ID: 954302297

View in Genome Browser
Species Human (GRCh38)
Location 3:49706419-49706441
Sequence AGGTGGGGCCCAGTGTGTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 460
Summary {0: 1, 1: 0, 2: 5, 3: 35, 4: 419}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954302284_954302297 15 Left 954302284 3:49706381-49706403 CCTCCGGAGCCCTCTGCTGTAGC 0: 1
1: 0
2: 2
3: 11
4: 147
Right 954302297 3:49706419-49706441 AGGTGGGGCCCAGTGTGTCCAGG 0: 1
1: 0
2: 5
3: 35
4: 419
954302293_954302297 -10 Left 954302293 3:49706406-49706428 CCCTAGCCCAGGAAGGTGGGGCC 0: 1
1: 0
2: 1
3: 32
4: 526
Right 954302297 3:49706419-49706441 AGGTGGGGCCCAGTGTGTCCAGG 0: 1
1: 0
2: 5
3: 35
4: 419
954302285_954302297 12 Left 954302285 3:49706384-49706406 CCGGAGCCCTCTGCTGTAGCTGC 0: 1
1: 0
2: 4
3: 26
4: 283
Right 954302297 3:49706419-49706441 AGGTGGGGCCCAGTGTGTCCAGG 0: 1
1: 0
2: 5
3: 35
4: 419
954302282_954302297 24 Left 954302282 3:49706372-49706394 CCACTGCACCCTCCGGAGCCCTC 0: 1
1: 0
2: 0
3: 46
4: 386
Right 954302297 3:49706419-49706441 AGGTGGGGCCCAGTGTGTCCAGG 0: 1
1: 0
2: 5
3: 35
4: 419
954302286_954302297 6 Left 954302286 3:49706390-49706412 CCCTCTGCTGTAGCTGCCCTAGC 0: 1
1: 0
2: 2
3: 17
4: 203
Right 954302297 3:49706419-49706441 AGGTGGGGCCCAGTGTGTCCAGG 0: 1
1: 0
2: 5
3: 35
4: 419
954302283_954302297 16 Left 954302283 3:49706380-49706402 CCCTCCGGAGCCCTCTGCTGTAG 0: 1
1: 0
2: 2
3: 6
4: 130
Right 954302297 3:49706419-49706441 AGGTGGGGCCCAGTGTGTCCAGG 0: 1
1: 0
2: 5
3: 35
4: 419
954302287_954302297 5 Left 954302287 3:49706391-49706413 CCTCTGCTGTAGCTGCCCTAGCC 0: 1
1: 1
2: 1
3: 13
4: 222
Right 954302297 3:49706419-49706441 AGGTGGGGCCCAGTGTGTCCAGG 0: 1
1: 0
2: 5
3: 35
4: 419

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954302297 Original CRISPR AGGTGGGGCCCAGTGTGTCC AGG Intronic
901201616 1:7470483-7470505 AGGTGGGGTCCAAGGTGTCAGGG + Intronic
901232069 1:7646881-7646903 AGGTGAGGACCAGTGTGTTAGGG - Intronic
901903691 1:12390017-12390039 AGGCGGAGCCCAAAGTGTCCAGG + Intronic
902732208 1:18376943-18376965 CGGTGGAGCCCAGTGGGTTCTGG - Exonic
904317294 1:29673727-29673749 AGGTGGGCCCCAGGATGCCCAGG - Intergenic
904804149 1:33119216-33119238 GTGTGTGGGCCAGTGTGTCCAGG + Intronic
905347820 1:37323405-37323427 AGGTGGGGCCCCAAGTCTCCAGG + Intergenic
905465466 1:38149775-38149797 AGGAGGAGCCCAAAGTGTCCAGG - Intergenic
906237544 1:44221151-44221173 AGGTGGGGCCTGATCTGTCCTGG + Exonic
906483872 1:46219941-46219963 CGCTGGGGGCCACTGTGTCCAGG - Exonic
906680119 1:47720495-47720517 AGGAGTGGCCCAGTGGGTCCTGG - Intergenic
906930690 1:50166855-50166877 AGGAGGAGCCCAAAGTGTCCAGG + Intronic
907041719 1:51266967-51266989 AGGTGAGAGCCACTGTGTCCGGG - Intronic
908737629 1:67292474-67292496 AGGAGGAGCCCAAAGTGTCCAGG - Intergenic
909577156 1:77187502-77187524 AGGAGGAGCCCAAAGTGTCCAGG - Intronic
910790522 1:91045106-91045128 AGGAGGAGCCCAGAGTGTCCAGG - Intergenic
911262908 1:95708619-95708641 GGGTGGGGCCTAGTGATTCCAGG + Intergenic
911738176 1:101360265-101360287 AGGAGGGTCCCAAAGTGTCCAGG + Intergenic
911831742 1:102557959-102557981 AGGGGGAGCCCAAAGTGTCCAGG + Intergenic
912129689 1:106586389-106586411 AGGAGGAGCCCAAAGTGTCCAGG + Intergenic
912500815 1:110120969-110120991 AGGTGTGGCCCTGAGTGTGCAGG - Intergenic
913616233 1:120562528-120562550 AGGTGGGGCGCAGTGGAACCCGG - Intergenic
914574042 1:148948376-148948398 AGGTGGGGCGCAGTGGAACCCGG + Intronic
915475352 1:156149877-156149899 AGGTGGGGCGCAGTGGGACATGG + Intronic
915903044 1:159859997-159860019 AGGTGGAGGGCAGAGTGTCCAGG - Intronic
916285556 1:163101182-163101204 AGGAGGAGCCCAAAGTGTCCAGG - Intergenic
917485130 1:175448698-175448720 AGGTGGGTAGCAGTGTTTCCAGG + Intronic
917764764 1:178203678-178203700 AGGAGGAGCCCAAAGTGTCCAGG - Intronic
918815272 1:189172863-189172885 AGGAGGAGCCCAAAGTGTCCAGG - Intergenic
918918012 1:190670215-190670237 AGGAGGAGCCCAAAGTGTCCAGG + Intergenic
919241990 1:194925868-194925890 AGGAGGAGCCCAAAGTGTCCAGG - Intergenic
922794734 1:228334463-228334485 CGGTGGGGGCCTGTGTGTGCTGG + Intronic
922886588 1:229025183-229025205 TGGTGGGGCCCAGTGTCCTCGGG - Intergenic
923104491 1:230843734-230843756 TGGTGGGGCCCAGGGCGTCCAGG + Exonic
923173719 1:231442968-231442990 AGGTGGGGCCCAGTGAGAGGTGG - Intergenic
923262035 1:232276686-232276708 AGGTGTGGCTCATTCTGTCCTGG - Intergenic
923520340 1:234730640-234730662 AGGTGGAGCAGAGTCTGTCCTGG - Intergenic
923711974 1:236395303-236395325 AGGCGGGGCCCCGAGTGTCCCGG - Intronic
1063224644 10:4004398-4004420 GGGTGGGGGCCTGAGTGTCCTGG + Intergenic
1063370251 10:5516571-5516593 AGGTTGGGGGCAGAGTGTCCAGG + Intergenic
1063788356 10:9410177-9410199 AGGAGGAGCCCAAAGTGTCCAGG - Intergenic
1064155746 10:12901833-12901855 GGGTGGGACCCAGTGTGCCTTGG - Intronic
1064517355 10:16166114-16166136 AGGAGGAGCCCAAAGTGTCCAGG + Intergenic
1067088779 10:43256152-43256174 TTGTGGGGCACAGTGTGGCCAGG - Intronic
1067146947 10:43701132-43701154 ATGTGTGCCCCAGTGGGTCCCGG + Intergenic
1067551189 10:47237645-47237667 AGGTGGGCTCCAGTATGGCCTGG - Intergenic
1070708325 10:78657716-78657738 GGGTGGTGCTCAGTGTCTCCTGG - Intergenic
1071439771 10:85679933-85679955 AGGTGGTGGCCAGTGAGTGCAGG + Intronic
1071670874 10:87608373-87608395 AGATGTGGCCAAGTGGGTCCCGG + Intergenic
1071937909 10:90550931-90550953 AGGAGGAGCCCAGAGTGTCCAGG - Intergenic
1071942551 10:90606113-90606135 AGGAGGAGCCCAAAGTGTCCAGG + Intergenic
1072209029 10:93230042-93230064 AGGAGGAGCCCAAAGTGTCCAGG + Intergenic
1072524869 10:96262952-96262974 AGGTGAGGCCCAGAGAGGCCAGG - Intronic
1072744728 10:97932109-97932131 ATGGGGGGCCCAGTGAGTCTGGG - Intronic
1073347169 10:102792446-102792468 AGGTGGGGACCACTCTGTACAGG - Intronic
1073426328 10:103457750-103457772 AGCTGAGGACCAGGGTGTCCTGG - Intronic
1074605495 10:114960292-114960314 AGGTGGGCCCCAGTGAGTTCTGG - Intronic
1075476234 10:122736750-122736772 ATGTGGGGCTCAGTGTGGCTGGG + Intergenic
1075855060 10:125622847-125622869 AGGAGGAGCCCAGAGTGGCCAGG + Intronic
1076772379 10:132673168-132673190 AGGAGGAGCCCAGAGTATCCAGG + Intronic
1077167372 11:1149898-1149920 AGGTGAGGCCCATTGTGCCGGGG - Intergenic
1077189971 11:1251876-1251898 AGTGGGGACCCAGTGTGGCCGGG - Intronic
1079249709 11:18778495-18778517 AGGTGGGGCCTGGTGGGTCACGG + Intronic
1081110756 11:39130385-39130407 AGGAGGAGCCCAAAGTGTCCAGG - Intergenic
1082671914 11:56044672-56044694 AGGAGGGTCCCAAAGTGTCCAGG - Intergenic
1084370048 11:68735297-68735319 AGCTGGGGCACAGGGTGGCCCGG + Intronic
1085254214 11:75163400-75163422 GGGTGGGGTTCAGTGTGTGCAGG + Intronic
1086141401 11:83504532-83504554 AGGAGGAGCCCAAAGTGTCCAGG + Intronic
1087235225 11:95710574-95710596 AGGTTGTTCCCATTGTGTCCAGG + Intergenic
1088191446 11:107233043-107233065 AGGAGGAGCCCAAAGTGTCCAGG + Intergenic
1088449574 11:109966994-109967016 AGGAGGAGCCCAAAGTGTCCAGG - Intergenic
1088562619 11:111131161-111131183 GGGTGTGGCCCAGTTTGGCCTGG + Intergenic
1089806304 11:121093875-121093897 ACAAGGAGCCCAGTGTGTCCAGG + Intergenic
1089903850 11:122015256-122015278 AGGAGGAGCCCAGAGTGTCCAGG - Intergenic
1091051970 11:132380383-132380405 AGGAGGAGCCCAAAGTGTCCAGG - Intergenic
1091776579 12:3188668-3188690 CCGTGAGGCCCAATGTGTCCAGG - Intronic
1092093854 12:5825595-5825617 AGGAGGAGCCCAAAGTGTCCAGG - Intronic
1092778787 12:11966425-11966447 AGGTGGAGCCATCTGTGTCCTGG + Intergenic
1092871937 12:12813215-12813237 AGGTGGGGCCCAGTGAATATGGG - Intronic
1093964766 12:25312571-25312593 AGGAGGAGCCCAAAGTGTCCAGG - Intergenic
1094389559 12:29934576-29934598 AGGAGGAGCCCAAAGTGTCCAGG + Intergenic
1095604124 12:44046285-44046307 AGGAGGAGCCCAAAGTGTCCAGG - Intronic
1096289000 12:50324896-50324918 AGGAGGAGCCCAAAGTGTCCAGG - Intergenic
1097821115 12:64130272-64130294 AGGAGGAGCCCAAAGTGTCCAGG + Intronic
1097843110 12:64341108-64341130 AGGAGGAGCCCAATGTGTCCAGG + Intronic
1098750053 12:74281238-74281260 AGGAGGAGCCCAAAGTGTCCAGG - Intergenic
1099183164 12:79490957-79490979 AGGAGGAGCCCAAAGTGTCCAGG + Intergenic
1099366148 12:81767027-81767049 AGGAGGAGCCCAAAGTGTCCAGG - Intergenic
1100240912 12:92709960-92709982 AGGAGGAGCCCAAAGTGTCCAGG + Intergenic
1101416724 12:104514797-104514819 ACATGGGGCCTAGTGTGTCATGG - Intronic
1102584984 12:113916469-113916491 AGATGGTGCCCAGTGATTCCTGG + Intronic
1103680548 12:122690280-122690302 AGCTTGGGCCCAGGGGGTCCTGG - Intergenic
1103899486 12:124295789-124295811 AGGTGGGGACCAGGGTGTGTAGG + Intronic
1104896897 12:132169065-132169087 AGCTGGGGGCCACTGAGTCCTGG + Intergenic
1104948939 12:132430022-132430044 AGGTGTGCTCCAGTGTGTGCAGG - Intergenic
1104948944 12:132430062-132430084 AGGTGTGTTCCAGTGTGTGCAGG - Intergenic
1104972624 12:132538907-132538929 AGGTGGGCCTCAGTGTGGCGGGG + Intronic
1104981959 12:132577202-132577224 AAGTCCTGCCCAGTGTGTCCTGG + Intronic
1105673105 13:22642381-22642403 AGGGGAGGCCCAGCGTGCCCTGG + Intergenic
1105740348 13:23316822-23316844 AGGAGGAGCCCAAAGTGTCCAGG - Intronic
1106551981 13:30780134-30780156 ATGTGGGGACCAGTGTCCCCAGG - Intergenic
1107342547 13:39423770-39423792 ATGTGAGGTCCAGTGTGCCCTGG - Intronic
1107446427 13:40473846-40473868 AGGTGTGGGCCACTGTGCCCGGG - Intergenic
1109950799 13:69500572-69500594 AGGAGGAGCCCAAAGTGTCCAGG + Intergenic
1110607411 13:77448798-77448820 AGGTGGGGCCTAATGTGTTTTGG + Intergenic
1111208875 13:85050424-85050446 AGGTGGAGCGCAAAGTGTCCAGG + Intergenic
1111363394 13:87207360-87207382 AGGAGGAGCCCAAAGTGTCCAGG + Intergenic
1113396368 13:109951251-109951273 AGGTGGAGCCCAAAGTGTTCAGG - Intergenic
1114206091 14:20572413-20572435 AGGAGGAGCCCAAAGTGTCCGGG - Intergenic
1115130908 14:30050905-30050927 AGGAGGAGCCCAAAGTGTCCAGG - Intronic
1116415298 14:44671008-44671030 AGGAGGAGCCCAAAGTGTCCAGG - Intergenic
1118642130 14:67802652-67802674 AAGTGTGCCCCAGTGGGTCCAGG + Intronic
1119059473 14:71460549-71460571 AGGAGGAGCCCAAAGTGTCCAGG + Intronic
1120081794 14:80225888-80225910 AGGAGGAGCCCAAAGTGTCCAGG + Intronic
1121694918 14:95904595-95904617 AGGTGGGCCACACTGTGTACTGG + Intergenic
1122120356 14:99550020-99550042 AACTGAGGCCCAGTGTGTCATGG - Intronic
1122349756 14:101082148-101082170 AGGTGGGTCCCAGTGGGCTCTGG - Intergenic
1122716101 14:103697979-103698001 AGGAGGGTCCCGGTGTATCCTGG - Exonic
1123039436 14:105484375-105484397 TGGTCGGGGGCAGTGTGTCCCGG + Intergenic
1123128342 14:105965849-105965871 AGGAGGGGCCCAAAGTGGCCAGG - Intergenic
1202864335 14_GL000225v1_random:105197-105219 AGGGCGGGCCCGGTGTTTCCTGG - Intergenic
1125579004 15:40772774-40772796 AGGTGGGGACAGGTGTGGCCAGG + Intronic
1126842095 15:52727290-52727312 AGGTGTGAGCCACTGTGTCCAGG + Intergenic
1128547470 15:68578146-68578168 ACTCGGGGCACAGTGTGTCCTGG - Intergenic
1128791504 15:70437948-70437970 AGGTGGGGCCCAAGGTCTCCAGG - Intergenic
1129478348 15:75803040-75803062 ACGTGGGGCCTTGTGTGTCCTGG + Intergenic
1129694987 15:77735403-77735425 AGGTTCAGCCCTGTGTGTCCAGG - Intronic
1130088133 15:80795579-80795601 TGGCCGTGCCCAGTGTGTCCTGG - Intronic
1130254073 15:82317755-82317777 GTGTGGGGCCCAGGGTGCCCTGG + Intergenic
1130600899 15:85272216-85272238 GTGTGGGGCCCAGGGTGCCCTGG - Intergenic
1131229488 15:90649464-90649486 ATGTGAGGCCCACTGGGTCCAGG - Intergenic
1131506655 15:93025562-93025584 AGGTGGGGAGTAGTGTGGCCAGG + Exonic
1132112819 15:99114815-99114837 AGGTGGTGCCCCTTGTTTCCTGG + Intronic
1132558285 16:582308-582330 AGGTGAGGCCCCTTGTGGCCAGG + Intronic
1132578160 16:673383-673405 CTGTGGGGCCCTGTGAGTCCAGG + Intronic
1132640675 16:976916-976938 AGGAGGCTCCCAGTGTGTCAGGG + Intronic
1132676775 16:1124310-1124332 AGGCTGGGGCCAGTGTGGCCTGG + Intergenic
1132686184 16:1163125-1163147 AGGTGTGGGCCAGTCTGCCCTGG + Intronic
1133018308 16:2955048-2955070 AGGTGGGGGCCTCTGGGTCCTGG - Intergenic
1133229449 16:4359721-4359743 AGGCGAGGCCTAGTGTGGCCCGG + Intronic
1133824047 16:9261285-9261307 TGGTGGGGCCCAGTCTCTCCAGG + Intergenic
1134235481 16:12462098-12462120 AGCTGAGGCCCAGGGTGTTCAGG - Intronic
1136024255 16:27459919-27459941 AAGTGTGGCCCAGAGTGACCAGG + Intronic
1138211081 16:55163969-55163991 AGGTGCGGACCAGTGTCACCAGG - Intergenic
1138868606 16:60852418-60852440 AGGAGGAGCCCAAAGTGTCCAGG - Intergenic
1140187864 16:72790219-72790241 GGGTGGGGTGCAGTGTGTGCTGG + Intronic
1141559308 16:84856392-84856414 AGGAGGAGCCCAAAGTGTCCAGG + Intronic
1142192752 16:88725434-88725456 CCTTGGGGCCCAGGGTGTCCTGG + Exonic
1142667138 17:1469641-1469663 GGGAAGGGCCCAGGGTGTCCAGG - Intronic
1143584798 17:7845698-7845720 AGTTGGGGCCCTCTGTCTCCAGG + Intronic
1144736776 17:17559908-17559930 AGGTGGGGCCCACTCAGGCCAGG - Intronic
1145782620 17:27572965-27572987 AGGTGGGGCACTTTGTTTCCAGG + Intronic
1146432688 17:32812706-32812728 AGTTGGTGCCCAGTGTCTGCTGG - Intronic
1146540497 17:33689419-33689441 AGGTGGTGTCTAGTGTGTACTGG - Intronic
1146579662 17:34025487-34025509 AGGTGGGACTTAGTGGGTCCAGG - Intronic
1146758658 17:35455777-35455799 AGGAGGTGCCCAAAGTGTCCAGG - Intergenic
1148464300 17:47855817-47855839 AGCTGGGGGCCACTGTTTCCTGG - Intronic
1148824328 17:50381046-50381068 AGGTGAGGCCCAGTCTTTCTTGG + Exonic
1148874018 17:50675881-50675903 AGGTGGAGCTCAGTGTGTTCTGG + Exonic
1150288974 17:63971015-63971037 ACGTGGGCCCCTGTATGTCCAGG + Intronic
1151137942 17:71965674-71965696 ATGTGGGACCCTGTGTGTTCTGG - Intergenic
1151916976 17:77125669-77125691 AGGTAGGTGCCTGTGTGTCCTGG - Intronic
1152066398 17:78114959-78114981 AGGTAGGGCCAGGTGGGTCCGGG - Intronic
1152349611 17:79777689-79777711 GGGTGGGGCCCCGCGTGCCCCGG + Intergenic
1152627136 17:81393069-81393091 CCGTGGGGCCCAGTCTCTCCTGG - Intergenic
1153089949 18:1331803-1331825 AGGAGGAGCCCAAAGTGTCCAGG - Intergenic
1154068689 18:11132725-11132747 AGGAGGAGCCCAAAGTGTCCAGG - Intronic
1155438956 18:25841771-25841793 AGGTGATGCCCTGTGTGTTCAGG - Intergenic
1155648280 18:28108492-28108514 AGCTGAGCCCCAGTGTGTCAGGG - Intronic
1156537794 18:37880566-37880588 AGGAGGAGCCCAAAGTGTCCAGG - Intergenic
1156990087 18:43399140-43399162 AGGAGGAGCCCAAAGTGTCCAGG + Intergenic
1157341437 18:46781655-46781677 AGGAGGAGCCCAAAGTGTCCAGG - Intergenic
1157524259 18:48367650-48367672 GGGTGGGCCGCAGTGTTTCCTGG - Intronic
1157998280 18:52586482-52586504 AGGAGGAGCCCAAAGTGTCCAGG + Intronic
1158937203 18:62375720-62375742 AGGTGGGAGCCACTGTGCCCTGG - Intronic
1159600366 18:70423358-70423380 AGGTGGGGCAGAGTGTGGGCAGG + Intergenic
1160092667 18:75841644-75841666 AGGAGGAGCCCAAAGTGTCCAGG - Intergenic
1160218794 18:76957370-76957392 AGGTGGGGCCCTGGGCTTCCTGG - Intronic
1160709968 19:547013-547035 CTGTGGGGCCCAGTGGGGCCTGG + Intronic
1160983192 19:1826161-1826183 AGCTGGGGCCCTGGGTGCCCAGG - Intronic
1161460477 19:4393925-4393947 AGGTGGGGCCCAGGATCCCCCGG + Intronic
1162070023 19:8147768-8147790 AGGTGGGGCCAGGTGGGGCCAGG + Intronic
1162825086 19:13246301-13246323 AGATGGGGCCATGTGTGTCTAGG + Intronic
1163033859 19:14560752-14560774 AAGTGGGGGCGAGTGTGTCATGG + Intronic
1164527660 19:29023619-29023641 AGGTGCGGGTCAGTGTCTCCAGG + Intergenic
1165393980 19:35553974-35553996 CAGTGGGGCCCAGGCTGTCCAGG - Intronic
1165428530 19:35758558-35758580 AGGCGGAGCCCAGTGGATCCTGG + Intronic
1166230465 19:41423307-41423329 TGCTGGGGCCATGTGTGTCCTGG + Intronic
1167300737 19:48676096-48676118 AGGAGGGCCCCAGAGTGTTCAGG + Intergenic
1168539105 19:57195770-57195792 AGGAGGAGCCCAAAGTGTCCAGG + Intronic
1168686237 19:58351152-58351174 AGGTGGTGCCCCCTGTGGCCTGG + Intronic
1168700738 19:58437969-58437991 AGGTGGGGGCCAGTGGATCTTGG - Intronic
925159537 2:1674462-1674484 AGGTGGGGTCACCTGTGTCCTGG - Intronic
925280185 2:2678492-2678514 AGGAGGAGCCCAAAGTGTCCAGG - Intergenic
925460964 2:4062088-4062110 AGGAGGAGCCCAAAGTGTCCAGG - Intergenic
925536631 2:4925273-4925295 AGGTGGGGCACAGAGTCTGCTGG - Intergenic
925772518 2:7297376-7297398 AGGAGGAGCCCAAAGTGTCCAGG + Intergenic
926679418 2:15652528-15652550 AGGTGGCGACCTGTGAGTCCCGG - Intergenic
927008937 2:18881346-18881368 AGGTGGAGCCCAAAGTGTCCAGG - Intergenic
927154192 2:20212385-20212407 TGGGGGAGCCCAGTGTCTCCTGG - Intronic
927680760 2:25137501-25137523 AGGTGGGGCCTGGTGTGCGCAGG + Exonic
927847961 2:26480983-26481005 AGGCTGGGCCCAGTGTGGGCAGG + Exonic
928131282 2:28653105-28653127 AGGTGTGACCCACTGTGCCCAGG - Intergenic
928446994 2:31341308-31341330 AGGTGAGGCTCAGTGGGACCAGG - Exonic
928922172 2:36537525-36537547 AGTTGCTGCCCAATGTGTCCAGG + Exonic
930536397 2:52650621-52650643 AGGAGGAGCCCAAAGTGTCCAGG + Intergenic
930910358 2:56622508-56622530 AGGAGGAGCCCAAAGTGTCCAGG - Intergenic
931221998 2:60296529-60296551 AGTTGGGGCCCAGAGCCTCCAGG - Intergenic
932434683 2:71695981-71696003 AGGTGGGGGCCATTGTGTAGAGG + Intergenic
932737602 2:74265277-74265299 GGATGGGGCTCAGTGTGGCCAGG + Intronic
934660252 2:96139329-96139351 AGGTGGGGCCCTGAGTGACCTGG - Intergenic
934882521 2:97996042-97996064 AGGTGGGGCCCAGGGGGCTCCGG - Intergenic
935279627 2:101506276-101506298 AGGCGGGGCCCACTGTATTCTGG - Intergenic
935424881 2:102909692-102909714 AGGAGGAGCCCAAAGTGTCCAGG + Intergenic
936593247 2:113823549-113823571 AGGTGGGGCCCAGGAGGTCAAGG + Intergenic
937661278 2:124432374-124432396 AGGAGGGACCCAGTGTCTCCAGG - Intronic
938382232 2:130843216-130843238 TGGAGGGGCCAAGTGAGTCCTGG - Intronic
939167097 2:138651841-138651863 AGGTGGGGCCAAGTGAGACTGGG + Intergenic
939548137 2:143579454-143579476 AGGTGGGGCTCAGAGTTTCTAGG + Intronic
939788452 2:146544470-146544492 AGGAGGAGCCCAAAGTGTCCAGG + Intergenic
940471863 2:154111479-154111501 AGGAGGAGCCCAAAGTGTCCAGG + Intronic
941668251 2:168262742-168262764 AGGAGGGGCCCAAAGTGTCCAGG - Intergenic
943021158 2:182575396-182575418 AGGAGGAGCCCAAAGTGTCCAGG + Intergenic
943032468 2:182701650-182701672 AGGTGTGGGCCACTGTGTCCGGG + Intergenic
943700712 2:190986013-190986035 AGGCTGGGCCCAGTGACTCCAGG + Intronic
944749014 2:202689160-202689182 AGGTGTGGGCCACTGTGCCCAGG - Intronic
945725625 2:213469858-213469880 AGGAGGAGCCCAAAGTGTCCAGG + Intronic
947403142 2:229748822-229748844 CTGTGGGTACCAGTGTGTCCAGG - Intergenic
947713904 2:232330463-232330485 AGCTGGAGCCCAGTGAGTCCAGG + Intronic
948138858 2:235658530-235658552 AGGTGTGGAGCAGAGTGTCCGGG + Intronic
948537750 2:238658746-238658768 TGGTGAGGCCCAGTGTGTCCAGG - Intergenic
948629366 2:239292160-239292182 AGGTGGGGCCCCAAGTGTTCCGG + Intronic
948822724 2:240558064-240558086 AGGCGGGGCCGGGTGCGTCCTGG - Intronic
1170618257 20:17972013-17972035 AGGTGTGACCCACTGTGCCCAGG + Intronic
1171183093 20:23105343-23105365 TGCTGGAGCCCAGTGGGTCCAGG - Intergenic
1171209259 20:23304455-23304477 AGGTGGGGCCATGTGGGTGCAGG + Intergenic
1171292192 20:23988824-23988846 AGGAGGGGCACAGAGTGCCCAGG - Intergenic
1171356084 20:24546586-24546608 AGGTGGGGCCCACTTTGTGAGGG + Intronic
1172714070 20:36950423-36950445 AGGTGGGGCCCTGTTTGGCTAGG - Intronic
1173146577 20:40529765-40529787 AGGGGGAGCCAGGTGTGTCCTGG + Intergenic
1174444843 20:50583735-50583757 TGGTGAGGCCCAGCCTGTCCTGG + Exonic
1175184037 20:57167775-57167797 GTGTGGGGCCCAGAGTGGCCAGG + Intergenic
1175895651 20:62334529-62334551 AGGTGGGGCCCTGGGTGTTGGGG + Exonic
1175942620 20:62544905-62544927 AGGTGGGGCCTGGTGTGTTTGGG - Intergenic
1176204175 20:63879177-63879199 AGGTGATGCCCATTGTTTCCAGG + Intronic
1176213723 20:63938687-63938709 CGGTGGGGCCCAGCGGGACCTGG + Intergenic
1177505337 21:22012578-22012600 AGGAGGAGCCCAAAGTGTCCAGG + Intergenic
1178061917 21:28862001-28862023 AGGAGGAGCCCAAAGTGTCCAGG - Intergenic
1178564891 21:33674538-33674560 AAATGGGGCCCAGTGTGTTTGGG + Intronic
1179414912 21:41190891-41190913 AGGAGGAGCCCAAAGTGTCCAGG + Intronic
1179895064 21:44357229-44357251 AGGTGAGGCCCCGTGGGTCTGGG + Intronic
1179923971 21:44522397-44522419 AGGTGGGGCCCACCGTGTCCTGG + Intronic
1179959870 21:44762180-44762202 AGATGCCGCCCAGTGTGCCCAGG + Intergenic
1180823253 22:18846587-18846609 AGGAGGGGCACAGAGTGCCCAGG - Intronic
1181038375 22:20180497-20180519 TGGCCGGGCCCAGTGTGTCTGGG + Intergenic
1181123679 22:20689686-20689708 AGGAGGGGCACAGAGTGCCCAGG - Intergenic
1181189490 22:21127959-21127981 AGGAGGGGCACAGAGTGCCCAGG + Exonic
1181209711 22:21282536-21282558 AGGAGGGGCACAGAGTGCCCAGG - Intergenic
1181373492 22:22437537-22437559 AGGAGGAGCCCAAAGTGTCCAGG + Intergenic
1181399802 22:22644408-22644430 AGGAGGGGCACAGAGTGCCCAGG + Intergenic
1181649609 22:24251660-24251682 AGGAGGGGCACAGAGTGCCCAGG - Intergenic
1181707762 22:24659086-24659108 AGGAGGGGCACAGAGTGCCCAGG + Intergenic
1183172142 22:36196432-36196454 AGGTGGGGCCCAGTCCCTGCTGG - Intronic
1183346120 22:37309398-37309420 AGCTGGGGGCCTGTGCGTCCAGG - Intronic
1184230232 22:43154821-43154843 GGGTGGGACCCAGGGTCTCCAGG - Intronic
1184812331 22:46844624-46844646 AGGTGGGGCCGAGTGATTCCTGG + Intronic
1203217236 22_KI270731v1_random:12897-12919 AGGAGGGGCACAGAGTGCCCAGG + Intergenic
1203273394 22_KI270734v1_random:72493-72515 AGGAGGGGCACAGAGTGCCCAGG - Intergenic
949639131 3:6015163-6015185 AGGAGGAGCCCAAAGTGTCCAGG - Intergenic
950295362 3:11824982-11825004 AGGTGTGACCCAGTGGGTCCTGG + Intronic
950884189 3:16348490-16348512 AGCTGGAGCCCACTGTGTCCAGG + Intronic
951003789 3:17594129-17594151 AGGAGGTGCCCAAAGTGTCCAGG - Intronic
952906215 3:38140665-38140687 AGGAAGGGCCCACTGTGCCCAGG - Intronic
953417829 3:42733013-42733035 AGGTGAGGCCCAGTAGGGCCTGG - Intronic
953929865 3:47000490-47000512 AGGTGTGGCCCTGTCTGACCAGG + Intronic
954054439 3:48009906-48009928 AGGAGGAGCCCAAAGTGTCCAGG - Intronic
954138199 3:48591967-48591989 ATGTGGGGCCCAGGATGACCGGG + Exonic
954302297 3:49706419-49706441 AGGTGGGGCCCAGTGTGTCCAGG + Intronic
954360866 3:50122196-50122218 AGTTGGAGCCCAGCTTGTCCAGG + Intergenic
954614367 3:51962011-51962033 GGGTGGGGCACAGCGTGTCAGGG + Exonic
956400845 3:68878096-68878118 AGGTGTGCCCCAGTTTTTCCAGG + Intronic
956703674 3:71981258-71981280 AGGAGGAGCCCAAAGTGTCCAGG + Intergenic
957183142 3:76907646-76907668 AGGGGGTGCCCATTGTGTGCTGG + Intronic
959745793 3:109775635-109775657 AGGAGGAGCCCAAAGTGTCCAGG + Intergenic
960349741 3:116577344-116577366 AGGAGGAGCCCAAAGTGTCCAGG - Intronic
961421422 3:126807984-126808006 AGGTCAGGCCCTGTGTTTCCTGG + Intronic
962254696 3:133862341-133862363 TGGTGGGTCCCAGAGGGTCCTGG + Intronic
962675897 3:137758355-137758377 TGGTGGGGCCCAGATTATCCAGG - Intergenic
962849031 3:139294147-139294169 AGGTGGAGCCCAGTGAGTAAAGG + Intronic
963970088 3:151420316-151420338 AGGAGGAGCCCAAAGTGTCCAGG + Intronic
964868939 3:161291918-161291940 AGATGGAGCCCTGTGTCTCCTGG + Intergenic
966881366 3:184353055-184353077 AGAGGGGGCCCAGTGTCACCAGG - Exonic
967832018 3:193927628-193927650 AGGAGGAGCCCAAAGTGTCCAGG - Intergenic
968434250 4:576570-576592 GGGTGGGGCCCAGGGGGTCCGGG - Intergenic
968621436 4:1605050-1605072 AGGTGGAGCCCGGTGTCTGCAGG - Intergenic
968730121 4:2265565-2265587 AGTTGGGGCCCAGTGGGCGCAGG - Intergenic
968800420 4:2739771-2739793 AGGAGGAGCCCAGAGTGTCCAGG - Intergenic
968903665 4:3442309-3442331 AGGTGGGGCTCCGTGAGCCCAGG - Intronic
968907247 4:3460053-3460075 AGGAGGAGCCCAGAGTGTCCAGG - Intergenic
969056406 4:4405500-4405522 ATGTGGGGCCCAGAGAGGCCAGG + Intronic
969549070 4:7852366-7852388 ACGAGGAGCCCAGTGTGGCCAGG - Intronic
970729724 4:19088675-19088697 AGGAGGAGCCCAAAGTGTCCAGG - Intergenic
971470970 4:27026797-27026819 AGGTGGGGCCCAGTGGGGAGAGG + Intergenic
972806155 4:42531017-42531039 AGGAGGAGCCCAAAGTGTCCAGG - Intronic
972882757 4:43446529-43446551 AGGTGGAGCCCAAAGTGTCCAGG + Intergenic
973092801 4:46158724-46158746 AGGAGGAGCCCAAAGTGTCCAGG - Intergenic
974459231 4:62165895-62165917 AGGAGGAGCCCAAAGTGTCCAGG - Intergenic
977430989 4:96929836-96929858 AGGAGGAGCCCAAAGTGTCCAGG - Intergenic
977833001 4:101616200-101616222 AGGAGGAGCCCAAAGTGTCCAGG + Intronic
978341344 4:107723908-107723930 AGGAGGAGCCCAAAGTGTCCAGG + Intergenic
978771921 4:112466144-112466166 AGGAGGAGCCCAGAGTGTCCAGG + Intergenic
979439446 4:120734095-120734117 GGCTGAGGCCCAGAGTGTCCAGG + Intronic
980513688 4:133825546-133825568 AGGAGGAGCCCAAAGTGTCCAGG - Intergenic
981128579 4:141133243-141133265 GGGTGCTGCCCAGGGTGTCCCGG + Intronic
981158230 4:141465342-141465364 AGGAGGAGCCCAGTGTGGCCAGG + Intergenic
981835226 4:149045544-149045566 AGGAGGAGCCCAAAGTGTCCAGG - Intergenic
983582911 4:169326456-169326478 AGGAGGAGCCCAAAGTGTCCAGG - Intergenic
984060062 4:174980395-174980417 AGGAGGAGCCCAAAGTGTCCAGG + Intergenic
986036820 5:3948811-3948833 AGGAGGAGCCCAAAGTGTCCAGG + Intergenic
986633257 5:9795605-9795627 GGATGGGGCCAAGTGTGACCAGG - Intergenic
988192529 5:27957758-27957780 AGGTGGGCCCCAGTGTGTACTGG + Intergenic
988562354 5:32292476-32292498 AGGAGGGGCCCAAAGTGTCCGGG - Intronic
989307278 5:39972980-39973002 AGGAGGAGCCCAAGGTGTCCAGG + Intergenic
993203620 5:84849182-84849204 AGGAGGAGCCCAAAGTGTCCAGG - Intergenic
997600393 5:135134783-135134805 AGGTGAGGCCTCGTGTGTCAGGG - Intronic
999384012 5:151141547-151141569 AGGTGGAGCAGAGTGAGTCCTGG + Intronic
1000499341 5:162029635-162029657 AGGAGGAGCCCAAAGTGTCCAGG - Intergenic
1000636676 5:163651592-163651614 AGGTGTGAGCCACTGTGTCCAGG + Intergenic
1001030943 5:168262375-168262397 TGGTGGTGCCTAGTGTGACCAGG - Exonic
1001670198 5:173467537-173467559 AGGTGGGGTCCTGTGCGACCTGG + Intergenic
1001854073 5:174995604-174995626 ATGTTGGGCACAGTGGGTCCAGG + Intergenic
1001949649 5:175807414-175807436 AGGTGGGGCCACCTGTGTGCAGG - Intronic
1002521059 5:179793517-179793539 TTGTGGGGCCCAGTGTGGCTGGG + Intronic
1002703046 5:181140832-181140854 AGTAAGGCCCCAGTGTGTCCAGG - Intergenic
1005390192 6:25324944-25324966 AGGTGGGGCTGAGGGTGACCAGG + Intronic
1006451944 6:34110439-34110461 CGGTGGAGGCCAGTGTGGCCAGG - Intronic
1006657596 6:35609063-35609085 AGGTGTGGGCCACTGTGCCCAGG + Intronic
1006933998 6:37705046-37705068 AGGTGAGGCCCAGGGTTTCTGGG + Intergenic
1007533694 6:42565288-42565310 AGGTGGGGCCCAAGCTGTCTTGG - Intronic
1008820615 6:55626770-55626792 AGGAGGAGCCCAAAGTGTCCAGG - Intergenic
1010291916 6:74147401-74147423 AGGAGGAGCCCAAAGTGTCCAGG + Intergenic
1010323791 6:74542125-74542147 AGGGGGAGCCCAAAGTGTCCAGG - Intergenic
1012002154 6:93666546-93666568 AGGTGGAGCCCAAAGTGGCCAGG - Intergenic
1013618001 6:111862619-111862641 ATGTGGGGCCAAGTATGTCTAGG + Intronic
1015443056 6:133270909-133270931 AGGAGGAGCCCAAAGTGTCCAGG + Intronic
1017392173 6:153952973-153952995 AGGCGGGGCACAGTGTCTCATGG + Intergenic
1018953573 6:168393708-168393730 ACGTGGGGCCCCGTGGGTCGTGG + Intergenic
1018999848 6:168740900-168740922 AAGCGGGGCACAGTGGGTCCAGG + Intergenic
1019157961 6:170051662-170051684 AGATGGGGCCCGATGTGTCAGGG + Intergenic
1019209657 6:170394832-170394854 AGGTGGGCCACACTGTGACCAGG - Intronic
1019305360 7:332084-332106 AGATGGGGACCTGTGAGTCCCGG - Intergenic
1022229899 7:28404666-28404688 AGATGAGGCCCTGTGTGACCAGG + Intronic
1022494337 7:30843798-30843820 TGGTGCAGCCCAGTGGGTCCTGG + Intronic
1022715053 7:32891582-32891604 CGGAGGGGCCCAGTGTGGACGGG - Exonic
1022780914 7:33582291-33582313 AGGTGGGGCACAGTGTGAGGAGG + Intronic
1022995172 7:35747904-35747926 AGGTGGGGCACAATGTGTCTTGG + Intergenic
1023596554 7:41835231-41835253 AGGCAGAGCCCAGGGTGTCCGGG + Intergenic
1024518664 7:50283817-50283839 AGGTGAGTCCCATGGTGTCCAGG + Intergenic
1024744436 7:52390068-52390090 AGGAGGAGCCCAAAGTGTCCAGG - Intergenic
1026627408 7:72007845-72007867 AGGTTGGGCCCAGTGACTCATGG - Intronic
1027406831 7:77871385-77871407 AGGGGGAGCCCAAAGTGTCCAGG + Intronic
1027610339 7:80352286-80352308 AGGAGGAGCCCAAGGTGTCCAGG + Intergenic
1028044061 7:86093104-86093126 AGGAGGAGCCCAAAGTGTCCAGG - Intergenic
1028217584 7:88153528-88153550 AGGTGGGGGCAAGTATGACCTGG - Intronic
1028959063 7:96728338-96728360 AGGTGGGTCACAGTGTGTCCTGG + Intergenic
1029308281 7:99638341-99638363 AGGTCAGGCCCAGTTTCTCCTGG + Intergenic
1029544476 7:101202999-101203021 AGCTGGGCCCCAGTGTCCCCTGG + Intergenic
1030559295 7:111064717-111064739 AGGAGGAGCCCAAGGTGTCCAGG - Intronic
1030883059 7:114904901-114904923 AGGAGGAGCCCAAAGTGTCCGGG + Intergenic
1031237083 7:119189902-119189924 AGGAGGAGCCCAAAGTGTCCAGG - Intergenic
1031833237 7:126651659-126651681 AGGAGGAGCCCAAAGTGTCCAGG - Intronic
1031861296 7:126983092-126983114 AGGAGGAGCCCAAAGTGTCCAGG + Intronic
1031922364 7:127611616-127611638 AGGAGGGACCCAGTGGTTCCAGG + Exonic
1031975787 7:128092769-128092791 AAGTGGTGCCCACTGGGTCCAGG - Intergenic
1032062131 7:128733763-128733785 AGGTGGGGCCCAGTTGGCCATGG - Intergenic
1033242251 7:139690020-139690042 AGGTGGGGCCCAATCTATGCAGG + Intronic
1033529559 7:142248370-142248392 AGGTGAGGCCCAGTCTGTGTGGG - Intergenic
1034170092 7:149056224-149056246 AGGAGGAGCCCAAAGTGTCCAGG - Intergenic
1034445898 7:151114369-151114391 AAATGGGGCCCAGTGTGTGGTGG + Intronic
1034962370 7:155371085-155371107 AGGTGGGGCACACAGTGTCTGGG - Intergenic
1034962383 7:155371153-155371175 AGGTGGGGCGCACAGTGTCTGGG - Intergenic
1035249335 7:157586779-157586801 AGGCAGGGCCCTGAGTGTCCCGG - Intronic
1035327899 7:158076638-158076660 ATGTGGGGTCCAGTGTGCCAAGG - Intronic
1035379982 7:158431778-158431800 CGGTGTGAGCCAGTGTGTCCTGG - Intronic
1035665751 8:1378477-1378499 AGGTGAGGCCAGGTGTGTGCAGG - Intergenic
1036793945 8:11742164-11742186 CGCTGGGGCCCAGGGTGTCAGGG + Intronic
1037743131 8:21622923-21622945 AGGTAGGGCCCAGTGCCACCTGG + Intergenic
1037848530 8:22306468-22306490 TTGTGGGGCCCTGAGTGTCCTGG + Intronic
1037924543 8:22834062-22834084 AGCTGGGGACCCTTGTGTCCTGG + Intronic
1040517884 8:48149163-48149185 AGGTAGTGGCCAGTGTGCCCAGG + Intergenic
1041107816 8:54458978-54459000 AGGTGGGGCCAGGTGGGGCCTGG + Intronic
1041479155 8:58298986-58299008 AGCAGGGGCCCTGTGTGTCAGGG - Intergenic
1042727143 8:71890392-71890414 AGGAGGGGCCCAGTGGCTCATGG - Intronic
1043033499 8:75168716-75168738 GGATGTGGCACAGTGTGTCCTGG - Intergenic
1043175105 8:77015528-77015550 AAGTGAGGTCCAGTGTGTCAGGG - Intergenic
1044285749 8:90410801-90410823 AGGTGGAGCCCAAGGTGTCCAGG + Intergenic
1044632918 8:94296770-94296792 AGGAGGAGCCCAAAGTGTCCAGG + Intergenic
1045266804 8:100625800-100625822 AGGTGGTGTCCAGTGGGGCCCGG - Intronic
1045507746 8:102790654-102790676 AGGTGGGTCCCAGTGTTTTTGGG + Intergenic
1046128423 8:109939731-109939753 AGGAGGAGCCCAAAGTGTCCAGG + Intergenic
1049025754 8:139987814-139987836 AGGTGGAGCTCAGTGACTCCGGG - Intronic
1049057994 8:140254243-140254265 AGGTGCAGCCCTGTGTATCCTGG + Intronic
1049094907 8:140542770-140542792 AGCTGGGCACCAGTGTGCCCAGG - Intronic
1049378564 8:142301076-142301098 AGGTGGGGGGCACTGTGGCCGGG - Intronic
1049378610 8:142301210-142301232 AGGTGGGGGGCACTGTGGCCGGG - Intronic
1049378678 8:142301401-142301423 AGGTGGGGGGCACTGTGGCCGGG - Intronic
1049378725 8:142301530-142301552 AGGTGGGGGGCACTGTGGCCGGG - Intronic
1049446881 8:142635274-142635296 AGGTGCGGAGCAGTGTGCCCAGG + Intergenic
1049538744 8:143195770-143195792 AGGAGGGGCTCAAAGTGTCCAGG - Intergenic
1049543441 8:143218751-143218773 AGACGGGGCCCAGGGTGTCTTGG - Intergenic
1051882181 9:21850910-21850932 AGGAGGAGCCCAAAGTGTCCAGG - Intronic
1052227804 9:26110019-26110041 AGGAGGAGCCCAAAGTGTCCAGG - Exonic
1052917145 9:33932052-33932074 AGGTGTGGCTCAGTGGGTCGTGG - Intronic
1052935400 9:34088827-34088849 AGGTGGGGCGCAGTGGTTCATGG + Intronic
1053222988 9:36327056-36327078 ATGTGGGGCCCAGTGTGTCTCGG + Intergenic
1055059834 9:72057167-72057189 AGGTGTGGGCCATTGTGCCCAGG + Intronic
1055103331 9:72487350-72487372 AGGAGGAGCCCAAAGTGTCCAGG - Intergenic
1056156906 9:83846844-83846866 AGGTGGAGCCCAAAGTGTCCAGG - Intronic
1056314013 9:85371295-85371317 AGGAGGAGCCCACAGTGTCCAGG + Intergenic
1056353633 9:85776682-85776704 AGGTAGAGCCCAAAGTGTCCAGG + Intergenic
1057100371 9:92353620-92353642 AGGAGGAGCCCAAAGTGTCCAGG + Intronic
1058543954 9:106041115-106041137 AGGAGGAGCCCAAAGTGTCCAGG + Intergenic
1060596925 9:124854045-124854067 AGAGAGGGCCCAGTGGGTCCCGG + Intronic
1060738817 9:126084120-126084142 GGGTGGGTCCCAGTGTCTTCTGG - Intergenic
1061013503 9:127968860-127968882 AGGTGGAGACCAGTGAGTCAGGG - Intronic
1061521820 9:131122757-131122779 GGGTGGGGGCTCGTGTGTCCTGG + Exonic
1061678184 9:132229920-132229942 AGGTGTGTCTCTGTGTGTCCAGG - Intronic
1062069537 9:134548105-134548127 ACGTCGGGCCCAGTGAGCCCAGG - Intergenic
1062242316 9:135547123-135547145 AGGATGGGCCAGGTGTGTCCTGG + Intronic
1185782454 X:2861429-2861451 GGGTGGGGCCCTGTGTAGCCAGG - Intronic
1186425574 X:9462853-9462875 AACTGGAGCCCAGTGTGGCCAGG - Intergenic
1186497521 X:10023543-10023565 CGGTTGGCCCCAGTGAGTCCCGG - Intronic
1186600211 X:11028608-11028630 AGGTGTGGGCCACTGTGCCCAGG + Intergenic
1190996380 X:55614471-55614493 AGGAGGAGCCCAAAGTGTCCAGG - Intergenic
1190996532 X:55615847-55615869 AGGAGGAGCCCAAAGTGTCCAGG + Intergenic
1191719023 X:64214080-64214102 AGGAGGAGCCCAAAGTGTCCAGG + Intergenic
1191769281 X:64738455-64738477 AGGAGGAGCCCAAAGTGTCCAGG + Intergenic
1191933131 X:66395789-66395811 AGGAGGAGCCCAAAGTGTCCAGG - Intergenic
1192673038 X:73166768-73166790 AGGAGGAGCCCAAAGTGTCCAGG + Intergenic
1193288151 X:79737849-79737871 AGGAGGAGCCCAAAGTGTCCAGG - Intergenic
1193356466 X:80524779-80524801 AGGAGGAGCCCAAAGTGTCCAGG - Intergenic
1193740711 X:85214416-85214438 AGGTGAGGCCTAGTGTGTCATGG - Intergenic
1193841331 X:86412129-86412151 AGGAGGAGCCCAAAGTGTCCAGG + Intronic
1194174843 X:90632467-90632489 AGGGGGAGCCCAAAGTGTCCAGG - Intergenic
1194210506 X:91063985-91064007 AGGAGGAGCCCAAAGTGTCCAGG - Intergenic
1194277213 X:91900229-91900251 AGGAGGAGCCCAGAGTGGCCAGG + Intronic
1194513207 X:94820628-94820650 AGGAGGAGCCCAAAGTGTCCAGG + Intergenic
1195782121 X:108478234-108478256 AGGAGGGGCCCAAAGTGTCCAGG + Intronic
1197044629 X:121979949-121979971 AGGAGGAGCCCAAAGTGTCCAGG - Intergenic
1197405385 X:126041836-126041858 AGGAGGTGCCCAAAGTGTCCAGG - Intergenic
1197420106 X:126227972-126227994 AGGAGGAGCCCAAAGTGTCCAGG - Intergenic
1197477162 X:126939924-126939946 AGGAGGAGCCCAAAGTGTCCAGG + Intergenic
1198212713 X:134530407-134530429 ACGTGGGGACCAGCTTGTCCTGG - Intergenic
1198934260 X:141889489-141889511 AGGACGAGCCCAGAGTGTCCAGG - Intronic
1199116350 X:143997630-143997652 AGGAGGAGCCCAATGTGTCCAGG + Intergenic
1200247924 X:154535744-154535766 AGGAGGGGACCTGTGGGTCCTGG + Intronic
1200521492 Y:4213657-4213679 AGGGGGAGCCCAGAGTGTCCAGG - Intergenic
1200594556 Y:5122328-5122350 AGGAGGAGCCCAGAGTGGCCAGG + Intronic
1200745830 Y:6903234-6903256 AGGAGGAGCCCAAAGTGTCCAGG + Intergenic
1200746909 Y:6911102-6911124 AGCTGGGGCCCTGCGTCTCCAGG - Intronic