ID: 954302364

View in Genome Browser
Species Human (GRCh38)
Location 3:49706686-49706708
Sequence GGCCCTCTAGTGCCTGGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 222}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954302364_954302373 7 Left 954302364 3:49706686-49706708 CCTGCTCCAGGCACTAGAGGGCC 0: 1
1: 0
2: 1
3: 10
4: 222
Right 954302373 3:49706716-49706738 GGCTGCCTGCAGGATCAGGGTGG 0: 1
1: 0
2: 3
3: 41
4: 302
954302364_954302376 14 Left 954302364 3:49706686-49706708 CCTGCTCCAGGCACTAGAGGGCC 0: 1
1: 0
2: 1
3: 10
4: 222
Right 954302376 3:49706723-49706745 TGCAGGATCAGGGTGGACCTGGG 0: 1
1: 0
2: 2
3: 15
4: 193
954302364_954302372 4 Left 954302364 3:49706686-49706708 CCTGCTCCAGGCACTAGAGGGCC 0: 1
1: 0
2: 1
3: 10
4: 222
Right 954302372 3:49706713-49706735 CTAGGCTGCCTGCAGGATCAGGG 0: 1
1: 0
2: 0
3: 20
4: 182
954302364_954302367 -3 Left 954302364 3:49706686-49706708 CCTGCTCCAGGCACTAGAGGGCC 0: 1
1: 0
2: 1
3: 10
4: 222
Right 954302367 3:49706706-49706728 GCCCTTCCTAGGCTGCCTGCAGG 0: 1
1: 0
2: 1
3: 26
4: 213
954302364_954302377 19 Left 954302364 3:49706686-49706708 CCTGCTCCAGGCACTAGAGGGCC 0: 1
1: 0
2: 1
3: 10
4: 222
Right 954302377 3:49706728-49706750 GATCAGGGTGGACCTGGGTATGG 0: 1
1: 0
2: 1
3: 21
4: 213
954302364_954302379 21 Left 954302364 3:49706686-49706708 CCTGCTCCAGGCACTAGAGGGCC 0: 1
1: 0
2: 1
3: 10
4: 222
Right 954302379 3:49706730-49706752 TCAGGGTGGACCTGGGTATGGGG 0: 1
1: 0
2: 1
3: 25
4: 264
954302364_954302371 3 Left 954302364 3:49706686-49706708 CCTGCTCCAGGCACTAGAGGGCC 0: 1
1: 0
2: 1
3: 10
4: 222
Right 954302371 3:49706712-49706734 CCTAGGCTGCCTGCAGGATCAGG 0: 1
1: 0
2: 2
3: 16
4: 271
954302364_954302375 13 Left 954302364 3:49706686-49706708 CCTGCTCCAGGCACTAGAGGGCC 0: 1
1: 0
2: 1
3: 10
4: 222
Right 954302375 3:49706722-49706744 CTGCAGGATCAGGGTGGACCTGG 0: 1
1: 0
2: 4
3: 21
4: 224
954302364_954302378 20 Left 954302364 3:49706686-49706708 CCTGCTCCAGGCACTAGAGGGCC 0: 1
1: 0
2: 1
3: 10
4: 222
Right 954302378 3:49706729-49706751 ATCAGGGTGGACCTGGGTATGGG 0: 1
1: 0
2: 0
3: 17
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954302364 Original CRISPR GGCCCTCTAGTGCCTGGAGC AGG (reversed) Intronic
900072002 1:778586-778608 GGCGCCATGGTGCCTGGAGCTGG - Intergenic
900164363 1:1238830-1238852 GGCCACTCAGTGCCTGGAGCGGG - Intergenic
900329305 1:2126151-2126173 GGGTCTCTGGTGCCTGGTGCAGG - Intronic
900364273 1:2304450-2304472 CGCCCTCCAGTGCCTGCCGCAGG - Exonic
900431860 1:2606445-2606467 GGCCCCCTAGTTCCTGGCTCCGG - Intronic
900488534 1:2935015-2935037 GGCTGCCAAGTGCCTGGAGCAGG - Intergenic
900593760 1:3471300-3471322 GGGCCTGTAGTGCCTGGCACAGG + Intronic
900987059 1:6079174-6079196 GGCACTCTAGGCCCTGGGGCTGG - Intronic
901151206 1:7103058-7103080 GCCCCTCTAGTGCATGGGGTGGG + Intronic
902764438 1:18605203-18605225 GGGTTTCTAGTGCCTGGGGCAGG + Intergenic
903327999 1:22582303-22582325 GTCCTTCTAGTGACAGGAGCAGG + Intronic
904599019 1:31663759-31663781 GGCTCCCCAGTGCCTGTAGCAGG - Intronic
904805225 1:33126667-33126689 GGCTCACTAGTGTATGGAGCTGG - Intergenic
905868829 1:41391501-41391523 GGGCCACCAGGGCCTGGAGCTGG - Intergenic
906237429 1:44220385-44220407 CTCCCTCTAGTGCCTGCAGCAGG + Intronic
906750242 1:48252221-48252243 GTACCCCTAGTGCCTGGAACAGG - Intergenic
912672971 1:111648577-111648599 GGCCCTCTACTTCCTGCAGATGG - Intronic
912704068 1:111898977-111898999 GTCCCACTAGTGCCAGGAACAGG + Intronic
914246746 1:145892001-145892023 AGCCCTCAGGTGGCTGGAGCTGG - Exonic
914376315 1:147076980-147077002 GGTCCTCCAGTGGCTGGAGAAGG - Intergenic
914913055 1:151802080-151802102 GGGCCACTAGTGCCGGGAGACGG + Exonic
915720485 1:157981543-157981565 TGTCCTCTAGTGCCTGGACCTGG - Intergenic
917657172 1:177138004-177138026 GGCCCTCTAGAGGCTGGAAGAGG + Intronic
917970024 1:180200336-180200358 GGCCCTGTTGTGCTTGGAGGGGG + Exonic
918050012 1:180965568-180965590 GGCTCTCAAGTGCTGGGAGCAGG - Intergenic
918059646 1:181049940-181049962 GGCTCTCAAGTGCTGGGAGCAGG - Intronic
922234946 1:223715576-223715598 GTGGCTCCAGTGCCTGGAGCGGG + Intronic
922266937 1:223992542-223992564 GGCGCTATGGTGCCTGGAGCTGG - Intergenic
922729433 1:227942130-227942152 GGCCCTCTGCAGCCTGCAGCAGG + Intronic
923616284 1:235540715-235540737 GGCTCGATAGTACCTGGAGCAGG - Intergenic
924349561 1:243101684-243101706 GGCGCTACGGTGCCTGGAGCTGG - Intergenic
1064033626 10:11898805-11898827 GGCCCACTAAGGCCTGGAGGAGG + Intergenic
1064194598 10:13234646-13234668 GGCCCTAACGTCCCTGGAGCAGG - Intergenic
1064585362 10:16834349-16834371 AGCCCCCTTGTGCCTGGAGCAGG - Intronic
1066726814 10:38403226-38403248 GGCGCTACGGTGCCTGGAGCTGG + Intergenic
1067341872 10:45412346-45412368 GCCCCTCCAGTGGCTGGTGCTGG + Intronic
1067788787 10:49272241-49272263 GGGCCTCTAGTGCCTTCAGAGGG + Intergenic
1067847616 10:49736356-49736378 GGCCATCACGCGCCTGGAGCAGG - Exonic
1069775997 10:70927552-70927574 GGCCCTCTGCTGCCAGGACCAGG + Intergenic
1072757340 10:98030102-98030124 GGGCCTCTGGGGCCTGGAGGGGG - Intronic
1073309815 10:102532330-102532352 AGCCCTCTAGGGCAGGGAGCAGG + Intronic
1073479852 10:103779551-103779573 GGCTCCCTATTGCCTGGAGGAGG - Intronic
1077046659 11:549704-549726 GGCCCTCCAGGGCTTGGAGAAGG + Intronic
1077896396 11:6456711-6456733 GGCCCACTAGCGCCTGGCGCAGG + Exonic
1078089841 11:8258243-8258265 GGCCCTCTGGACCCTGGAGATGG + Intronic
1078364570 11:10695324-10695346 GTCCCTGTAGTGCCTGCTGCTGG - Intergenic
1080895980 11:36449107-36449129 GGAGCTCTAGAGCCTGGGGCTGG + Intronic
1085050708 11:73378791-73378813 TGCCTTCTAGAGCCTGGACCTGG + Intronic
1088733734 11:112707857-112707879 GGCCCACTCGCGCCTGGAGGGGG + Intergenic
1088788174 11:113201189-113201211 GGCCCTCTAATCCCTGCAGTCGG + Intronic
1089777191 11:120846536-120846558 GTTCCTTTTGTGCCTGGAGCAGG + Intronic
1090636877 11:128694891-128694913 GGCTCTCCAGCGCCTAGAGCCGG - Intronic
1090957924 11:131530178-131530200 GACCCTCTGGTGCCTGGCACAGG + Intronic
1092244443 12:6855767-6855789 GGGTCTCCAGTGCCTGTAGCAGG - Exonic
1094473284 12:30822888-30822910 GGGCCTGCAGTGCCAGGAGCAGG + Intergenic
1096718942 12:53507058-53507080 GTCTCTCCATTGCCTGGAGCAGG + Exonic
1098221877 12:68278679-68278701 GGCCCTTACGTGCTTGGAGCTGG - Intronic
1102000605 12:109555699-109555721 GGCCCTCTTGAGCCTTGGGCAGG - Exonic
1104886739 12:132114753-132114775 GGCCACTTAGTGCCTTGAGCTGG + Intronic
1107404340 13:40098640-40098662 GGCCCACTAGTGTCTGGAAGAGG - Intergenic
1108689385 13:52847791-52847813 GGCCGCCTACAGCCTGGAGCTGG - Exonic
1114824378 14:26059065-26059087 GGGGCTCAAGTGACTGGAGCAGG + Intergenic
1116756510 14:48955357-48955379 GTCCCTCTATTGACTGGAGCTGG - Intergenic
1116867714 14:50044712-50044734 GTCCTGCTAGTGCCAGGAGCAGG - Intergenic
1117959392 14:61148118-61148140 GGCCTTTGTGTGCCTGGAGCCGG + Intergenic
1119082194 14:71705681-71705703 AGCCCTCTCATGGCTGGAGCAGG - Intronic
1119561212 14:75591407-75591429 GGCACACTAGTGCCAGGAGGGGG + Intronic
1121403672 14:93704773-93704795 AGCCCTCTAAGGCCAGGAGCAGG - Intronic
1121730812 14:96185758-96185780 GTCCCTGTAGTGCCAGGATCTGG + Intergenic
1122326235 14:100882214-100882236 GGCCTTCGAGTGCCTGAAGAGGG - Exonic
1122419040 14:101563972-101563994 GGACCTCAGCTGCCTGGAGCGGG - Intergenic
1122629704 14:103101959-103101981 GGGCCTGTTGTTCCTGGAGCAGG + Intronic
1124023731 15:25945933-25945955 GGCCCTGTAGATCCTGCAGCCGG + Intergenic
1125725442 15:41866106-41866128 GGCCCTCAGGGGCCAGGAGCTGG - Exonic
1126009566 15:44289308-44289330 GGCCCTCTCTGGCCTGCAGCCGG - Exonic
1131056564 15:89378606-89378628 GGCCCCCGCGGGCCTGGAGCTGG + Intergenic
1131440376 15:92455063-92455085 GGCCCTCAAGTCTCTGCAGCAGG - Intronic
1132832764 16:1937236-1937258 TGCCCTCCAGGGCCTGGGGCAGG + Intergenic
1138600678 16:58052141-58052163 AGCCCCCGAGTGCCTGGTGCAGG + Intergenic
1139086755 16:63596684-63596706 GGCACTTTTCTGCCTGGAGCAGG - Intergenic
1139548791 16:67662149-67662171 GGCTCCCCAGGGCCTGGAGCGGG + Exonic
1140162721 16:72515187-72515209 GGCCCTGTAGGGGGTGGAGCTGG - Intergenic
1142232516 16:88906433-88906455 GGCCGTCTTGCGGCTGGAGCGGG - Intronic
1142270303 16:89085550-89085572 GCCCCTCCTGTGCCTGGACCGGG + Intergenic
1143344417 17:6239516-6239538 TGCCCTTGGGTGCCTGGAGCTGG - Intergenic
1143651562 17:8266844-8266866 TGGCCTCCATTGCCTGGAGCTGG + Exonic
1146263469 17:31436391-31436413 TGCCCTCCAGTTCCTGGGGCAGG - Intronic
1147947997 17:44091429-44091451 GGCCCTCCAGTCCCTGCGGCAGG - Exonic
1148783701 17:50135170-50135192 AGCCCTCTGGTCCCTGAAGCTGG + Exonic
1152258212 17:79252512-79252534 GGGCCTCTAGAGGCTGGAACAGG + Intronic
1152558028 17:81064267-81064289 GGCCCTGTAGTGCCCACAGCCGG + Intronic
1152663070 17:81551947-81551969 GGGCCTCTACTGCCTGTCGCTGG - Exonic
1153015626 18:580279-580301 CGCCCGCTGGGGCCTGGAGCCGG - Intergenic
1154276019 18:12961113-12961135 GGCCCACTAGTGCCTGGGAGGGG + Intronic
1158860476 18:61587170-61587192 GGGGCTCCAGTGCCTGGTGCAGG - Intergenic
1160451652 18:78970511-78970533 TGTCCTCTAGCGTCTGGAGCAGG + Intergenic
1160542430 18:79631867-79631889 GGCCCTACAGGCCCTGGAGCAGG - Intergenic
1161089132 19:2351543-2351565 GGCGCTCTGGCGCCGGGAGCTGG + Exonic
1161381060 19:3965093-3965115 GTCCTTCAAGTGCCTGGTGCAGG - Intronic
1161383305 19:3977764-3977786 GTCCCTCTAGAGCCTGGAAACGG + Intronic
1161571210 19:5031777-5031799 TGCCCTCTAGTGCCCGCAGTGGG + Intronic
1162091098 19:8280608-8280630 GCCCCTCAACTGCCTGGGGCCGG + Intronic
1162093332 19:8295446-8295468 GCCCCTCAACTGCCTGGGGCCGG + Intronic
1162138023 19:8568077-8568099 GGGCCTCTAGTGCCTGGGGCAGG - Intronic
1162320713 19:9969561-9969583 GGCCCTGTGGTGAGTGGAGCGGG - Exonic
1162733840 19:12734764-12734786 GGCCCTCCAGCGCCCGCAGCGGG + Exonic
1164821561 19:31255103-31255125 GGCTCTCTGGTGACTGGAGAAGG + Intergenic
1166275970 19:41754129-41754151 TGCCCTCTAGTGGTCGGAGCTGG + Intronic
1166395649 19:42438589-42438611 GGCCCTCTAGTGGTCAGAGCTGG - Intronic
1167447585 19:49547159-49547181 TGCCCTCTAGTGGCTGGATGTGG + Intergenic
1167468131 19:49660928-49660950 GGCCCTCTGCTGCCTCGACCAGG + Intronic
1167469952 19:49670153-49670175 GGCCCTCTATTGGCTGGCCCCGG + Intronic
1167592229 19:50410249-50410271 GGCCCTCATATGCCAGGAGCTGG - Intronic
1168269664 19:55242532-55242554 GGCCCTCTGCAGCCTGGTGCTGG + Intronic
1168687549 19:58357779-58357801 TGCCCTCTGGAGCCTGGAGCAGG + Intronic
925206726 2:2013492-2013514 GGCCCACTGGAGCCTGGAACCGG + Intronic
928417937 2:31112193-31112215 TGCTCTCCTGTGCCTGGAGCTGG - Intronic
930031967 2:47063876-47063898 GGCCCTGTAGTCCTTGGAGTGGG + Intronic
932589811 2:73058646-73058668 GGCTCTCCAGTGTCTGGAGAAGG - Intronic
932866946 2:75353665-75353687 GGCCCTCTAGTTGTTGGACCTGG - Intergenic
932893225 2:75613572-75613594 GGCCTTCTACTACCTGGAGAGGG - Intergenic
934941701 2:98507637-98507659 CGGCCTCTGGTGGCTGGAGCTGG + Intronic
935100904 2:99995086-99995108 GGCACTTTGGTGGCTGGAGCAGG + Intronic
937266407 2:120617363-120617385 GGCCCTCTGAAGCCTGGAGCCGG - Intergenic
938555057 2:132416640-132416662 GGCTCTCAAGTGCCGGCAGCTGG + Exonic
938764050 2:134448768-134448790 GACCCTCTGGTGCCTGGGGTGGG - Exonic
939432671 2:142130888-142130910 AGCCTTCTCCTGCCTGGAGCAGG + Exonic
941499285 2:166249349-166249371 CTCCCTCCAGTGCCTGGAACTGG + Intronic
946370326 2:219277837-219277859 CGGCCTCTAGTGTCTGGAGGAGG - Intronic
947461354 2:230306888-230306910 GGCCCTCTCTTGCCTGAAGGTGG - Intronic
947741342 2:232486392-232486414 GGCCCTCAAGTACCTGGGCCCGG - Exonic
948664040 2:239523552-239523574 AGCCCTCTGGGGTCTGGAGCAGG + Intergenic
948909204 2:240994559-240994581 GGCCCTCAGGTGCCTGGGTCCGG + Intergenic
1169297931 20:4415886-4415908 GGCCCTCTGAGACCTGGAGCAGG - Intergenic
1170160189 20:13302816-13302838 GGCCCTCTAGTGGCTGCACATGG + Intergenic
1172447557 20:35001168-35001190 GCCCCTCTAGTCCTTGGCGCAGG + Intronic
1172502066 20:35434475-35434497 GGCCCAGCTGTGCCTGGAGCTGG - Exonic
1172903188 20:38349685-38349707 GGCTCTGAAGTGGCTGGAGCTGG + Intronic
1175472121 20:59237802-59237824 AGTGCTGTAGTGCCTGGAGCTGG + Intronic
1175959103 20:62626097-62626119 GGCCCTGCAGTGCCTGGGGCGGG + Intergenic
1176240584 20:64074089-64074111 CCCCACCTAGTGCCTGGAGCAGG + Intronic
1178624467 21:34203609-34203631 GGCCCTCCAGGGCCTTGAGTAGG - Intergenic
1178848547 21:36193667-36193689 GTCCCTCTTGTGTCTGGTGCTGG + Intronic
1179798414 21:43799001-43799023 GGTCCGCTAGTGCCTGCTGCTGG + Intronic
1182307791 22:29383118-29383140 GGCCTGCTAATGCCTGGTGCTGG - Intronic
1183189370 22:36311969-36311991 GGCTCTCTAGGACCAGGAGCCGG - Intronic
1183461562 22:37953979-37954001 GGCCCTCCTGTGCCTCCAGCCGG - Intronic
1183574880 22:38681842-38681864 GGTCCTCCAGTGCCCGCAGCGGG - Intergenic
1184117123 22:42428687-42428709 GTCCCTCTGGTGCCTAGAACCGG + Intronic
950097249 3:10337456-10337478 GGTCCCCTTATGCCTGGAGCAGG - Intronic
950405038 3:12798899-12798921 TGTCCTCTGGTTCCTGGAGCGGG + Intronic
953741417 3:45542185-45542207 GGCCCTCAAGTGCTTGGAAAGGG + Intronic
953914004 3:46906506-46906528 GGGCCCCAAGTGCCTGGAGTGGG + Intergenic
954302364 3:49706686-49706708 GGCCCTCTAGTGCCTGGAGCAGG - Intronic
954735004 3:52699991-52700013 GACACTCTAGTGACTAGAGCAGG + Intronic
956845106 3:73175400-73175422 TGTCCTCCATTGCCTGGAGCTGG + Intergenic
960158745 3:114325975-114325997 TTCCCTCTAGTGCCTGGGGTTGG + Intergenic
961025519 3:123552293-123552315 TGCCCTCTAGTGACTGGATAGGG + Intronic
963385347 3:144585668-144585690 GGCGCTATAGTGCCTTGGGCAGG + Intergenic
963781751 3:149493594-149493616 GGTCCTCTAGTGCCAGGCTCTGG - Intronic
964616567 3:158672702-158672724 GCCCCACTACTGCCTGCAGCGGG + Intronic
967880228 3:194296742-194296764 GTCCCTCTAGTGCCAGGTGGGGG + Intergenic
968618988 4:1595208-1595230 GGCCGTCCAGAGCCTGGAGGTGG - Intergenic
969194069 4:5546964-5546986 GGCCTTCTACTCCATGGAGCAGG + Intronic
969230420 4:5826650-5826672 TGTTCTCCAGTGCCTGGAGCAGG - Intronic
969971068 4:11048774-11048796 TACCCTCTAGTGCCTTGAGTTGG + Intergenic
973255936 4:48113489-48113511 GCACCTCTAGTTCCTGGAGAAGG - Intronic
973343184 4:49027030-49027052 GCCACTCTAGTGCCTCAAGCAGG + Intronic
973813265 4:54594258-54594280 GGCCCTCTAGGGCTTGAAACTGG - Intergenic
973980137 4:56301665-56301687 TGCCCTCTAGTGCCTGCACATGG + Intronic
979335189 4:119454578-119454600 GGCCCTACGGTGCCTGGAGCTGG - Intergenic
981098128 4:140802583-140802605 GCCTCTCTAGTAGCTGGAGCTGG + Intergenic
985578353 5:684080-684102 GACCCTCTCGTGCCTGCAGATGG + Intronic
985593283 5:776220-776242 GACCCTCTCGTGCCTGCAGGTGG + Intergenic
985915963 5:2919511-2919533 GCCCCTTTAGTGCCAGCAGCTGG - Intergenic
987572497 5:19682583-19682605 TGCCCTCTGCTTCCTGGAGCTGG - Intronic
991204699 5:64037582-64037604 GCACCTCAAGTGGCTGGAGCAGG - Intergenic
992105393 5:73446666-73446688 GAGCCTCTAGTGCCTGGACAGGG + Exonic
992979784 5:82156945-82156967 AGACAGCTAGTGCCTGGAGCTGG - Intronic
996211619 5:120817974-120817996 GCCCCTGTAGTTCCTGGACCAGG - Intergenic
997623769 5:135318145-135318167 GCCCCTCTAGTCCCTGAGGCTGG - Intronic
998252123 5:140560514-140560536 GGCCCTCTAGTGACTAGGCCTGG - Intronic
998909850 5:146947360-146947382 TGCCCTCTAGTGATTGGATCAGG + Intronic
1001387640 5:171353187-171353209 GGCCCTCTGGGGCCTGGGCCAGG - Intergenic
1001594686 5:172890736-172890758 GCCCCCCTAGTGCCTGGTGTGGG + Intronic
1002321087 5:178376452-178376474 GGCCCCCCACTGCCTGGTGCTGG + Intronic
1005703026 6:28422963-28422985 GACCCTTTACTGGCTGGAGCCGG + Intergenic
1006639963 6:35484814-35484836 GCCCCTCTAGGTCCTGGAGGTGG - Intronic
1007994464 6:46291501-46291523 AGCCCTGCAGTGCCTGGAGGGGG - Intronic
1008171625 6:48214474-48214496 GGACCTCTAGTTCTTGGAGGTGG + Intergenic
1011398691 6:86937234-86937256 TGCCCTCTAGTGTCTGCAACCGG + Intergenic
1012703178 6:102489053-102489075 GGCCCTGGAGTGATTGGAGCAGG + Intergenic
1016301103 6:142632783-142632805 GGAGCTCAAGTGCATGGAGCAGG + Intergenic
1019466662 7:1193447-1193469 GTAGCTCCAGTGCCTGGAGCAGG + Intergenic
1024068882 7:45769143-45769165 GGCGCTACAGTACCTGGAGCTGG + Intergenic
1024503729 7:50142498-50142520 GGCCCTCTAGTGCCCAAATCAGG - Intronic
1025098574 7:56116469-56116491 GGCGGTACAGTGCCTGGAGCAGG + Intergenic
1025187774 7:56874455-56874477 GGCGGTATAGTGCCTGGAGATGG - Intergenic
1025188980 7:56882366-56882388 GGCGGTATAGTACCTGGAGCTGG - Intergenic
1025682957 7:63694553-63694575 GGCGATATAGTACCTGGAGCTGG + Intergenic
1025684148 7:63702471-63702493 GGCGGTATAGTGCCTGGAGATGG + Intergenic
1025834411 7:65081382-65081404 GGCTGTACAGTGCCTGGAGCTGG + Intergenic
1026772874 7:73213267-73213289 GCCCATGTCGTGCCTGGAGCTGG + Intergenic
1027013737 7:74766663-74766685 GCCCATGTCGTGCCTGGAGCTGG + Intergenic
1027074301 7:75179369-75179391 GCCCATGTCGTGCCTGGAGCTGG - Intergenic
1027213187 7:76166542-76166564 GACGCTACAGTGCCTGGAGCTGG - Intergenic
1029125546 7:98292629-98292651 TGACCTCTGGTGCCTGGAGAAGG - Exonic
1029283150 7:99449583-99449605 GTCCCTCCAGTGCCTGGAAAGGG - Intronic
1030206895 7:106959941-106959963 GCCACTCTAGAGGCTGGAGCTGG - Intergenic
1031120704 7:117718603-117718625 GGCACTCTAGTATCTGCAGCAGG - Intronic
1034132596 7:148734317-148734339 GGCTCTCTACAGCCTTGAGCTGG + Intronic
1040109587 8:43561358-43561380 GGCCCTCCAGGGTCTGGTGCAGG + Intergenic
1042022342 8:64380719-64380741 GGCCCTCCAGTGCCTCCCGCCGG - Intergenic
1044734866 8:95268974-95268996 GCAGCTCTAGGGCCTGGAGCAGG + Intronic
1045067755 8:98466584-98466606 GTTCCTCTAGTGCTGGGAGCAGG + Intronic
1046970402 8:120216691-120216713 GGCCAGATAGTGGCTGGAGCTGG + Intronic
1047402147 8:124556550-124556572 TGCCCTTTAGAGCCTGGAGAGGG - Intronic
1049249284 8:141579611-141579633 GGCCCACTAGTGCCAGGTGTGGG + Intergenic
1049424124 8:142530501-142530523 GGACCCCTAGTGCCTGGCTCAGG - Intronic
1049454965 8:142682123-142682145 GGCCCCCCAGAGCCTAGAGCTGG - Exonic
1049588944 8:143446820-143446842 GGCCCTCTGGGGCCTGGACTGGG + Intronic
1053302002 9:36958970-36958992 GCTCCTCTAGTGCAGGGAGCAGG - Intronic
1057222507 9:93264811-93264833 GGCCACCAAGTGCCTGGAGTAGG + Intronic
1057702471 9:97373958-97373980 GGCCTCCTAGGGCCTGGTGCAGG - Intronic
1060190679 9:121590317-121590339 GGCCCACAAGACCCTGGAGCAGG - Intronic
1061165495 9:128919806-128919828 GGCTGTCCAGCGCCTGGAGCAGG + Intergenic
1062730189 9:138104257-138104279 GGCCCTTTGGGGCCTGGAGTGGG + Intronic
1189348520 X:40260316-40260338 GGCACTCTAGTGGCGGGGGCAGG + Intergenic
1190257464 X:48774230-48774252 GTCTCTCCAGTGCCTGGAACAGG - Intergenic
1192473721 X:71420905-71420927 CGCCATCTTGTGCCTGGGGCCGG - Intronic
1195618579 X:106931686-106931708 GGCCCTCTAGATCCAGGGGCTGG - Intronic
1198452720 X:136783790-136783812 GGCTCTCTATTGCCTAAAGCAGG + Intergenic
1199941549 X:152632667-152632689 GGCCCTCTAGTGGCTCTATCTGG + Intergenic
1200829942 Y:7679918-7679940 GGCCCTCTTGTGCTGGGTGCTGG - Intergenic