
1202361489 Y:24115187-24115209 CAGAGTCTACAGAGGCAGGCAGG + Intergenic
1202363584 Y:24137913-24137935 CAGAGTCTACAGAGGCAGGCAGG - Intergenic
1202507196 Y:25532204-25532226 CAGAGTCTACAGAGGCAGGCAGG + Intergenic
1202509289 Y:25554932-25554954 CAGAGTCTACAGAGGCAGGCAGG - Intergenic