ID: 954295366

View in Genome Browser
Species Human (GRCh38)
Location 3:49671719-49671741
Sequence CCCTCCACAAAGGTGCCCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 155}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954295362_954295366 -9 Left 954295362 3:49671705-49671727 CCAAAGACAATGGGCCCTCCACA 0: 1
1: 0
2: 1
3: 8
4: 103
Right 954295366 3:49671719-49671741 CCCTCCACAAAGGTGCCCAAGGG 0: 1
1: 0
2: 1
3: 16
4: 155
954295359_954295366 0 Left 954295359 3:49671696-49671718 CCAAGCCATCCAAAGACAATGGG 0: 1
1: 0
2: 1
3: 3
4: 155
Right 954295366 3:49671719-49671741 CCCTCCACAAAGGTGCCCAAGGG 0: 1
1: 0
2: 1
3: 16
4: 155
954295361_954295366 -5 Left 954295361 3:49671701-49671723 CCATCCAAAGACAATGGGCCCTC 0: 1
1: 0
2: 0
3: 12
4: 146
Right 954295366 3:49671719-49671741 CCCTCCACAAAGGTGCCCAAGGG 0: 1
1: 0
2: 1
3: 16
4: 155
954295357_954295366 5 Left 954295357 3:49671691-49671713 CCACACCAAGCCATCCAAAGACA 0: 1
1: 0
2: 1
3: 18
4: 261
Right 954295366 3:49671719-49671741 CCCTCCACAAAGGTGCCCAAGGG 0: 1
1: 0
2: 1
3: 16
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954295366 Original CRISPR CCCTCCACAAAGGTGCCCAA GGG Intergenic