ID: 954297369

View in Genome Browser
Species Human (GRCh38)
Location 3:49681744-49681766
Sequence GAGGGCTGCCAGGCTGCAGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 595
Summary {0: 1, 1: 0, 2: 6, 3: 63, 4: 525}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954297369_954297379 17 Left 954297369 3:49681744-49681766 CCTGCTGCAGCCTGGCAGCCCTC 0: 1
1: 0
2: 6
3: 63
4: 525
Right 954297379 3:49681784-49681806 CCCATGGTGGTCATGCCCCACGG 0: 1
1: 0
2: 1
3: 13
4: 158
954297369_954297375 4 Left 954297369 3:49681744-49681766 CCTGCTGCAGCCTGGCAGCCCTC 0: 1
1: 0
2: 6
3: 63
4: 525
Right 954297375 3:49681771-49681793 TAAGACCCAAGTGCCCATGGTGG 0: 1
1: 0
2: 0
3: 13
4: 144
954297369_954297382 28 Left 954297369 3:49681744-49681766 CCTGCTGCAGCCTGGCAGCCCTC 0: 1
1: 0
2: 6
3: 63
4: 525
Right 954297382 3:49681795-49681817 CATGCCCCACGGTAGGCATCTGG 0: 1
1: 0
2: 0
3: 5
4: 50
954297369_954297381 21 Left 954297369 3:49681744-49681766 CCTGCTGCAGCCTGGCAGCCCTC 0: 1
1: 0
2: 6
3: 63
4: 525
Right 954297381 3:49681788-49681810 TGGTGGTCATGCCCCACGGTAGG 0: 1
1: 0
2: 0
3: 5
4: 67
954297369_954297374 1 Left 954297369 3:49681744-49681766 CCTGCTGCAGCCTGGCAGCCCTC 0: 1
1: 0
2: 6
3: 63
4: 525
Right 954297374 3:49681768-49681790 AGATAAGACCCAAGTGCCCATGG 0: 1
1: 0
2: 0
3: 11
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954297369 Original CRISPR GAGGGCTGCCAGGCTGCAGC AGG (reversed) Exonic
900110111 1:1001727-1001749 GGGGGCTGCGAGGCCGGAGCGGG + Intergenic
900337856 1:2173663-2173685 GAGGTCTCCCAGGCTGCCTCTGG - Intronic
900590863 1:3459230-3459252 CAGAGCTCCCAGGCTCCAGCAGG + Intronic
900610322 1:3541955-3541977 GGGGGCTTCCAGGGTGGAGCTGG - Intronic
900913765 1:5620285-5620307 GAGGAGGGCCAGGCTGCAGCGGG - Intergenic
900919405 1:5661258-5661280 GAATGGTGCCAGGCTGCAGGTGG - Intergenic
901021407 1:6257812-6257834 GAGGGCTGCCAGGCTGGGAAGGG - Intronic
901060147 1:6468121-6468143 GAGCTCTGACAGGCTGCGGCTGG + Exonic
901184462 1:7363846-7363868 GGGGGCTACCAGGGTGAAGCAGG - Intronic
901647354 1:10723812-10723834 GAGAGCAGCCAGGTTGCAGGGGG - Intronic
901720010 1:11189498-11189520 GAGGTCTGCAAAGCTGCAGCAGG - Exonic
901754833 1:11435151-11435173 CAAGCCTGCCAGGCTGCAGCGGG - Intergenic
902761175 1:18581623-18581645 GAGGGCTGCAGGGCTGCGGAAGG - Intergenic
902919959 1:19659844-19659866 GGGGACTGCAAGGCTGCAGGCGG + Intergenic
902954017 1:19912238-19912260 GATGGCTGGCAGCCTGCCGCAGG - Exonic
903281611 1:22253151-22253173 GTGGGCTGCCTGTCTGCAGCGGG + Intergenic
903707178 1:25294897-25294919 GAGGGCTGCAGGGGTGCAGCGGG + Intronic
903720061 1:25398445-25398467 GAGGGCTGCAGGGGTGCAGCGGG - Intronic
904143193 1:28369739-28369761 GTTGGCCGCCAGGCAGCAGCCGG - Intronic
904645141 1:31959892-31959914 TAGGGCTGCCAGTTTGCAGTTGG + Intergenic
905323267 1:37132499-37132521 GTGGGCTGCCAGGCTGGGTCAGG - Intergenic
905882930 1:41476261-41476283 CAGGGCTGTGAGGCTGCAGACGG - Intergenic
905912065 1:41662081-41662103 CTGGGCTGCCAGGCCGCGGCGGG + Intronic
906194589 1:43921835-43921857 GAGGGGAGCCAGGCTGCAAGGGG - Intronic
906298238 1:44662293-44662315 GAGGGCTGGCAGGTGTCAGCAGG - Intronic
907074204 1:51564128-51564150 GAGTGCTGTCAGGCTGGACCTGG + Intergenic
907153068 1:52306784-52306806 GCTCTCTGCCAGGCTGCAGCTGG - Intronic
910237184 1:85048232-85048254 GAGGGCAGGCGGGCTGGAGCTGG - Intronic
910949974 1:92635387-92635409 GGCGGCAGCGAGGCTGCAGCGGG - Intronic
911039673 1:93582024-93582046 GAGGGATGGCAGGCTGCTGCCGG - Intronic
911366642 1:96946710-96946732 CATTGCTGCCAGGCTGCAGAAGG - Intergenic
912551194 1:110486510-110486532 GAGGGCTGCAGGCCTGCAGAGGG + Intergenic
913714320 1:121519062-121519084 GAGGCCGGAGAGGCTGCAGCCGG + Intergenic
914171840 1:145232904-145232926 GCGGGCGGGCAGACTGCAGCCGG - Intergenic
915022782 1:152797036-152797058 GTGGGCTGCCAGAGTGGAGCAGG - Intronic
915102022 1:153507612-153507634 GAGGGATGGCAGGGGGCAGCAGG - Intergenic
915334074 1:155130391-155130413 GTGGGCAGTCAGGCTGGAGCCGG + Intronic
916212138 1:162367751-162367773 CAGGACTGCCAGGCTGCTGGAGG + Exonic
918523064 1:185436116-185436138 GTGCTCAGCCAGGCTGCAGCAGG - Intergenic
919751718 1:201041857-201041879 AAAGGCTGGGAGGCTGCAGCTGG - Intronic
921005837 1:211093091-211093113 ATGGGCTGCAGGGCTGCAGCTGG - Intronic
921046123 1:211479165-211479187 GAAGGTGGCCAGGCTGCCGCGGG + Exonic
921055626 1:211540454-211540476 GATGTCTGCCAGACTCCAGCTGG - Intergenic
922550098 1:226488435-226488457 CAGGGCTTCCAGGGGGCAGCAGG - Intergenic
922703937 1:227779079-227779101 GGTGGCTGCCATGCTGCAGAAGG - Intronic
922890587 1:229058792-229058814 GAGGGCTGGGAGGCTCCCGCTGG - Intergenic
922985735 1:229864864-229864886 GAGGGCTCCAAGGCTGCAGGAGG + Intergenic
923458512 1:234187158-234187180 TGGGGCTGGCAGGCAGCAGCTGG - Intronic
924715161 1:246566462-246566484 GCGGGCCGCCAGCCTCCAGCCGG + Exonic
924733115 1:246730349-246730371 GAGGACTTCCAGGGTGAAGCTGG - Intronic
1062916081 10:1242063-1242085 GGGGGCTGCCAGGGAGCAGATGG - Intronic
1064037381 10:11925780-11925802 AAGGTCAGCTAGGCTGCAGCAGG + Intronic
1065189821 10:23198996-23199018 GAGGGCTGAAAGGCGGCAGAAGG - Intergenic
1066454549 10:35561561-35561583 GAGGGCTCACAGGTTTCAGCTGG + Intronic
1067427634 10:46221668-46221690 AAGGGCAGCCAGGCCTCAGCAGG - Intergenic
1067709250 10:48635457-48635479 GAGGGCTGAGAGCCTGGAGCGGG - Intronic
1069683321 10:70300478-70300500 CAAGGCAGCCAGGCTGCTGCTGG + Exonic
1069945288 10:71981368-71981390 GAGGGCTGCGAGGCTGGGGAGGG - Intronic
1070547804 10:77466135-77466157 GAGGGCAGCCAGGCTTCAGAGGG - Intronic
1070799270 10:79235549-79235571 CAGGGCTGCCAGGGAGTAGCAGG - Intronic
1072378559 10:94841359-94841381 GAGGGATGGAAGTCTGCAGCGGG + Intronic
1073189843 10:101643492-101643514 GAGGGCACCCAGGATGCCGCAGG + Intronic
1074108320 10:110404921-110404943 GCGGGTGGCCAGCCTGCAGCAGG - Intergenic
1074702992 10:116108739-116108761 GTGGGCAGCAAGGCTGAAGCTGG - Intronic
1076546056 10:131246374-131246396 GAGGGCGGCCATGCTGGACCTGG + Intronic
1076763810 10:132619636-132619658 GAGGGCTGCACCCCTGCAGCAGG + Intronic
1077050815 11:565992-566014 CAGGGAAGCCAGGCAGCAGCAGG + Intergenic
1077225354 11:1437024-1437046 GAGGGCTGCCTGGATGGGGCTGG + Intronic
1077225764 11:1438498-1438520 CAGGGCTGCTGGGATGCAGCAGG - Intronic
1077278926 11:1733242-1733264 GCGGGCTGCGAGGCTGATGCGGG - Exonic
1077343592 11:2036637-2036659 GTTGGTTCCCAGGCTGCAGCTGG + Intergenic
1077356317 11:2120543-2120565 GAGGGCTGGCCGGCCCCAGCAGG - Intergenic
1077415830 11:2423877-2423899 GAGGTCAGCCAGGCTGGGGCTGG - Intergenic
1078821991 11:14891931-14891953 GAGGGCCGCCAGGCTGGCCCGGG - Intronic
1079032230 11:16994391-16994413 GAGTGCTGCCAGGCAGTAGTGGG + Intronic
1079136974 11:17780907-17780929 GAGGGCTGCCAGCCTTCGGGAGG + Intronic
1079690100 11:23406649-23406671 GGGGGCTCCCAGGCTCCAGCGGG - Intergenic
1079870825 11:25795321-25795343 GAATCCTGGCAGGCTGCAGCAGG + Intergenic
1081978128 11:47248751-47248773 GAGAGCCGCCCGGCTCCAGCCGG + Exonic
1083581190 11:63826676-63826698 GAAGGCTGCCTGGCTTCAGCTGG + Intronic
1083625170 11:64068710-64068732 GAGGGCAGAGAAGCTGCAGCTGG + Intronic
1083731910 11:64656834-64656856 GGGGGCTGGGAAGCTGCAGCAGG + Intronic
1083778871 11:64907807-64907829 GATCACTTCCAGGCTGCAGCGGG + Exonic
1083895687 11:65618728-65618750 GAGAGCTCCCGGGGTGCAGCAGG + Exonic
1084070625 11:66731580-66731602 GAGGGCCGTGAGGCTGCAGAAGG - Intergenic
1084097002 11:66918041-66918063 GAGGGCTCACAGGCTGCTGTGGG - Intronic
1084391820 11:68882337-68882359 GAGGGCTGCCATGACTCAGCAGG - Intergenic
1084564724 11:69922354-69922376 CAGAGCTTCCAGGCTGCAGCAGG + Intergenic
1084779226 11:71397678-71397700 GGGGGCTGCTGGGCTGCCGCTGG - Intergenic
1085048044 11:73364576-73364598 GAGCCCTGACACGCTGCAGCTGG + Exonic
1085298135 11:75442495-75442517 GAGCTCTGCCAGGCTGCAGATGG + Exonic
1087898040 11:103609614-103609636 GAGGACTGCAAGGCTGGAGAAGG - Intergenic
1088859210 11:113784140-113784162 GAGGGCTGCAAGCCACCAGCAGG - Intergenic
1089100925 11:115961795-115961817 AAGGCCTGGCAGGCTGCCGCAGG - Intergenic
1089596717 11:119585274-119585296 GACAGCTGCCAGGGAGCAGCAGG + Intergenic
1089787071 11:120915419-120915441 ATCGGCTGCCAGGCTGCGGCTGG + Intronic
1090243877 11:125202249-125202271 GGGGCCAGCCAGGCTGCAGCTGG + Intronic
1090636228 11:128692229-128692251 GAGGGCAGGCAGCCTGCCGCGGG + Intronic
1202826578 11_KI270721v1_random:91826-91848 GTTGGTTCCCAGGCTGCAGCTGG + Intergenic
1092996915 12:13959354-13959376 GAGGGAGGTCAGGCTGCAGAGGG + Intronic
1095953785 12:47795450-47795472 GTGGGGGGCCAGGGTGCAGCAGG + Intronic
1095981479 12:47977031-47977053 GAGGGCAGCCAGCCTCCAGGTGG - Intronic
1096078275 12:48818182-48818204 GAGGGGTCCCAGGCGACAGCAGG - Intronic
1096113398 12:49041556-49041578 TAGGGCAGTCAGGCTGCTGCAGG + Intronic
1096180937 12:49549989-49550011 GAGGCCTGCCAGGGTGGAGAGGG + Intronic
1096519635 12:52177358-52177380 GAGGTGTGCCTGGCTGCAGGGGG + Intronic
1096671161 12:53198982-53199004 CAGAGGTGCCAGGCTGGAGCTGG - Intronic
1096691604 12:53325260-53325282 GAGGACCGCGAGGCTGCGGCGGG + Intergenic
1099439768 12:82686574-82686596 AGGCGCTGCCAGGCAGCAGCGGG + Intergenic
1100246022 12:92757722-92757744 CAAGGCAGCCAGGCTCCAGCTGG - Intronic
1101036927 12:100716165-100716187 GAGGGCAGCCAGGCGGCGGCGGG - Intergenic
1101964516 12:109273417-109273439 GAGGGAGGCGTGGCTGCAGCGGG - Intergenic
1102203622 12:111075183-111075205 CAGGGGTGCCTGGCAGCAGCTGG - Intronic
1102261431 12:111445691-111445713 GAGGGCAGCCTGGCAGGAGCAGG - Intronic
1102430165 12:112876791-112876813 GGTGGCTGGCGGGCTGCAGCAGG - Exonic
1103954668 12:124569276-124569298 GAGGGCTGCCAGGCGGCCTGGGG - Intergenic
1104828770 12:131733806-131733828 GAGGGCTGCTGCGCTGCGGCAGG - Intronic
1104877263 12:132044236-132044258 GAGGGAGGCCCGGCTGCGGCTGG + Exonic
1105344418 13:19560348-19560370 GGGGGCTGCCCTGCTGCAACTGG - Intergenic
1107355285 13:39559711-39559733 GAGGAGTGCCAGGCTGCAAATGG + Intronic
1107410490 13:40153505-40153527 GAGTGCTGTCAGCCAGCAGCAGG + Intergenic
1107838747 13:44434703-44434725 GGGGGGAGCCAGTCTGCAGCTGG + Exonic
1109689467 13:65866721-65866743 AAGGGATGCCAGGGTGCAGAAGG - Intergenic
1111542437 13:89686875-89686897 AAGGGCTGTCAGACTGCACCTGG + Intergenic
1112155129 13:96808929-96808951 GAGCCCAGCCAGGCTACAGCAGG + Intronic
1112400921 13:99077638-99077660 AGGGGATGCCAGGTTGCAGCAGG + Intronic
1112652536 13:101415785-101415807 GTGGGCAGCCTGGCTCCAGCAGG - Intronic
1112793303 13:103027832-103027854 AAGGCCTCCCAGGCTCCAGCTGG + Intergenic
1112817775 13:103293211-103293233 GTGGGCTGCCAGGCTGGGGAGGG - Intergenic
1113569439 13:111343356-111343378 GGAGGCTGCCAGGCTGCTGTGGG + Intronic
1113579940 13:111421503-111421525 CAGGGCTGCCTGGCAGGAGCAGG + Intergenic
1113717171 13:112519629-112519651 CAGGGCTGCTAGGCTTAAGCTGG - Intronic
1113868503 13:113544182-113544204 GACGCCTGCCAGCCTGCAGGTGG - Intronic
1114254325 14:20988807-20988829 GAGAGCTGGCAGGCTGCAGTCGG + Intergenic
1115899603 14:38129905-38129927 GAGTGCTTCCGGGCGGCAGCAGG - Intergenic
1116521661 14:45855602-45855624 ATGGGCTGGCAGGCTGGAGCTGG - Intergenic
1117886745 14:60372003-60372025 GAGGGCTCCAACTCTGCAGCAGG - Intergenic
1118705557 14:68477295-68477317 GAGGGCTTCCTGGCTACAGATGG + Intronic
1119397521 14:74338305-74338327 GAGGGCTGTCAGGCTGATGCTGG - Intronic
1119857402 14:77910771-77910793 GGGGGCAGCTAGGCTGGAGCTGG + Intronic
1120704840 14:87735199-87735221 AAGGGCTCCCACGGTGCAGCGGG + Intergenic
1121311420 14:92937399-92937421 GGGGTCGGCCAGGCTGCAGGAGG + Exonic
1121952460 14:98183625-98183647 GAGAACTGCCAAGATGCAGCAGG + Intergenic
1122037958 14:98962075-98962097 CAGGTCTGCCAGGCTGGGGCTGG - Intergenic
1122122471 14:99561786-99561808 GAGGGATGCCAGGTGGGAGCAGG + Intronic
1122251486 14:100443067-100443089 GAGTCCTGCCCGGCTGCAGGTGG + Intronic
1122884142 14:104703087-104703109 CAGGGCTGCCAGGGTGGAGTGGG - Exonic
1123018285 14:105385847-105385869 GCGGGCTCTCAGCCTGCAGCTGG - Intronic
1123041949 14:105493936-105493958 GAGGGCGGGCAAGCTGCTGCGGG + Intronic
1123042931 14:105497831-105497853 GTGGGCTGTGAGGCTGCAGCAGG - Exonic
1123115696 14:105893079-105893101 GTGGCCTCCCAGTCTGCAGCCGG + Intergenic
1123119935 14:105911795-105911817 GTGGCCTCCCAGTCTGCAGCCGG + Intergenic
1123578738 15:21697240-21697262 GAGGGGTGCTTGGCTGCAGTTGG + Intergenic
1123615365 15:22139722-22139744 GAGGGGTGCTTGGCTGCAGTTGG + Intergenic
1124224780 15:27883627-27883649 CAGGGCTGCCTGCCTTCAGCCGG + Intronic
1124931754 15:34126757-34126779 GAGGGCTGCCTGACTGCAGCAGG + Intergenic
1126189066 15:45860727-45860749 GTGGGCTCTGAGGCTGCAGCAGG + Intergenic
1128087579 15:64896600-64896622 AAGGGCTGCCAGTCTGGAACTGG - Intronic
1128306901 15:66604622-66604644 CAGGGCTTCCTGGCTGCAGCGGG + Intronic
1128716767 15:69914297-69914319 GAGGGCTGCAGGGCAGGAGCAGG - Intergenic
1129672258 15:77613884-77613906 GAGGGCTGGCGGGGGGCAGCAGG + Exonic
1131068704 15:89450488-89450510 GAGGGCTGCAAGCCTGCTCCAGG - Intergenic
1131493149 15:92880446-92880468 GAGGGCTCCCAGGTGGCATCAGG + Intergenic
1131668023 15:94590812-94590834 GGGGGCTGCCAGGATGCAGGTGG - Intergenic
1132113343 15:99118062-99118084 CAGGGCTGGGAGTCTGCAGCGGG - Intronic
1202987608 15_KI270727v1_random:431485-431507 GAGGGGTGCTTGGCTGCAGTTGG + Intergenic
1132547758 16:541084-541106 AGGGCCTGCCAGGCTGCACCTGG + Intronic
1132627340 16:897767-897789 GAGGGTGGCCCAGCTGCAGCAGG + Intronic
1132654871 16:1037517-1037539 GAGGGCTGGCAGTCTCCAGGCGG - Intergenic
1132865638 16:2091486-2091508 GAGGGCGGCCAGGGCGCGGCCGG + Exonic
1132882267 16:2167688-2167710 GAAGGCCGCCTGGCAGCAGCTGG - Intronic
1133201186 16:4205650-4205672 AAGGGGTGTCTGGCTGCAGCTGG + Intronic
1134178790 16:12030836-12030858 CAGGGCTGACAGGCAGCGGCAGG + Intronic
1134388345 16:13795086-13795108 GATGGTTGGCTGGCTGCAGCAGG + Intergenic
1134430527 16:14200347-14200369 TAGGGCCGCCATGTTGCAGCAGG + Intronic
1135305532 16:21364578-21364600 CAGGGCTGACAGGCAGCGGCAGG + Intergenic
1136088599 16:27902911-27902933 GTCGGGTGCCATGCTGCAGCTGG + Intronic
1136246723 16:28980470-28980492 GAGGGCAGCCAGTCTCCTGCAGG - Intronic
1136302273 16:29343731-29343753 CAGGGCTGACAGGCAGCGGCAGG + Intergenic
1136561370 16:31041077-31041099 GAGGGTTACCTGGCTGAAGCAGG + Intronic
1136993788 16:35173788-35173810 CAGGGCCGCCGGGCTGAAGCAGG + Intergenic
1137268368 16:46886234-46886256 GATGTCTGGCAGGCTGGAGCTGG + Intronic
1137675337 16:50301219-50301241 GAGGGCTCAGAGGCCGCAGCTGG + Intronic
1138514873 16:57530509-57530531 GAGGGCTGCCAGGCAGCCTTGGG - Intronic
1141028702 16:80570388-80570410 AAGGGCTGGCGGGCTGCAGGTGG - Intergenic
1141072884 16:80974053-80974075 GAGGGCTTCCGGGTTGCTGCTGG - Exonic
1141184047 16:81774493-81774515 GAGGCCTGCCAGCCAGCAGCTGG + Intronic
1141601081 16:85126806-85126828 GGGAGCTGCCAGGCGGCAGGGGG + Intergenic
1141828395 16:86496464-86496486 CAGGGCAGCCAGGCTGATGCGGG - Intergenic
1141992452 16:87618318-87618340 GAGGGAGGCCGGGCAGCAGCTGG + Intronic
1142231411 16:88901871-88901893 GTGGCCGGCCAGGCTGGAGCTGG + Intronic
1142378435 16:89718620-89718642 GATGGGTGCCAGGCTTCGGCGGG - Intronic
1143209999 17:5179093-5179115 GAGGCCTGCCCTGCTGCTGCTGG - Intergenic
1143670508 17:8392940-8392962 GAGCTCTGCCAGGCTGCGGCGGG + Exonic
1143907982 17:10225086-10225108 CAGGGATGCCAGTCTGCAGCTGG + Intergenic
1144473335 17:15563436-15563458 TAGGGCCGCCATGTTGCAGCAGG - Exonic
1144583008 17:16470569-16470591 GGGGGATGCCAGGCCTCAGCTGG + Intronic
1144675371 17:17158363-17158385 GTGGCCTGCCAGGCAGAAGCTGG - Intronic
1144698467 17:17321579-17321601 GAGAGCTGCCAGGCAGCTGCAGG + Intronic
1144762016 17:17712416-17712438 GAGGCCTGTGTGGCTGCAGCGGG + Intronic
1144770618 17:17757452-17757474 GGGGACAGCCTGGCTGCAGCGGG + Intronic
1144923147 17:18781284-18781306 TAGGGCCGCCATGTTGCAGCAGG + Exonic
1145219195 17:21074506-21074528 GTGGGAGGCCAGGCTCCAGCAGG - Intergenic
1145281989 17:21474991-21475013 GAGGCCAGCCAGGCTGGAGTGGG - Intergenic
1145934663 17:28707880-28707902 GATGGCTGCCATGTTGCAGGTGG - Intronic
1146658513 17:34649359-34649381 GAGGACTCCCAGGCTGAGGCGGG + Intergenic
1147926112 17:43946981-43947003 GACGGCTGCCAGCTTGCTGCAGG - Intergenic
1148150676 17:45395080-45395102 GAGGGCTTCCTGGCTGCTTCTGG - Exonic
1148485355 17:47987404-47987426 GAGGGCATCAAGGCTGCTGCAGG + Intergenic
1148493425 17:48037677-48037699 GAGGGCTCCCCGGCTCGAGCAGG + Exonic
1148714819 17:49708333-49708355 GCGGGCGGCCAGGCTTCTGCTGG + Intronic
1148791897 17:50177974-50177996 AAGAGCTGCCTGGCTGCAGGGGG - Intergenic
1148804677 17:50258136-50258158 AAGTGCTGTCAAGCTGCAGCAGG + Intergenic
1150132229 17:62675397-62675419 GAGAGCTGCCAGGATGGAGAGGG - Intronic
1150640705 17:66947640-66947662 GGGCCCTGCCAGGCTGCAGCTGG - Intergenic
1151240590 17:72754655-72754677 CAGGGGTGCCGGGCCGCAGCCGG + Intronic
1151620755 17:75243409-75243431 GAGGGCTGCCTGGAGGCTGCGGG + Intronic
1151800598 17:76377145-76377167 GAATTCTGCCAGGCTGCAGATGG + Intronic
1152041986 17:77909532-77909554 GACGCCAGCCAGGCTGGAGCAGG + Intergenic
1152105798 17:78328137-78328159 GAGGGGTTCCAGGCTGTACCTGG - Intergenic
1152522164 17:80862906-80862928 GAGGGCCGGCTGGCGGCAGCAGG - Intronic
1152573074 17:81128944-81128966 GTGGGATGCCAGCCTGCGGCAGG - Intronic
1152701438 17:81821807-81821829 ACTGGCTGCCAGGCGGCAGCTGG + Intergenic
1152716959 17:81904868-81904890 GGAGGCTGCCAGGCAGCAGGCGG - Exonic
1152891260 17:82882910-82882932 CCGCGCTGCCAGGCTGGAGCGGG + Intronic
1152891267 17:82882942-82882964 CTGCGCTGCCAGGCTGGAGCGGG + Intronic
1153265161 18:3262335-3262357 CAGGGCGGCCAGGCGGCGGCAGG + Intronic
1153913214 18:9721993-9722015 GAGGTCTGTGAGGCTGGAGCAGG + Intronic
1156233997 18:35183401-35183423 GAGGGCTGCATTGCTGCTGCAGG + Intergenic
1156507783 18:37609433-37609455 CAGGCCTCACAGGCTGCAGCTGG + Intergenic
1157226156 18:45866546-45866568 GAGGGCTGCCAGCAAGCTGCTGG - Intronic
1157304477 18:46507224-46507246 GAGGGGTGCCAGGCAGCAGAAGG + Intronic
1158841998 18:61397396-61397418 CAGGGCTGCGGGGCTGCAGCAGG - Intronic
1159053898 18:63446494-63446516 GAGGTCTGCCTGCCTGGAGCTGG + Intergenic
1160151573 18:76399046-76399068 GCGGGCTGCCAGGATGCCTCGGG - Intronic
1160408635 18:78659920-78659942 GGAGGCTGCGAGGCTGCGGCTGG + Intergenic
1160486700 18:79299882-79299904 GAGAGCTGCCCATCTGCAGCAGG - Intronic
1160764439 19:801148-801170 CAGGACTTCCAGTCTGCAGCTGG - Intronic
1160873180 19:1286116-1286138 GAAGGCTGGCAGGCGGCGGCCGG + Intergenic
1161087236 19:2340790-2340812 GGGGGCTGCCACTCTGCAGGGGG + Intronic
1161232288 19:3180262-3180284 TAGGGCTCCCAGGCTGCAAGGGG + Exonic
1161328573 19:3675415-3675437 AAGGGCAGCCAGTCTGCTGCAGG + Intronic
1161346254 19:3770259-3770281 GAGGGCTGCGAGGCTGTGGGTGG - Exonic
1161365681 19:3878028-3878050 GAGCCCTGCCTGGGTGCAGCGGG - Intergenic
1161366163 19:3880941-3880963 GAGCCCTGCCCGGGTGCAGCTGG - Exonic
1161620031 19:5292957-5292979 GGGGGGCGCCAGGCAGCAGCAGG + Intronic
1161727150 19:5936156-5936178 GAAGGCAGCCTGGCTGGAGCTGG + Intronic
1161779262 19:6280087-6280109 GGGGCCTGCCGGGCTGCGGCCGG + Intergenic
1162296930 19:9819660-9819682 GACGGAAACCAGGCTGCAGCAGG + Intronic
1162664926 19:12202356-12202378 GCAGGGTGCCAGGGTGCAGCGGG + Intergenic
1162906227 19:13825716-13825738 GAGGGCTGCCAGGTGGATGCGGG + Intronic
1163125631 19:15242960-15242982 GAGGCTTGGCAGGCTGCGGCGGG + Exonic
1163152264 19:15422506-15422528 GGGGGCTCCCAGGCCCCAGCAGG + Exonic
1163650536 19:18515333-18515355 GTGGGCTGCCAGGAGGCATCAGG - Intronic
1164557339 19:29263669-29263691 GAGCTCTCCCAGGCTGCAGCGGG - Intergenic
1164576204 19:29406927-29406949 AGGGGCTGACAGCCTGCAGCAGG - Intergenic
1164601161 19:29564589-29564611 GCAGGCAGCCAGGCTGCAGTGGG - Intergenic
1164783935 19:30914452-30914474 GAAGCCTGCCAGGGTGCTGCTGG + Intergenic
1165074310 19:33272453-33272475 GAGGGGTGTCTGGCTGCACCTGG + Intergenic
1165093872 19:33400259-33400281 GAGGGACTCCAGGCTGCAGAAGG + Intronic
1165166851 19:33863177-33863199 GAGGCCAGGCAGGCTGGAGCAGG + Intergenic
1165821008 19:38676049-38676071 CAGGGCTGTCAGGATGCAGCGGG + Intronic
1165858584 19:38894758-38894780 GAGACCTGCCAGTCTGGAGCTGG - Intronic
1166254105 19:41590087-41590109 GAGTCCACCCAGGCTGCAGCTGG - Intronic
1166391352 19:42410565-42410587 GAGGTGCGCCAGGCAGCAGCGGG + Exonic
1166409446 19:42546932-42546954 GAGGCCATCCAGGCTGCAGCTGG + Intronic
1166442272 19:42825256-42825278 GAAGGCTGGCAGGGTGCAGGTGG + Intronic
1166461718 19:42993565-42993587 GAAGGCTGGCAGGGTGCAGGTGG + Intronic
1166478999 19:43153523-43153545 GAAGGCTGGCAGGGTGCAGGTGG + Intronic
1166631150 19:44409182-44409204 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632027 19:44415309-44415331 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632455 19:44418994-44419016 GAGGGTTGCAAGGATGCTGCTGG + Intronic
1166637024 19:44459399-44459421 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
1166782802 19:45351196-45351218 GTTGGCTGCCAGGCTGGACCTGG + Exonic
1166819888 19:45571560-45571582 TATGGCAGCCAGGCTGCTGCTGG - Intronic
1166859069 19:45799273-45799295 GAGGGCTGCCAGGTGCCTGCGGG + Intronic
1167010010 19:46801144-46801166 GGGGCCTGCCACCCTGCAGCTGG - Intergenic
926784970 2:16509581-16509603 GAAGGCTGCCCGGCTGCTCCTGG + Intergenic
926911335 2:17854062-17854084 GAGGGCTACCAGGCTGAGCCAGG + Intergenic
927875258 2:26650995-26651017 GAGGGCAGCCAGGCTGGAGAGGG + Intergenic
928122047 2:28590644-28590666 GAGGGCTCCCAGGCTGACACTGG + Intronic
928438565 2:31272482-31272504 GAGGGGACCTAGGCTGCAGCAGG + Intergenic
928442542 2:31304080-31304102 GAGGCCTCCCAGGCCCCAGCAGG - Intergenic
929348259 2:40914653-40914675 GTTGGCAGCCAGGCTGCAACTGG + Intergenic
931462043 2:62457633-62457655 GTGGGCTGCCTGGGTGCAGAGGG + Intergenic
931996099 2:67840663-67840685 GACTGCAGCCAGGCTGCAGAGGG - Intergenic
932417619 2:71583385-71583407 GAGGGTAGCCAGCCTCCAGCTGG + Intronic
932749879 2:74364742-74364764 GAGGGTTGTCAGCCAGCAGCAGG - Intronic
934619242 2:95794004-95794026 GAGTGCTATGAGGCTGCAGCAGG - Intergenic
934641650 2:96030553-96030575 GAGTGCTATGAGGCTGCAGCAGG + Intronic
935232763 2:101113554-101113576 CAGGGCTGTCAGGCTGCAGGCGG - Intronic
935591844 2:104852333-104852355 GGGGGCTGCCTGGCTGCGGCTGG + Intergenic
935660258 2:105460686-105460708 CAGGGCTGCCCGTCTGCAGCTGG + Intergenic
936048386 2:109203876-109203898 AAGGGCTGCCAGGCCGCACAGGG - Intronic
936329063 2:111531688-111531710 GAGGACTGCCTGGAGGCAGCAGG - Intergenic
936500456 2:113062299-113062321 GTGGGCTGCCCGGCTTCAGTAGG - Intronic
936622673 2:114116832-114116854 GAGGGAAGCCAGGCTGTGGCTGG + Intergenic
937140476 2:119595908-119595930 CAGGGCTGCAAGGCTGGAACAGG + Intronic
937910770 2:127074466-127074488 GCGGGCTGCCAGGTGGCTGCTGG - Intronic
937958225 2:127435415-127435437 GAGGGCTGCAAGGGTGAAGCTGG - Intergenic
938406973 2:131038231-131038253 CTGGGCTGCAAGGCTGCAGGAGG - Intronic
938406980 2:131038260-131038282 GAGGGCTGCAAGGCTGCAGGAGG - Intronic
938406995 2:131038322-131038344 GGGGGCTGCAAGGCTGCAGGAGG - Intronic
938407006 2:131038353-131038375 CTGGGCTGCAAGGCTGCAGGAGG - Intronic
938407013 2:131038382-131038404 GAGGGCTGCAAGGCTGCAGGAGG - Intronic
938407020 2:131038413-131038435 GGGCGCTGCAAGGCTGCAGGAGG - Intronic
938407027 2:131038444-131038466 CTGGGCTGCAAGGCTGCAGGAGG - Intronic
938407034 2:131038473-131038495 GAGGGCTGCAAGGCTGCAGGAGG - Intronic
938407052 2:131038535-131038557 GGGGGCTGCAAGGCTGCAGGAGG - Intronic
938540996 2:132283388-132283410 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
938583399 2:132668380-132668402 GAGGGCTGCCAGGCTCTTACCGG + Exonic
938799085 2:134743627-134743649 GAGTTCTGGAAGGCTGCAGCTGG - Intergenic
941099481 2:161280937-161280959 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
941155386 2:161971694-161971716 CAGTGCTGCCGGGATGCAGCCGG + Intronic
943618082 2:190116559-190116581 GAGGGCTAGCAGGCTACAACTGG - Intronic
945116261 2:206410864-206410886 CCGAGCTGCCAGCCTGCAGCTGG + Intergenic
946309687 2:218876469-218876491 GAGGGGTGTCAGGCTGCAGTGGG + Intergenic
947566695 2:231198711-231198733 GAGGGTGGCCCGGCTGCATCCGG - Intronic
947579863 2:231308401-231308423 GAGAGCCTGCAGGCTGCAGCGGG + Intronic
948280528 2:236743981-236744003 CAGTGATGCCAGGTTGCAGCTGG - Intergenic
948404178 2:237705060-237705082 GAGGCCTGCAAGTCTGGAGCAGG + Intronic
948524109 2:238559884-238559906 GCTGGCTGCCAGGCTGCACCAGG - Intergenic
948676858 2:239601958-239601980 GGTGGCTGGCTGGCTGCAGCTGG - Intergenic
948703971 2:239778153-239778175 GAGGGGTGCCACGCTGGAACTGG + Intronic
1168892058 20:1300991-1301013 AGGAGCTGCCAGGCTGAAGCTGG - Intronic
1169520630 20:6368980-6369002 ATGGGCTGGCAGGCTGGAGCTGG - Intergenic
1170550045 20:17468727-17468749 GTGGGCTGCCTGTCTACAGCAGG - Intronic
1171256196 20:23690651-23690673 GGGGGCTGCCAGGGTGGGGCGGG - Intergenic
1171456972 20:25277631-25277653 GAGGGCTGACGGGCTCCAGCTGG - Intronic
1171869905 20:30516393-30516415 GAGGGTTGCAAGGGTGCTGCTGG - Intergenic
1172436016 20:34929453-34929475 CAGGGCTGCCAGGCCGTAGCAGG + Exonic
1172838171 20:37886345-37886367 GCTGGCTGCCAGGCTGCCACGGG + Intergenic
1172978757 20:38925816-38925838 TAGGGCTGCCGGGGTGCAGGTGG + Intergenic
1173202052 20:40961468-40961490 GAGGGCTGAGAGGCTGCTGAGGG - Intergenic
1173352657 20:42259522-42259544 GAGGGCTGCCAAGACCCAGCTGG + Intronic
1173577591 20:44123171-44123193 AAGGGCTGATAGGATGCAGCGGG - Intronic
1174157972 20:48528874-48528896 GAGAGCAGCCAGGCAGGAGCAGG + Intergenic
1174338709 20:49882910-49882932 TAGGGCAGCCAGGCTGCTGCAGG - Intronic
1174368274 20:50069387-50069409 GAGGGCAGGCAGGCAGCAGTGGG - Intergenic
1174408112 20:50316110-50316132 GGGGTCAGCCAGACTGCAGCAGG - Intergenic
1174458750 20:50668094-50668116 GAGGGCAGCCAGGGAACAGCAGG - Intronic
1174607692 20:51772839-51772861 GATGGATGACAGGCTGGAGCCGG + Intergenic
1175229447 20:57464420-57464442 GAAAGCTGTCAGGCTGAAGCGGG + Intergenic
1175754689 20:61522135-61522157 GGGAGCTGCCAAGCTGAAGCAGG - Intronic
1175883830 20:62276851-62276873 GAAGGCTGGCAGGCAGCAACAGG - Intronic
1175980210 20:62735019-62735041 GCGGGGTGCCAGGCACCAGCCGG + Intronic
1175985897 20:62764041-62764063 GGGGGCAGCCAGGTGGCAGCAGG + Intergenic
1176109118 20:63403141-63403163 GATGGCTGCCAGGCTGTGGGAGG + Intergenic
1176164469 20:63665469-63665491 CAGGGCTGCCATGCTGCAGAGGG + Intronic
1176242525 20:64081652-64081674 GAGGGCTGTCAGGGCGCAGAGGG - Intronic
1176723684 21:10413145-10413167 GAGGCCAGCCACGGTGCAGCAGG + Intergenic
1177455545 21:21332767-21332789 GAGAGTTTTCAGGCTGCAGCTGG - Intronic
1178915637 21:36704421-36704443 GAAGCCTGCCAGGCTGCAGCTGG + Intronic
1178925715 21:36773351-36773373 GAGGGCTGGCAGTCTGCCACTGG + Intronic
1179536338 21:42055254-42055276 GAGGTATGACAGGCTGCAGATGG + Intergenic
1179883251 21:44302135-44302157 CAGCGCTTCCTGGCTGCAGCTGG + Intronic
1180115846 21:45704443-45704465 GCGGCCTCCCAGTCTGCAGCTGG - Intronic
1180187574 21:46147076-46147098 AAGGCCTGCCAGCCTGGAGCTGG + Intronic
1180304840 22:11065922-11065944 GAGGCCAGCCACGGTGCAGCAGG + Intergenic
1180754328 22:18149945-18149967 GAGGGCTGGAAGTCTGGAGCAGG + Exonic
1181050105 22:20234364-20234386 GAGGGGTCCTCGGCTGCAGCAGG + Intergenic
1181277708 22:21697010-21697032 CAGGGATGACAGGCTGCAGAGGG - Exonic
1181372253 22:22427837-22427859 GAGGGCTCCCTGGCTTCTGCTGG - Intergenic
1181609879 22:24005215-24005237 CAGGCCTGCCAGGCAGCAGTGGG + Intergenic
1182025033 22:27111281-27111303 TAGGGCTCCCAGTCTGCTGCTGG + Intergenic
1182257845 22:29050839-29050861 GAGGGCAGCCAGGCCGCAGTAGG - Exonic
1183094560 22:35544331-35544353 GGGGGCTGCCAGACCACAGCAGG - Intronic
1183275694 22:36896160-36896182 GAGGGCTCCCCTCCTGCAGCAGG - Intergenic
1183958859 22:41398821-41398843 GAGGGCTGCCCAGCTTCAGAGGG - Exonic
1184262831 22:43329159-43329181 AGGGGCTGCCAGCCTGGAGCGGG + Intronic
1184330380 22:43823503-43823525 GTGGGGGGCCTGGCTGCAGCTGG - Intergenic
1184333574 22:43840615-43840637 GGGTGCTGCCAGGCTGGCGCTGG + Intronic
1184562249 22:45269807-45269829 GGGGGCTGACAGGCTGGGGCAGG - Intergenic
1184665007 22:45983699-45983721 GGGGGCTGGCAGGCTGGAGGGGG + Intergenic
1184668753 22:46002022-46002044 TGGGGCCGCCAGGCTGCAGGGGG - Intergenic
1184714611 22:46273776-46273798 GGGGCCAGCCAGGCAGCAGCAGG - Intronic
1184860937 22:47173065-47173087 GGAGGCTGCAAAGCTGCAGCAGG + Intronic
1185141005 22:49101297-49101319 GAGGGACCCCAGGCTGCAGGGGG + Intergenic
1185311789 22:50160145-50160167 GAGGGCTCCCTGTCTGCAGATGG + Intronic
1185393083 22:50573146-50573168 GTGGGGTGCCAGGCTGGACCTGG + Intronic
1185402927 22:50627808-50627830 GAGGGCTACTTGGCTCCAGCAGG + Exonic
949668360 3:6367966-6367988 GAGGAATGCCAGGCTGCACTGGG + Intergenic
950812665 3:15664374-15664396 GGTGGCTGCTAGGCTGCAACAGG + Intergenic
952238686 3:31507341-31507363 GAGGGCTGCCCAGCAGGAGCTGG + Intergenic
953528270 3:43713606-43713628 GAGGGCTGAAAGACTGCAGGTGG - Intronic
954293676 3:49662683-49662705 AAGGGCAGCCTGCCTGCAGCAGG - Intronic
954297369 3:49681744-49681766 GAGGGCTGCCAGGCTGCAGCAGG - Exonic
954839129 3:53495565-53495587 GAGGGCCGCAAGTCTTCAGCCGG + Intronic
956716928 3:72087411-72087433 GATGGCAGACAGGCTGGAGCAGG + Intergenic
958912048 3:100005034-100005056 AAGGGGTGCCAGAATGCAGCAGG + Intronic
960011263 3:112836084-112836106 GTGGGCTCCCAGGATGAAGCAGG + Intronic
960287933 3:115850786-115850808 GAGGTCTGCAAGGCTGGAGAAGG + Intronic
960416214 3:117388407-117388429 GATGGCCACAAGGCTGCAGCAGG - Intergenic
961329261 3:126129149-126129171 GAGAGGAGCCAGGCTGCAGGTGG - Intronic
962240940 3:133750416-133750438 GAGGGAAGCCAGGCTGCATCTGG - Intronic
966754528 3:183355989-183356011 GAGGTTTGCAAGGCTGCAGATGG - Intronic
967102330 3:186225908-186225930 AAGGGCTGACCAGCTGCAGCAGG + Intronic
968377210 4:53586-53608 GAGGGCTGAGAGGCGGCAGCGGG - Intronic
968393556 4:212883-212905 GAGGGCTGAGCGGCGGCAGCGGG - Intergenic
968506873 4:974772-974794 GAGGGCTGCCTGGGGGCAGCAGG + Intronic
968529782 4:1085525-1085547 GCAGGCAGCCAGGCTGCAGGTGG + Intronic
968758286 4:2427925-2427947 GCTGGCTGCCAGGCCCCAGCCGG - Intronic
968894637 4:3391810-3391832 GAGGGCTGCCTGGGTGCTCCAGG + Intronic
968971195 4:3796120-3796142 GAGGTTTGCCAGGCTGGAGCTGG - Intergenic
969095511 4:4729513-4729535 AGGGGCTGCCAGCCTGCCGCTGG - Intergenic
969108728 4:4828178-4828200 GGGGCTAGCCAGGCTGCAGCAGG - Intergenic
969695292 4:8730844-8730866 GAGAACTCCCAGGCTGCACCAGG + Intergenic
970882125 4:20944713-20944735 GAGGGCTACCTGGCAGCAGATGG - Intronic
971478409 4:27093046-27093068 GAGGGCTGCCAAGCAGCAGCAGG + Intergenic
971938975 4:33189434-33189456 GAGGGCTGCCAGGATGGGGCTGG - Intergenic
973569507 4:52223939-52223961 GGGGGCAGCCAGGCTGGGGCAGG - Intergenic
973732106 4:53832740-53832762 GAGGGCTCCAACGCTACAGCAGG - Intronic
975403726 4:73965891-73965913 GAGGGCTGACTAGATGCAGCTGG - Intergenic
977787254 4:101051035-101051057 GAGAGCAGCCAGGATGCTGCTGG + Intronic
977967304 4:103168095-103168117 GAGAGCAGGGAGGCTGCAGCAGG - Intronic
978372939 4:108047265-108047287 GAGGGTTGCCAGGATTCAGATGG - Intergenic
979448115 4:120838988-120839010 GCTCTCTGCCAGGCTGCAGCTGG + Intronic
979644623 4:123053685-123053707 GATAGCTCCCAGACTGCAGCAGG + Intronic
980153696 4:129079801-129079823 GAGGGCTGCGCCCCTGCAGCAGG + Intronic
981147635 4:141343614-141343636 GAGGGAAGCCAGGATGCAGGTGG + Intergenic
981889332 4:149716602-149716624 CAAGCCTGCCCGGCTGCAGCCGG + Intergenic
983651448 4:170040490-170040512 GAGGGCCGGAAGGCTGCAGGAGG + Intergenic
985577600 5:680889-680911 GAAGTCAGCCAGGCTGCTGCTGG + Intronic
985586002 5:734676-734698 CAGGGCTACCAGGCTGGTGCTGG - Intronic
985592530 5:772987-773009 GAAGACAGCCAGGCTGCTGCTGG + Intergenic
985600421 5:826088-826110 CAGGGCTACCAGGCTGGTGCTGG - Intronic
985613942 5:908163-908185 GAGGGCAGCCCGGCTGTAGGAGG - Intronic
985681234 5:1256971-1256993 CACGGCAGCCAGGCTGCAGTGGG - Intronic
985703914 5:1389753-1389775 GAGGGCTGCCAGCCATCACCAGG - Intergenic
985812864 5:2103119-2103141 GAGGGTGGCCAGGCAGCAGGAGG + Intergenic
985946409 5:3188164-3188186 CTGTGCTCCCAGGCTGCAGCTGG + Intergenic
986495595 5:8338647-8338669 CAGTGTTGCCAGGCTGGAGCTGG - Intergenic
987983894 5:25121655-25121677 GAGGGCTCCATGCCTGCAGCGGG + Intergenic
988936861 5:36092588-36092610 GAGCATTGCCAGGCTGCTGCTGG - Intergenic
989963425 5:50441420-50441442 GAGGCCGGAGAGGCTGCAGCCGG - Intronic
990389728 5:55307163-55307185 GAGAAATGCCAGGCTGCAACAGG + Intronic
990545165 5:56815359-56815381 GAGGGCGGCCCGGCGGCCGCAGG - Intergenic
991359163 5:65802343-65802365 GCTGCCTGCAAGGCTGCAGCCGG + Intronic
993351508 5:86855731-86855753 CAGGGCAGGCAGGCTGCAGATGG - Intergenic
994819248 5:104627857-104627879 GAGGGTTTCCAGGCTTCAGGGGG - Intergenic
995410038 5:111846590-111846612 GAGGGCTGCCTGGATACTGCTGG + Intronic
996133327 5:119809030-119809052 GAGGTCTGCCAGGCCCCAGGTGG + Intergenic
997232481 5:132254757-132254779 CAGGGCTGGCAGGCTCCAGCAGG - Intronic
998544445 5:143014679-143014701 GAGTGCTTACAGGCAGCAGCAGG - Intronic
999770675 5:154773419-154773441 GAGGGCTCACAGGTAGCAGCTGG - Intronic
1000923632 5:167167593-167167615 GAGGCCTGCCAGGATGCACTAGG + Intergenic
1001570245 5:172726002-172726024 GAGGCCAGCATGGCTGCAGCGGG - Intergenic
1001886014 5:175291029-175291051 GAGGGCTGCCATGCTGAATTTGG - Intergenic
1001972571 5:175968177-175968199 GAGGGCCCCATGGCTGCAGCGGG + Exonic
1002059003 5:176615302-176615324 GAGGGCTGCCAAGGAGCAGCTGG - Intergenic
1002229744 5:177754094-177754116 AAGGGATGACAGGCTGCACCTGG + Intronic
1002244870 5:177875604-177875626 GAGGGCCCCATGGCTGCAGCGGG - Intergenic
1002328631 5:178426601-178426623 GTGGGGTGGCAGGCTGCAGGGGG - Intronic
1002381486 5:178832522-178832544 GAGGCCTGCCTGGCTGCGGTTGG - Intergenic
1002441878 5:179268647-179268669 GAGGACTGCCAGGCTGAGACTGG + Intronic
1002640987 5:180630522-180630544 GAGGCGGGCCAGGCTGGAGCAGG - Intronic
1003183874 6:3813949-3813971 GCGGGCTCCCAGGATGCAGCAGG + Intergenic
1004562380 6:16762026-16762048 AAGGGCTGTCAGGCTTCAGCTGG + Intergenic
1004883119 6:20028140-20028162 GAGGGCTGCTAGGGTGGAGCAGG - Intergenic
1005990346 6:30898319-30898341 GAGGACAGCCAGGTTGGAGCAGG + Intronic
1006025601 6:31144918-31144940 GGAGGCTGCCAGTCTGCGGCAGG - Exonic
1006171315 6:32095049-32095071 GAGAGATGCCAGGCTCCAGGAGG - Intronic
1006373094 6:33657404-33657426 GAGGGCTGCCTGGAGGCAGTGGG + Intronic
1006848243 6:37078126-37078148 GGGAGCAGCCAGGCTGCAGCTGG + Intergenic
1007400524 6:41600023-41600045 GAGGGCTTCCAGCCTGGGGCCGG - Exonic
1007420423 6:41715891-41715913 GATGTCTGCAAGGCTGCAGTGGG - Intronic
1007633269 6:43284239-43284261 GCGGGCTGCTGGGCTGCAACAGG - Exonic
1007661502 6:43489596-43489618 CACTGCTGCCAGGCTGCACCAGG - Intronic
1010985028 6:82413713-82413735 GAGGGGTCCCAGGCTGGTGCAGG + Intergenic
1013600645 6:111701343-111701365 GGGGGCTGCCAGGAGGGAGCGGG - Intronic
1015252582 6:131142583-131142605 GAGGGCTCCACTGCTGCAGCAGG - Intronic
1016992978 6:149942434-149942456 TGGGACTGCCAGGCTGCACCAGG - Intronic
1019144968 6:169970638-169970660 GATGGCTGCCAGGATGCATGTGG + Intergenic
1019212845 6:170420471-170420493 GAGGGTTGCCAGGGTGCTGTGGG + Intergenic
1019275496 7:173463-173485 GCTGGCTGCCTGCCTGCAGCGGG + Intergenic
1019429793 7:993397-993419 GAGCGCTGGCAGCCTCCAGCTGG - Intergenic
1019522828 7:1468345-1468367 GAGGCTGGCGAGGCTGCAGCAGG + Intergenic
1019634054 7:2066205-2066227 GAGGGCTGCGAGCCTCCGGCTGG - Intronic
1019770801 7:2882729-2882751 GAGCTCTGCCAGGTTGCAGGGGG + Intergenic
1021968434 7:25944934-25944956 GAGGGCTGCCTGCCAGGAGCTGG - Intergenic
1024478598 7:49840449-49840471 GGGGGCTACCAAGCAGCAGCTGG - Intronic
1025032986 7:55572399-55572421 GCGGGCGGGCAGACTGCAGCCGG + Exonic
1026665192 7:72335894-72335916 GAGGGCGCCTAGGCAGCAGCAGG - Intronic
1026979473 7:74518080-74518102 GAGGGCAGCCAGGCTGGGGTCGG - Intronic
1026990073 7:74580027-74580049 GAGGAGGGCCAAGCTGCAGCGGG - Intronic
1027247602 7:76377825-76377847 GTGGGCAGCCAGACTGCAGGGGG + Intergenic
1028420916 7:90631896-90631918 CATGGCTGCCATGTTGCAGCAGG + Intronic
1028456533 7:91044131-91044153 CAAGGTTGTCAGGCTGCAGCTGG + Intronic
1029034599 7:97505706-97505728 GAGGCCTGCCAGGAAACAGCAGG - Intergenic
1030860992 7:114628656-114628678 GCAGGCTGTCATGCTGCAGCAGG + Exonic
1032076780 7:128839851-128839873 CGGGGCTGCCGGGCTGGAGCTGG - Intronic
1033145369 7:138866542-138866564 GAGCCCTGCCTTGCTGCAGCAGG - Intronic
1033602517 7:142898488-142898510 CAGGCTTGCCATGCTGCAGCTGG + Intergenic
1034866126 7:154643982-154644004 GTGCCCTGCCAGGCTGCTGCTGG + Intronic
1036645486 8:10609411-10609433 GATGGCGGCCGAGCTGCAGCAGG - Exonic
1037579915 8:20238972-20238994 GATTGCTGCCATGCTGGAGCAGG - Intergenic
1037913758 8:22759534-22759556 CAGGGCTGCGGGGCTGCAGCTGG + Intronic
1038575879 8:28702432-28702454 CAGGGCTGCCCGGCTGCTGATGG + Intronic
1038612873 8:29070793-29070815 GAGGGCAGCCGAGCTGCAGACGG + Intronic
1039390879 8:37179973-37179995 CAGGCCTGCCATGCAGCAGCAGG + Intergenic
1039892064 8:41692557-41692579 GAGGACTGCCTGCCTGCACCTGG + Intronic
1040063624 8:43126377-43126399 GAGGGCTGCCAAGGTCCAGTTGG - Intergenic
1040458383 8:47622516-47622538 GCTGGCTGTGAGGCTGCAGCAGG - Intronic
1041101289 8:54398656-54398678 GAGGGATGTAAGGCTGGAGCAGG - Intergenic
1042042446 8:64607033-64607055 GAGGACTTCCATGCTGCACCAGG + Intronic
1042222046 8:66483635-66483657 AAGGGCAGCAAGGCTGAAGCAGG - Intronic
1042529002 8:69795789-69795811 GAGGGCTCCGACCCTGCAGCAGG + Intronic
1044477717 8:92647637-92647659 GAGGGCTGGCTGGCTGCCTCTGG - Intergenic
1044849825 8:96417552-96417574 GAGGGAAGTCAGGCTGCAGAAGG - Intergenic
1045370106 8:101514600-101514622 GTGGGAGGCCTGGCTGCAGCTGG + Intronic
1046037771 8:108864656-108864678 GATGTTTGGCAGGCTGCAGCTGG + Intergenic
1046648331 8:116809822-116809844 CAGTGCTCCCAGGCTGGAGCTGG + Intronic
1047275559 8:123402386-123402408 GGTGGGGGCCAGGCTGCAGCAGG - Intronic
1047456453 8:125017416-125017438 GAGTACTGCCTGGCTGCTGCTGG + Intronic
1047499106 8:125429131-125429153 CAGGGCTGCCCGGGTGCAGGCGG + Intergenic
1048294602 8:133205123-133205145 GTGGGCTCAGAGGCTGCAGCAGG + Intronic
1049011408 8:139890068-139890090 GAGGGGTGCCTCGCTGCTGCTGG - Intronic
1049194576 8:141308272-141308294 GAGCGCTGCGAGGCTGCGGCCGG + Intronic
1049332744 8:142063833-142063855 GGGGGTTCCCAGGCTGCTGCCGG - Intergenic
1049404327 8:142444963-142444985 GAGGGGGGCCAGGATGCACCAGG + Intergenic
1049438788 8:142599781-142599803 CAGGGCTGCCAGACTCCAACAGG + Intergenic
1049562495 8:143318692-143318714 GAGGGCTGCCATGCTGGTGCTGG - Intronic
1049598204 8:143494343-143494365 GAGGGCTGGCGGGCTGCCACCGG - Intronic
1049682640 8:143926508-143926530 GACGGCCGCTAGGCTGCAGGGGG + Intronic
1051332705 9:16039813-16039835 GATGGCTGCCTGGCTGGAGATGG - Intronic
1053351187 9:37414405-37414427 GTGGGGTGCAAGGCTGCAGCAGG + Intergenic
1053431408 9:38044036-38044058 GTGGGCTGCCAGGCAGAACCAGG - Intronic
1054738929 9:68785077-68785099 GATGGATGCCAGGTTGCAGTTGG + Intronic
1055149036 9:72972821-72972843 GATAGCAGCCAGGCTGCAGGGGG + Intronic
1055437903 9:76310789-76310811 GAGGGTGGCCCGGCTGCATCTGG - Exonic
1056765339 9:89441587-89441609 GAGGGCAGCCTGGAAGCAGCAGG + Intronic
1057557717 9:96100788-96100810 GAGGGGTGCGTGGCTTCAGCAGG + Intergenic
1058446882 9:105062587-105062609 GAGTTCTGCCCAGCTGCAGCTGG + Intergenic
1058816771 9:108691679-108691701 GAAGGCTACCAGGTTGAAGCAGG + Intergenic
1058885869 9:109320778-109320800 GCGGGCTGCCAGGGGGCTGCCGG + Exonic
1059304072 9:113340219-113340241 GTGGGCTGCGGGGCTGGAGCTGG + Exonic
1059432777 9:114260029-114260051 AAGGGCAGCCAGGCTCCATCCGG + Intronic
1059530571 9:115031638-115031660 CAGGTCTGCCAGGCTGTAGGAGG + Exonic
1060943641 9:127557512-127557534 GAAGTCTGCCAGGCTCCACCCGG + Intronic
1061512118 9:131067809-131067831 GAGCCCTGGCAGGCTGCAGAGGG - Intronic
1061552385 9:131345106-131345128 GGCGGCAGCCAGGCTGCAGGAGG - Intergenic
1061627277 9:131848494-131848516 GAGGGAAGGCAGGCTGCCGCTGG + Intergenic
1061732339 9:132625415-132625437 GAAGCCTGCCAGACAGCAGCAGG - Intronic
1062004812 9:134233830-134233852 CAGGCCAGCCTGGCTGCAGCTGG - Intergenic
1062008239 9:134252525-134252547 GAGCGCTGCCAGGCTGCCCAGGG - Intergenic
1062041697 9:134407368-134407390 GCTGGCTGGCAGGCTGCAGCGGG + Intronic
1062098110 9:134712937-134712959 GTGGGTGACCAGGCTGCAGCCGG + Intronic
1062254485 9:135614629-135614651 GAAGGCTGCAGGGCGGCAGCCGG + Intergenic
1062337032 9:136075900-136075922 GAGGGCTGCGGGGCTGCTCCTGG - Intronic
1062462113 9:136666357-136666379 GGGGGCTGCGGGGCTGCTGCCGG + Intronic
1203788404 EBV:140830-140852 GGGGGGTGGCCGGCTGCAGCCGG + Intergenic
1203788448 EBV:140932-140954 GGGGGGTGGCCGGCTGCAGCCGG + Intergenic
1203788492 EBV:141034-141056 GGGGGGTGGCCGGCTGCAGCCGG + Intergenic
1203788536 EBV:141136-141158 GGGGGGTGGCCGGCTGCAGCCGG + Intergenic
1203788580 EBV:141238-141260 GGGGGGTGGCCGGCTGCAGCCGG + Intergenic
1203788624 EBV:141340-141362 GGGGGGTGGCCGGCTGCAGCCGG + Intergenic
1203788668 EBV:141442-141464 GGGGGGTGGCCGGCTGCAGCCGG + Intergenic
1203788712 EBV:141544-141566 GGGGGGTGGCCGGCTGCAGCCGG + Intergenic
1203788756 EBV:141646-141668 GGGGGGTGGCCGGCTGCAGCCGG + Intergenic
1203788800 EBV:141748-141770 GGGGGGTGGCCGGCTGCAGCCGG + Intergenic
1203788844 EBV:141850-141872 GGGGGGTGGCCGGCTGCAGCCGG + Intergenic
1203788888 EBV:141952-141974 GGGGGGTGGCCGGCTGCAGCCGG + Intergenic
1203788932 EBV:142054-142076 GGGGGGTGGCCGGCTGCAGCCGG + Intergenic
1203788976 EBV:142156-142178 GGGGGGTGGCCGGCTGCAGCCGG + Intergenic
1203789020 EBV:142258-142280 GGGGGGTGGCCGGCTGCAGCCGG + Intergenic
1203789064 EBV:142360-142382 GGGGGGTGGCCGGCTGCAGCCGG + Intergenic
1203789108 EBV:142462-142484 GGGGGGTGGCCGGCTGCAGCCGG + Intergenic
1203789152 EBV:142564-142586 GGGGGGTGGCCGGCTGCAGCCGG + Intergenic
1203789196 EBV:142666-142688 GGGGGGTGGCCGGCTGCAGCCGG + Intergenic
1203789240 EBV:142768-142790 GGGGGGTGGCCGGCTGCAGCCGG + Intergenic
1203789284 EBV:142870-142892 GGGGGGTGGCCGGCTGCAGCCGG + Intergenic
1203789328 EBV:142972-142994 GGGGGGTGGCCGGCTGCAGCCGG + Intergenic
1203789372 EBV:143074-143096 GGGGGGTGGCCGGCTGCAGCCGG + Intergenic
1203789416 EBV:143176-143198 GGGGGGTGGCCGGCTGCAGCCGG + Intergenic
1203572026 Un_KI270744v1:140660-140682 GAGGGCTGAGAGGCGGCAGCGGG + Intergenic
1185582712 X:1223387-1223409 GAGGGCTGACAGGGCTCAGCTGG + Intergenic
1186673183 X:11787928-11787950 GAGGGCTACCCGGCTGCTGCTGG - Intergenic
1187146530 X:16642515-16642537 GAACGCTGCCAGGCACCAGCTGG + Intronic
1189011362 X:37048816-37048838 GAAGTCTGCAAGGCTGCTGCAGG + Intergenic
1189259734 X:39669848-39669870 GTAGCCTGCCAGTCTGCAGCTGG - Intergenic
1189266563 X:39721165-39721187 GAGTGAAGCCAGGCTGCAGAAGG - Intergenic
1189330362 X:40141101-40141123 GAGGGCTGCCAAGGGGCAGCAGG + Intronic
1191605527 X:63058045-63058067 GATAGCTGCCAGACTGCAGAGGG - Intergenic
1192049420 X:67710392-67710414 CAGGGGTTCCAGGCTGCAGTGGG - Intronic
1192236819 X:69301443-69301465 GGTGGCAGCCAGTCTGCAGCAGG - Intergenic
1192410295 X:70927880-70927902 AAGGGCTCTCAGGCTGAAGCTGG + Exonic
1192583761 X:72305105-72305127 GGGGGCCGCCAGGCATCAGCCGG - Intronic
1195206126 X:102601595-102601617 GAGAGCTGCTTGGCTCCAGCAGG + Exonic
1196893412 X:120311065-120311087 GGGAGCGGCCTGGCTGCAGCGGG - Intronic
1198143055 X:133825338-133825360 GGTGGCTGTCAGGCTGCACCAGG - Intronic
1199036138 X:143053064-143053086 GAGTGCTGCCAGACTACTGCTGG + Intergenic
1200013612 X:153140679-153140701 CATGGCTGGCAAGCTGCAGCTGG + Intergenic
1200025989 X:153259239-153259261 CATGGCTGGCAAGCTGCAGCTGG - Intergenic
1200114966 X:153765948-153765970 GAGGGGTGCCAGACTGGAGATGG - Intronic
1200213200 X:154356027-154356049 GAGAGCTGCCTGGCCGCGGCAGG - Intronic