ID: 954297779

View in Genome Browser
Species Human (GRCh38)
Location 3:49683782-49683804
Sequence ACTTTTGCCCATGGGTGCCG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 95}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954297779_954297784 -1 Left 954297779 3:49683782-49683804 CCACGGCACCCATGGGCAAAAGT 0: 1
1: 0
2: 0
3: 3
4: 95
Right 954297784 3:49683804-49683826 TAGTCCCAGGGACATTGCCTTGG 0: 1
1: 0
2: 0
3: 6
4: 148
954297779_954297786 3 Left 954297779 3:49683782-49683804 CCACGGCACCCATGGGCAAAAGT 0: 1
1: 0
2: 0
3: 3
4: 95
Right 954297786 3:49683808-49683830 CCCAGGGACATTGCCTTGGTTGG 0: 1
1: 0
2: 0
3: 17
4: 138
954297779_954297792 20 Left 954297779 3:49683782-49683804 CCACGGCACCCATGGGCAAAAGT 0: 1
1: 0
2: 0
3: 3
4: 95
Right 954297792 3:49683825-49683847 GGTTGGGGAAGCCCCTAGGCTGG 0: 1
1: 0
2: 1
3: 14
4: 179
954297779_954297789 5 Left 954297779 3:49683782-49683804 CCACGGCACCCATGGGCAAAAGT 0: 1
1: 0
2: 0
3: 3
4: 95
Right 954297789 3:49683810-49683832 CAGGGACATTGCCTTGGTTGGGG 0: 1
1: 0
2: 2
3: 12
4: 175
954297779_954297791 16 Left 954297779 3:49683782-49683804 CCACGGCACCCATGGGCAAAAGT 0: 1
1: 0
2: 0
3: 3
4: 95
Right 954297791 3:49683821-49683843 CCTTGGTTGGGGAAGCCCCTAGG 0: 1
1: 1
2: 0
3: 22
4: 229
954297779_954297788 4 Left 954297779 3:49683782-49683804 CCACGGCACCCATGGGCAAAAGT 0: 1
1: 0
2: 0
3: 3
4: 95
Right 954297788 3:49683809-49683831 CCAGGGACATTGCCTTGGTTGGG 0: 1
1: 0
2: 0
3: 21
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954297779 Original CRISPR ACTTTTGCCCATGGGTGCCG TGG (reversed) Exonic
905306025 1:37018874-37018896 ACTTTTGCTCCTGGGGGCCTGGG - Intronic
905952594 1:41964572-41964594 ATTTTTCCCCACTGGTGCCGGGG + Intronic
907314851 1:53561764-53561786 GCTTTGGCCCATGGGAGCCAAGG + Intronic
910422455 1:87080937-87080959 ACTTTAGCCCATGGTGGCAGGGG - Intronic
922237611 1:223733770-223733792 ACTTTTGCCTATGGGTCTCTGGG - Intronic
922428966 1:225528008-225528030 ACTTTTGCCTATGGGTTTAGAGG - Intronic
1065771958 10:29086070-29086092 ACATTTCCCCATGGGTCCAGGGG + Intergenic
1069957274 10:72059880-72059902 TCCTTGGCCCATGGGTGCTGGGG - Exonic
1070940136 10:80337255-80337277 GCTTCTGCCCTTGGGGGCCGTGG - Intronic
1076403010 10:130195523-130195545 ATTTTTGGCCCAGGGTGCCGCGG + Intergenic
1082835003 11:57645319-57645341 ACTTTTGCCATTGGGTGGGGTGG - Exonic
1085632560 11:78131190-78131212 ACTTTTACTGATGGGTGCAGTGG - Intronic
1085843149 11:80036975-80036997 AGTTTTGCCCATGGATGCCCCGG + Intergenic
1086893254 11:92283263-92283285 AGTTTTGCCCATGAGTGAAGAGG + Intergenic
1094849254 12:34375043-34375065 ATTTTCGCCCATGGGTGGGGGGG + Intergenic
1102549834 12:113683724-113683746 CCTTCTGCCCATGGCTGCCTTGG + Intergenic
1107568792 13:41634083-41634105 ATGTTTGGCCATGGGTGCCGTGG + Intronic
1108731412 13:53239325-53239347 TCTTCTTGCCATGGGTGCCGTGG + Intergenic
1114650874 14:24283988-24284010 ACACATGCCCATGGGTGCCCTGG - Intergenic
1115502685 14:34063514-34063536 TCTTTTGTCTATGGGTGCCAGGG - Intronic
1116758853 14:48985437-48985459 ATTTTTGCCCATGTGTTCTGTGG - Intergenic
1121121541 14:91378951-91378973 ACTTCTGCACATGGATGCCTGGG - Intronic
1121579195 14:95014044-95014066 TCTGTTGTCCATGGGTGCAGTGG + Intergenic
1122587644 14:102820354-102820376 CCTTCTGCACTTGGGTGCCGGGG + Intronic
1126264416 15:46735824-46735846 ACTTCTTCCCTTGGGTGCCAGGG + Intergenic
1126474352 15:49050672-49050694 CCTTTTGCCCATGGGAGGTGTGG + Intergenic
1129544688 15:76382670-76382692 ACTTTGGCTCAAGGGTGCCCAGG + Intronic
1132917186 16:2356501-2356523 ACTTTTGCTCTTGGTTGCCCAGG + Intergenic
1141574493 16:84955351-84955373 TTTTTTGCCCATGGGAGCCCAGG - Intergenic
1149001478 17:51762260-51762282 ATTTTTGTCCATGGGTACTGGGG + Intronic
1149359677 17:55881061-55881083 AGTTTTGTCCACGGGTGCTGAGG + Intergenic
1149929824 17:60740413-60740435 ACTTGAGCCCAGGGGGGCCGAGG + Intronic
1152749915 17:82057904-82057926 ACTTTTGCACACGCGTGCTGAGG + Exonic
1154390845 18:13934787-13934809 ACTTCAGCCCATGGGTGACAGGG + Intergenic
1159200135 18:65173199-65173221 ACTTTTGCAGCTGGGTGCGGTGG + Intergenic
1159317468 18:66796257-66796279 ACATTTGCCCATAGGTACCAAGG - Intergenic
1161261597 19:3340792-3340814 TCTTTTGCCCATGGGCCCTGGGG - Intergenic
1161340913 19:3741679-3741701 ACTTTTGGGCCTGGGTGCGGTGG + Intronic
1161719505 19:5895201-5895223 TCCTTTGCCCATGGATGCCAGGG + Intronic
1163399364 19:17082749-17082771 TATTTGGCCCATAGGTGCCGTGG + Intronic
1163668124 19:18612615-18612637 ACTATTCCCCAGGGGTGTCGAGG - Intronic
1167376911 19:49117358-49117380 ACTTTGTCCCATGGGTGCTGGGG + Intronic
1167981051 19:53276138-53276160 CCTTCTGCCCGTGGGTGCAGTGG - Intergenic
925034361 2:674377-674399 CCTTTTGCCCCTGGGTTCCCAGG + Intronic
927094090 2:19734668-19734690 ACTATTGACCTTGGGTGCCCTGG - Intergenic
928484679 2:31718084-31718106 ACTGTTGCCCCTTGGTGCCCTGG - Intergenic
930651568 2:53970175-53970197 ACTTTTGCGCATGGGAGAGGCGG - Intronic
931467523 2:62504873-62504895 ACTATTGTCAATGGCTGCCGTGG + Intronic
931769618 2:65486394-65486416 ATCTTTGCCCATGGGGGCCTGGG - Intergenic
936068791 2:109351690-109351712 ACTTTTGCACATGACTGCAGCGG + Intronic
948579798 2:238978606-238978628 ACTTGTGCCCATGGGTACTAGGG - Intergenic
1171190709 20:23157230-23157252 ACCTTTTCCCATGGCTGCCAGGG + Intergenic
1171494832 20:25548509-25548531 AGCTGTGGCCATGGGTGCCGAGG - Intronic
1171495058 20:25549210-25549232 AGGTTTGGCCGTGGGTGCCGGGG - Intronic
1171495106 20:25549360-25549382 AGCTGTGGCCATGGGTGCCGGGG - Intronic
1171495124 20:25549410-25549432 AGCTGTGGCCATGGGTGCCGGGG - Intronic
1173757075 20:45525932-45525954 TCTTTGGTCCATGGGTGTCGGGG + Intergenic
1174085936 20:48007071-48007093 ACTTTTGCCCCAGGCTGCAGGGG + Intergenic
1176054694 20:63138245-63138267 ACGTTTTCCCATGAGCGCCGAGG + Intergenic
950031360 3:9855874-9855896 TCTTTTGCCCATGGTAGCCATGG - Intergenic
951880672 3:27478476-27478498 TCTTTTGCCCAGGAGTGCAGTGG - Intronic
954297779 3:49683782-49683804 ACTTTTGCCCATGGGTGCCGTGG - Exonic
960101125 3:113745268-113745290 ACTATTGCCCCTGAGTGCTGAGG - Intronic
963531094 3:146474318-146474340 CCTTTTCCCCCTTGGTGCCGTGG - Intronic
963902339 3:150744718-150744740 ACTTTTCCCCATAGCTGCCCAGG + Intronic
969845686 4:9918431-9918453 ACTTGTCCCCATGGCTGCCTAGG + Intronic
976027339 4:80705315-80705337 ACTTTAGCACATGGCTGCCAAGG + Intronic
976198145 4:82552855-82552877 ACCTTTGCCCATGGCTGGCCTGG - Intronic
979344836 4:119574854-119574876 AGTGTTGCCCATGGGTGGTGAGG + Intronic
985387327 4:189461513-189461535 AGGCTTGCCCATGGGTGCCTGGG + Intergenic
993999039 5:94756019-94756041 ACTGTCGGCCATGGGTGCCCAGG - Intronic
995022076 5:107378356-107378378 ACCTTTGCCCCTGGTTGCCAAGG - Exonic
999052041 5:148533400-148533422 ACATTTGCACATGGCTGCAGTGG - Intronic
999636247 5:153625527-153625549 CCCTTTGCCCGTGAGTGCCGTGG - Intronic
1001930886 5:175672259-175672281 AGTTTTGCCCCTGGGTGGCAGGG + Intronic
1003026556 6:2559965-2559987 ACTTTTGCCCCTGGCTTCCAAGG + Intergenic
1005987305 6:30883116-30883138 ACTAGTGCCCATGTGTGCCTCGG + Intronic
1011421191 6:87175373-87175395 ACTTTTACCCAGGAGTGCAGTGG + Intronic
1012318066 6:97805342-97805364 ATTTTTGCCAGTGGGTGCTGAGG - Intergenic
1015709900 6:136128556-136128578 AATTTTGCCCAGGGGTGGGGGGG - Intronic
1027149505 7:75722881-75722903 ACTTTTGTGCATGAGTGCCAGGG + Intronic
1032242056 7:130170204-130170226 CCTTTTACCAATGGGTTCCGAGG + Intronic
1034994190 7:155567858-155567880 ACTTTGGCCCATGGTTGTTGAGG + Intergenic
1040073528 8:43206894-43206916 ACCTTTGCCGATGGGTTCCTGGG + Intergenic
1042002856 8:64145862-64145884 TTTTTTGATCATGGGTGCCGTGG - Intergenic
1044749939 8:95406459-95406481 AGTTTTGTCCATGGCTGCCCAGG + Intergenic
1044860724 8:96520873-96520895 GCTTTTGCCCCTGGGTGTCCAGG - Intronic
1045394572 8:101748003-101748025 ACTTTTCCCACTGGGTGCGGTGG - Intronic
1047158652 8:122351257-122351279 ACTGTTCCCCTTGGGTGCAGGGG + Intergenic
1048799591 8:138183708-138183730 ACTTTGGACCAAGGGTGACGTGG + Intronic
1056121327 9:83492070-83492092 ACTTTTTCCCTTGGGGGCCCAGG - Intronic
1057180421 9:93026833-93026855 AGTGCTGCCCCTGGGTGCCGTGG + Intronic
1059755459 9:117289260-117289282 ACTTTGGCTCATGGGTGGGGAGG + Intronic
1186297060 X:8161053-8161075 ACACTTGCCCATGGATGACGTGG + Intergenic
1186354941 X:8781520-8781542 ACACTTGCCCATGGATGACGTGG - Intergenic
1186377085 X:9015881-9015903 ACACTTGCCCATGGATGACGTGG - Intergenic
1192795668 X:74422386-74422408 ACCTTTGCCCCTGTGTGCTGGGG + Intronic
1199336795 X:146627994-146628016 ACATTTGCCCAAGGTGGCCGGGG - Intergenic
1199645950 X:149910617-149910639 AGTTTTGCCCTTTGTTGCCGAGG - Intergenic