ID: 954297011

View in Genome Browser
Species Human (GRCh38)
Location 3:49679858-49679880
Sequence GGAACAGAGTTGAGTGCTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 188}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954297011_954297014 4 Left 954297011 3:49679858-49679880 CCTTTAGCACTCAACTCTGTTCC 0: 1
1: 0
2: 0
3: 16
4: 188
Right 954297014 3:49679885-49679907 GTCCTGGCCCAGCCTCAGCACGG 0: 1
1: 0
2: 6
3: 46
4: 440

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954297011 Original CRISPR GGAACAGAGTTGAGTGCTAA AGG (reversed) Intronic
900471775 1:2858482-2858504 AGCACAGATTTGGGTGCTAAGGG - Intergenic
901154824 1:7128498-7128520 GAAACAGGGTTGAGTGGTCAGGG + Intronic
902856633 1:19210796-19210818 AGAAGAGATTTGAGTGCTAAGGG - Intergenic
903471199 1:23588592-23588614 GGAACAGGGTTGACTGATGATGG + Intronic
904899677 1:33847026-33847048 GGACCAGAGCTGAGTGGTATAGG + Intronic
907235533 1:53043037-53043059 GGGACAGAGTTGAGAACTCAAGG - Intronic
909322892 1:74312425-74312447 GCAGCAGAGCTGAGTGTTAAGGG + Intronic
909478620 1:76110621-76110643 AGGATAAAGTTGAGTGCTAAAGG + Intronic
910674645 1:89804303-89804325 GGAAGAGACTTGAGTGATCATGG + Intronic
911014332 1:93316274-93316296 GGAACAGAATAGAGAGCCAAGGG + Intergenic
913275912 1:117137590-117137612 GGAGGAGAATTGAGTGATAAAGG - Intergenic
916079589 1:161224102-161224124 GGGACAGGGTTGAGGGCTATGGG + Intergenic
916345021 1:163778198-163778220 GGAACAGAGTTGAGAGAAGAAGG + Intergenic
917402613 1:174667393-174667415 GGAACAGACTTGGGTTCAAATGG + Intronic
919550710 1:198983032-198983054 GTAACACAGTTGATTGCTTATGG - Intergenic
924526978 1:244862032-244862054 GGAATATACTTGTGTGCTAATGG + Intronic
1064928147 10:20593162-20593184 GGACCAGAGAAGAGTGGTAAAGG + Intergenic
1065507311 10:26442127-26442149 GAACCAGAGTTGAGTGCTGTGGG + Intronic
1066758527 10:38733811-38733833 GGAACAAGGATGACTGCTAATGG - Intergenic
1067262951 10:44710285-44710307 GGAATTAAGTTGAGTGATAAAGG - Intergenic
1069016045 10:63430598-63430620 GGAACACAAGTGACTGCTAACGG + Intronic
1071275245 10:84048339-84048361 GCTACTGAGTTGAGTGTTAAGGG - Intergenic
1072880982 10:99229293-99229315 GGAACAGAGTTGAGAACCAAAGG - Intronic
1075569012 10:123525516-123525538 GAAACAGAGTTCAATCCTAAAGG - Intergenic
1075730491 10:124632645-124632667 GGAACAGAGTTGTGAGCTGCTGG - Intronic
1075971372 10:126656691-126656713 GGAAGTGCGTTGAGTGCAAAGGG + Intronic
1076268655 10:129131421-129131443 AGAACAGTGCTGAGTGCTGAAGG - Intergenic
1077590777 11:3489315-3489337 GGCACAGAGTTGACAGCTACAGG - Intergenic
1077767038 11:5170348-5170370 GGAAGAGGGGTGAGTTCTAATGG - Intronic
1079056369 11:17209345-17209367 GGAACTAAGTTGATTTCTAAGGG - Intronic
1079826499 11:25201793-25201815 GGATCGGAGTAGAGTGCTAGTGG - Intergenic
1084246499 11:67861100-67861122 GGCACAGAGTTGACAGCTACAGG - Intergenic
1084462908 11:69306275-69306297 GGCACAGAGTTGGGTGCTGCGGG + Intronic
1084826180 11:71733401-71733423 GGCACAGAGTTGACAGCTACAGG + Intergenic
1085644658 11:78215225-78215247 GGAACAGACTGGAGTGAGAACGG + Intergenic
1087821428 11:102717121-102717143 GGAACAGAGTGGAGTGGAATTGG - Intronic
1088070052 11:105771385-105771407 AGAGCAGAGTTGAGTAATAAGGG - Intronic
1092417063 12:8298222-8298244 GGCACAGAGTTGACAGCTACAGG - Intergenic
1096273309 12:50184052-50184074 GGAACAAAGCTGAGTGGAAATGG + Intronic
1096478010 12:51920476-51920498 GGAAGAGAGTAGAGTGAGAAAGG - Intronic
1100562345 12:95760489-95760511 GAGACAGAGATGAGTGCTCAAGG - Intronic
1102454217 12:113061477-113061499 GGAGCAGACCTGAGTGCCAACGG + Intronic
1104142503 12:126002491-126002513 GGAACAGTGTGGAGTGTTGATGG + Intergenic
1105270379 13:18869022-18869044 AGAACAGAGCTGAGTAATAAGGG - Intergenic
1106849267 13:33771563-33771585 GGAACAGAGTTGAGCAGTTAGGG - Intergenic
1107750228 13:43557436-43557458 GGAACAGGGATGAGTGCCTAAGG + Intronic
1107859715 13:44649425-44649447 TTAAAAGAGTTGATTGCTAAAGG - Intergenic
1107872401 13:44759534-44759556 GGAGGAGAATGGAGTGCTAATGG + Intergenic
1111289043 13:86138530-86138552 AGAACAGATGTGATTGCTAAAGG + Intergenic
1112548751 13:100399499-100399521 GGAACAGAGTTGAGTATTGCTGG + Intronic
1113054278 13:106251354-106251376 GGAACAGGGGTGAGTGTGAAGGG + Intergenic
1113096482 13:106669455-106669477 GGAAAAGACTTGAATGGTAATGG - Intergenic
1114547205 14:23511950-23511972 GGAAGAGAGCTGAGTGGTGATGG - Intergenic
1114990408 14:28279622-28279644 GGAACTGAGTCCATTGCTAAGGG - Intergenic
1115078729 14:29423588-29423610 AGAACAGAGTAGCCTGCTAATGG - Intergenic
1115534944 14:34364072-34364094 GGAACAGAGTGGGATGATAAAGG - Intronic
1117023413 14:51595282-51595304 GGTACAGATTTGAGTTCAAAGGG - Intronic
1120348435 14:83321064-83321086 GGAACAGTCTTGAGTGATGAGGG - Intergenic
1122129456 14:99596696-99596718 GGAACAAACTTGTCTGCTAAAGG - Intronic
1122609396 14:102971167-102971189 GGAAAACAGTTGAGTTCTCATGG - Intronic
1123631524 15:22263491-22263513 GGCCCAGAGTTTAGGGCTAAGGG - Intergenic
1124269432 15:28267300-28267322 GGAAGAGAGATGAGTGCAGATGG - Intronic
1126663495 15:51054687-51054709 GGGACAGAGCTGAGTGTTCAGGG + Intergenic
1129190527 15:73935005-73935027 AGAACAGAGTAGAGTGGAAATGG + Intronic
1131576803 15:93600512-93600534 GGAAAAGGGTTGACTGATAAAGG + Intergenic
1133062804 16:3185892-3185914 GGAACAGGGAGGACTGCTAATGG + Intergenic
1133356151 16:5138413-5138435 GGCACAGAGTTGACAGCTACAGG - Intergenic
1135967483 16:27048049-27048071 GAAACAGAATTGAGTGCAAGTGG - Intergenic
1138627590 16:58264904-58264926 GGCACTGGGCTGAGTGCTAAGGG + Intronic
1141971476 16:87486955-87486977 GGCCCAGAGTTTAGGGCTAAAGG + Intronic
1142224670 16:88871720-88871742 GGCTCAGAGTTGAGTCCTTACGG - Intergenic
1143556953 17:7667982-7668004 GGAACAGGGGTGGGTGCTACTGG - Intronic
1145063674 17:19747960-19747982 GCAGCAGAGCCGAGTGCTAAAGG - Intronic
1146453752 17:32994107-32994129 GGGACAGCGTGGCGTGCTAAAGG + Intronic
1154417656 18:14190947-14190969 AGAACAGAGCTGAGTAATAAGGG + Intergenic
1154484480 18:14862728-14862750 GGATCAGAGTTGAGTGCCTGTGG - Intergenic
1155431180 18:25760524-25760546 GGATCTGAGTAGAGTGTTAATGG + Intergenic
1156057263 18:33022168-33022190 GGAAAAGATTTGAGAGCAAAGGG - Intronic
1157140264 18:45098796-45098818 GGAACAGAGCTTATTGCTAGAGG - Intergenic
1164541213 19:29122807-29122829 GGAACAGAGCTGAGGCCTGAGGG + Intergenic
1166321094 19:42019318-42019340 TGAACTGGGTTGAGTCCTAAAGG - Intronic
1167696255 19:51017129-51017151 GGACCAGAGTTGGGTGCTGACGG - Exonic
1168456232 19:56510936-56510958 GTGGCAGAATTGAGTGCTAAAGG + Intronic
926894910 2:17675431-17675453 GGAACAGAGAGGAATGCAAAAGG - Intronic
928343303 2:30465276-30465298 GGTAGAGATTTGAGTGTTAACGG + Intronic
930243013 2:48955567-48955589 GCAACTGAGTTAAGTGCCAAGGG + Intergenic
930664924 2:54092467-54092489 GGAACAGGGTTGGGTGACAAAGG + Intronic
930869216 2:56153147-56153169 GTCACAGAGTTGAATGTTAAAGG + Intergenic
934499583 2:94846370-94846392 GGAACAGAGCTGAGTAATAAGGG - Intergenic
936434886 2:112495905-112495927 GGAACAGAAATGAGTACCAATGG - Intronic
936532285 2:113284511-113284533 GGAGCAGACTTGAGGGCTTAGGG + Intergenic
938314292 2:130315423-130315445 GGGACAGAGTTGCCTGCTCAGGG + Intergenic
939301387 2:140344806-140344828 GGAAGAGAGTAGAGGACTAAGGG + Intronic
940690452 2:156912711-156912733 GGAGCAGGATTGAGTGCAAAGGG - Intergenic
944103401 2:196053840-196053862 GAAACACAGTTAAGTGCTAGAGG + Intronic
944377791 2:199068019-199068041 GGAGAAGTGGTGAGTGCTAATGG - Intergenic
1169551984 20:6710418-6710440 GAAACAGAGCTTAGTGCTGAGGG + Intergenic
1169833867 20:9855759-9855781 GAAGCAGACTTGAGAGCTAAAGG - Intergenic
1170590739 20:17769739-17769761 GGAACCGAGTGGCGTGCTGAAGG - Intergenic
1171020174 20:21577622-21577644 GGTCCTGAGTTCAGTGCTAATGG - Intergenic
1171890818 20:30713077-30713099 GGAACAGAGCTGAGTAATAAGGG - Intergenic
1172011697 20:31849496-31849518 GGAACAGAGTGGCGTGGGAACGG - Intronic
1173032483 20:39375073-39375095 GGGTTAGAGTTGAGTGCTAGAGG + Intergenic
1173317856 20:41961244-41961266 GGCACAGAGCTGGGTGCAAAAGG - Intergenic
1174692883 20:52526285-52526307 AGAGCAGAGTTGAGTGGTAGTGG + Intergenic
1175256872 20:57652945-57652967 GGAACAGTGTGGGCTGCTAAAGG - Intronic
1175498804 20:59434559-59434581 GGGGTAGAGGTGAGTGCTAAGGG + Intergenic
1176796848 21:13376737-13376759 GGATCAGAGTTGAGTGCCTGTGG + Intergenic
1176855650 21:13968326-13968348 AGAACAGAGCTGAGTAATAAGGG - Intergenic
1178010122 21:28275431-28275453 GGAACACAGTGGTGTGCTGAGGG - Intergenic
1178676755 21:34637750-34637772 GGAACTGAATTAAGTGCGAAGGG + Intergenic
1179814322 21:43894850-43894872 GGAACAGAGTCCAGTGCTTCAGG - Intronic
1182340116 22:29613625-29613647 GGAATAGAGTTGAGAGTTCATGG + Intronic
1183763767 22:39850785-39850807 GGTCCAGAGTTGTGTTCTAAAGG - Intronic
1203305268 22_KI270736v1_random:104785-104807 GGAAGAGAGTGGAGTGCAATAGG + Intergenic
950526280 3:13526140-13526162 GGAACAGATTTGAGCGCAACAGG - Intergenic
952989539 3:38819687-38819709 GGAAAAGAAGTGAGTGCTAATGG + Intergenic
954297011 3:49679858-49679880 GGAACAGAGTTGAGTGCTAAAGG - Intronic
954681044 3:52346073-52346095 GAGACAGAGTTGAGTGCAGAGGG - Intronic
956721682 3:72123623-72123645 GGAACATAGTTGAGTACTCTTGG + Intergenic
957060810 3:75479861-75479883 GGCACAGAGTTGACAGCTACAGG - Intergenic
958964546 3:100544507-100544529 GGAATAGAATTGACTGCAAAGGG - Intronic
959200501 3:103240458-103240480 GAAAGTGAGTTGAGTGTTAATGG - Intergenic
959750286 3:109826851-109826873 AGAACATATCTGAGTGCTAATGG + Intergenic
961143143 3:124572461-124572483 GGAACAGAATTTAGTTCTCAGGG + Intronic
961292572 3:125859549-125859571 GGCACAGAGTTGACAGCTACAGG + Intergenic
961894612 3:130156824-130156846 GGCACAGAGTTGACAGCTACAGG - Intergenic
965518868 3:169652658-169652680 GGAACAGAGTTGAGTGAGTTGGG + Intronic
965817507 3:172652337-172652359 GGAATAGAAATGTGTGCTAATGG + Intronic
968130861 3:196192147-196192169 ACAACACAGTTGAATGCTAATGG - Intergenic
969004709 4:4009916-4009938 GGCACAGAGTTGACAGCTACAGG - Intergenic
969809186 4:9634791-9634813 GGCACAGAGTTGACAGCTACAGG + Intergenic
970631372 4:17949785-17949807 GTAAAAGAGTTGAGTTTTAAAGG + Intronic
971356150 4:25896920-25896942 GCAACAGAGTTGAAAACTAAAGG + Intronic
971868000 4:32197220-32197242 GAAACAGAGATGACTGCAAAAGG + Intergenic
978936860 4:114388264-114388286 GGAACCCAGTTGAGTCCTCATGG + Intergenic
979625324 4:122838307-122838329 GGAACATAGTGCAGTGGTAAAGG - Intronic
980950292 4:139368859-139368881 GGAACAAATTTGAAAGCTAAAGG - Intronic
981294065 4:143109427-143109449 GGACCAGAGTTGAATGTGAAGGG - Intergenic
982445278 4:155483814-155483836 GGAATAGAGGAGAGTGCTGAAGG - Intergenic
982755962 4:159219111-159219133 GGAACAGAGTCAAGTCCTAGAGG - Intronic
984559258 4:181249710-181249732 GGAACATAGATGAGTGCTTCAGG + Intergenic
985278287 4:188260359-188260381 TCAACTGAGTTGTGTGCTAATGG - Intergenic
987811167 5:22838175-22838197 GAAATAGAGATGAGTGCTTAAGG - Intronic
988162359 5:27535944-27535966 AGAAAAGAGTAGAGTGCTAAGGG + Intergenic
988191265 5:27938482-27938504 GGAACAGATCTGTGTGTTAAGGG + Intergenic
990236666 5:53776202-53776224 TGAACTGAGTTGAGTTCTCATGG - Intergenic
992502788 5:77358315-77358337 GAAGCTGAGTTGAGTCCTAAAGG - Intronic
997384552 5:133462437-133462459 GCCACAGAGTTGAGTGTTAATGG - Intronic
999792064 5:154949907-154949929 GGTACAGAGTTGAGAAATAAGGG - Intronic
1000299353 5:159941885-159941907 GGAAATGAGATGACTGCTAATGG + Intronic
1001088351 5:168718170-168718192 GGAATAGAGTTGCCTGGTAAGGG + Intronic
1001878952 5:175226102-175226124 TGAACAGTTTTGAGTGATAAGGG + Intergenic
1002636831 5:180612796-180612818 GGAACAGAGCCGAGTGTTCAGGG - Intronic
1003922639 6:10847447-10847469 GGATCAGAGTTGGGAGCTGAGGG - Intronic
1004920008 6:20367479-20367501 GGACCAGAGTTGTGTGCTCATGG - Intergenic
1004980897 6:21022574-21022596 GGAGCAGAGTTTACTGGTAATGG - Intronic
1005894590 6:30167077-30167099 GGCACACTGTTGAGTGCTGAGGG - Intronic
1006386376 6:33733342-33733364 TGAACAGAGATCAGTGCTCAAGG + Intronic
1010668651 6:78659477-78659499 GGGACAGAGTTTAGTGTTCAGGG - Intergenic
1012812438 6:103977256-103977278 TTAACAGAGTTTAGTGCTGAGGG + Intergenic
1014199722 6:118595065-118595087 GGACCAGAGTTGAGTGACAGAGG - Intronic
1014480737 6:121933381-121933403 GGAACAGAGGTAAGTAATAAAGG - Intergenic
1014735439 6:125089660-125089682 GAGACAGACTTGAGTGTTAAAGG + Exonic
1015187909 6:130439618-130439640 GGAACAGATATGAATGCCAAGGG + Intronic
1016494049 6:144639527-144639549 GAAACAGATTTGAGTTTTAAAGG - Intronic
1016562481 6:145412544-145412566 AGAACAATGTTGAGAGCTAAAGG - Intergenic
1017228662 6:152048614-152048636 GGCACTGAGTTCAGTGCTGAAGG - Intronic
1019050261 6:169177105-169177127 AGAACTGAGTTGGGTGCTGAAGG + Intergenic
1021673859 7:23060928-23060950 GGAAGAGAGATGTTTGCTAATGG - Intergenic
1022411594 7:30142685-30142707 GGATCAGAGTTGCGTGCTGGGGG - Intronic
1022952111 7:35349062-35349084 GGAAGAGTGTTGAGTGGGAAAGG + Intergenic
1022998097 7:35779252-35779274 GGAAGACAGATGAGGGCTAAAGG + Intergenic
1023278076 7:38541881-38541903 GGAACAGAGGTAAGTGAGAAGGG + Intronic
1023611484 7:41976080-41976102 GGAATAGTGATGACTGCTAATGG - Intronic
1027620904 7:80483754-80483776 GGAAGAGACTTGAGTGAAAAAGG - Intronic
1030569347 7:111202793-111202815 GAAACAGAGATGAGTGTGAAGGG + Intronic
1030890859 7:114997262-114997284 GGTACATGGTTGAGTGCTATTGG + Intronic
1036677897 8:10850452-10850474 GGCACTGAAGTGAGTGCTAATGG - Intergenic
1036945363 8:13089881-13089903 AGAACAGAGAAGAGTGCAAAGGG + Intronic
1039742920 8:40398476-40398498 GGAAGAGAGTTCAGTGATGAGGG + Intergenic
1039851184 8:41366615-41366637 AGAACAGAGTTGAGAGATCACGG - Intergenic
1044413112 8:91906577-91906599 GGTACTGAGATGTGTGCTAAAGG - Intergenic
1046453740 8:114431058-114431080 GTAACTGAGTTATGTGCTAAAGG + Intergenic
1047355746 8:124119874-124119896 GGCACTGTGCTGAGTGCTAAGGG + Exonic
1047498547 8:125425839-125425861 GGAACACAGTTGCGTGGAAAGGG + Intergenic
1047695540 8:127400253-127400275 GGAACAGAGTTAGGTACAAAGGG + Intergenic
1049866967 8:144945677-144945699 GGACCAGAGTAGAGTCCTGAGGG + Intronic
1050739451 9:8803428-8803450 TGAACAGAGTAGATTACTAAAGG - Intronic
1053657576 9:40234170-40234192 GGAACAGAGCTGAGTAATAAGGG + Intronic
1053885379 9:42641587-42641609 GGATCAGAGTTGAGTGCCTGTGG - Intergenic
1053907938 9:42863447-42863469 GGAACAGAGCTGAGTAATAAGGG + Intergenic
1054224398 9:62449036-62449058 GGATCAGAGTTGAGTGCCTGTGG - Intergenic
1054358038 9:64082675-64082697 GGAACAGAGCTGAGTAATAAGGG + Intergenic
1054369700 9:64380441-64380463 GGAACAGAGCTGAGTAATAAGGG + Intronic
1054527020 9:66142058-66142080 GGAACAGAGCTGAGTAATAAGGG - Intronic
1054677327 9:67870194-67870216 GGAACAGAGCTGAGTAATAAGGG + Intronic
1203560426 Un_KI270744v1:50846-50868 GGAACAGAGCTGAGTAATAAGGG - Intergenic
1186613986 X:11167280-11167302 TTAACAGTGGTGAGTGCTAAGGG + Intronic
1189919989 X:45894167-45894189 GTAACATAGTTGAGTGATATGGG - Intergenic
1190297044 X:49033785-49033807 GGAAAAGAGTGGAGTGATCAGGG + Intronic
1190475920 X:50827328-50827350 GGAACAGAGTTGAGGGGGCATGG - Intergenic
1196961290 X:121005004-121005026 AAAACAGAGTTGAGAGCTCAAGG - Intergenic
1197175316 X:123479509-123479531 GCAACAGACTTGTGTGATAAAGG + Intronic
1201412467 Y:13713934-13713956 GGACCAGAGATGAAAGCTAAAGG + Intergenic