ID: 954305249

View in Genome Browser
Species Human (GRCh38)
Location 3:49722178-49722200
Sequence CACTTGTCTCCCAAGACTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 143}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954305240_954305249 27 Left 954305240 3:49722128-49722150 CCGATGCGGGCACTTGGGTCCTG 0: 1
1: 0
2: 0
3: 3
4: 63
Right 954305249 3:49722178-49722200 CACTTGTCTCCCAAGACTGAGGG 0: 1
1: 0
2: 1
3: 10
4: 143
954305244_954305249 8 Left 954305244 3:49722147-49722169 CCTGAGAGCGGTGGGAAAAATAC 0: 1
1: 0
2: 1
3: 10
4: 80
Right 954305249 3:49722178-49722200 CACTTGTCTCCCAAGACTGAGGG 0: 1
1: 0
2: 1
3: 10
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954305249 Original CRISPR CACTTGTCTCCCAAGACTGA GGG Intronic
900082556 1:869686-869708 CACCTGTCTCAGAGGACTGATGG - Intergenic
900561708 1:3310308-3310330 CACTCGACTCCCAAGGCTGAGGG - Intronic
900792240 1:4688177-4688199 CACTTCCCTCCCAAGACTACGGG - Intronic
901570042 1:10152862-10152884 CCCTTGGGTCCCCAGACTGAGGG - Intronic
902854089 1:19187286-19187308 CATCTGTCTCCCAACCCTGAAGG + Exonic
905906294 1:41620712-41620734 CACTAGTGTCGCAAGCCTGAAGG - Intronic
907838787 1:58136434-58136456 CAGTGGTCTCACAATACTGAAGG + Intronic
911098467 1:94075302-94075324 CACTTGTATCCCAGAACTTAAGG + Intronic
913219530 1:116648303-116648325 CGGCTGTCTCCCAAGTCTGAAGG + Intronic
914193461 1:145431112-145431134 ATCTTGTCTCCAAAGACTGTAGG + Intergenic
914474790 1:148014002-148014024 ATCTTGTCTCCAAAGACTGTAGG + Intergenic
915930050 1:160054751-160054773 AACTTATCTCCAAAGACTGCTGG + Intronic
916169218 1:161988209-161988231 CAGCTGTCTCCCAGGACTGTTGG - Intronic
916718461 1:167464352-167464374 CACTTGGCTCCAAACACAGAGGG + Intronic
916924116 1:169499433-169499455 TAGTTGTCTCCCAAGACTATGGG - Intergenic
918140226 1:181713782-181713804 CCCTTCTCTCCCAAGTCTGGTGG - Intronic
918651174 1:186965281-186965303 TATTTGTCTCCAAAGCCTGAGGG + Intronic
922500637 1:226094723-226094745 CACCTGTCTCCCAGGGCTGCTGG + Intergenic
1062760021 10:11223-11245 CACCTGTCTCAGAGGACTGATGG - Intergenic
1067710799 10:48649595-48649617 TGGTTGTCTCCCAAGACTGCTGG - Intronic
1067770536 10:49120341-49120363 CTCTCTTTTCCCAAGACTGATGG + Intergenic
1068815171 10:61301712-61301734 CACATGTCCCACAAGAGTGATGG + Intergenic
1071015027 10:80986854-80986876 CACTTGGCTCCCAGGCCTGTGGG - Intergenic
1071790781 10:88951948-88951970 CACTTGCCTCACCAGGCTGAAGG + Intronic
1071971248 10:90909647-90909669 ACCTGGTCACCCAAGACTGATGG + Intergenic
1073390884 10:103175667-103175689 GACTTATCTCCCAAGGGTGAAGG + Intronic
1076547352 10:131254169-131254191 CATTTGTCCCCCAGGCCTGATGG - Intronic
1079918171 11:26396914-26396936 CACATGTATCCCAGGACTTAAGG + Intronic
1085616658 11:78005211-78005233 CACCTGTATCCCAACACTGTGGG - Intergenic
1086545519 11:87963315-87963337 CACTTGTGTACCAAGACATAAGG - Intergenic
1087138803 11:94745782-94745804 TACTTATTTCCCAAGATTGAAGG + Intronic
1089140876 11:116282940-116282962 CACTTTTCTTCCAGGACAGATGG - Intergenic
1089223337 11:116894134-116894156 CACTTGTCTCCTAGGACAGCAGG + Intronic
1089810294 11:121125961-121125983 GACTTGTGACCCAAGAATGAGGG + Intronic
1091066858 11:132522375-132522397 CACTTTTCTCCCAAGGCTGCTGG + Intronic
1091207241 11:133830275-133830297 CACATGACTCCCTAGACTGTTGG + Intergenic
1092143128 12:6197858-6197880 GACCTGTCTCCCAAGATAGATGG + Intergenic
1096106565 12:48999539-48999561 CTGTTGTCCCCCAAGCCTGATGG + Intergenic
1096115196 12:49051302-49051324 CACTTGTCCCCCCAGGCTGAGGG - Exonic
1099792128 12:87349444-87349466 CACTTGTCCTCCAAGAGTCAAGG - Intergenic
1099906189 12:88773288-88773310 CACTTATCTACCAAAAATGATGG + Intergenic
1105524177 13:21160322-21160344 CACTTGTCTTCCAAGATGGCAGG + Intronic
1107380928 13:39855833-39855855 CTCTTGTCTCCCAGTTCTGAGGG + Intergenic
1108614103 13:52114632-52114654 CACTTCTCACCCAATGCTGAGGG - Intronic
1109376762 13:61505244-61505266 CACTTGTCTTCCAAGACACTGGG + Intergenic
1110129571 13:71990538-71990560 AACTTGCAGCCCAAGACTGAAGG + Intergenic
1110861637 13:80350692-80350714 CACATGTCTCCCAGAACTTAAGG - Intergenic
1113718577 13:112533829-112533851 CACTTGTTTCCCAAAACCTATGG - Intronic
1114031358 14:18583627-18583649 CACCTGTCTCAGAGGACTGATGG - Intergenic
1115629595 14:35230754-35230776 CACTTTTCTTCCAAGTCTGCTGG + Intronic
1116549896 14:46223943-46223965 CACTGCTCTCCCATGACTTAAGG + Intergenic
1121551622 14:94807120-94807142 CAGATGTCTCCCAAGAAAGAAGG - Intergenic
1122500012 14:102191204-102191226 CACTTGGCTACCAAGAGGGAAGG + Intronic
1129673093 15:77617782-77617804 CACCAGTCTCCCAGGACTGACGG + Intronic
1131056103 15:89376055-89376077 CTGATGTCTCCCAAGTCTGATGG + Intergenic
1131454749 15:92574843-92574865 CAATTGTCTCCCAAGGGGGATGG + Intergenic
1136735230 16:32461312-32461334 CACCTGTCTCAGAGGACTGATGG + Intergenic
1137380872 16:47998496-47998518 CAGTTATCACCCAAGACAGAAGG - Intergenic
1138335248 16:56247695-56247717 CACTTGTCTCCCGAGGGAGAAGG + Intronic
1139273543 16:65705776-65705798 AACCTTTCTCCCAAGACTGGTGG - Intergenic
1203017850 16_KI270728v1_random:368281-368303 CACCTGTCTCAGAGGACTGATGG - Intergenic
1203036185 16_KI270728v1_random:641439-641461 CACCTGTCTCAGAGGACTGATGG - Intergenic
1142945553 17:3423412-3423434 CACCTGTCCTCCAACACTGAGGG + Intergenic
1152952929 18:11576-11598 CACCTGTCTCAGAGGACTGATGG - Intergenic
1158682232 18:59578920-59578942 CACATGTATCCCAGGACTTAAGG + Intronic
1158993090 18:62890044-62890066 CACTTGGCACCTAGGACTGAGGG + Intronic
1161725587 19:5926676-5926698 CAGCTGTCTCCCCAGACTCAAGG + Intronic
1166212142 19:41313644-41313666 GACTTGTTTCCCAAGAGTGGAGG - Intronic
1167733934 19:51279759-51279781 CTCTGGTCTTCAAAGACTGAGGG - Intergenic
1167734146 19:51281587-51281609 CTCTGGTCTTCAAAGACTGAGGG - Intergenic
925592453 2:5523837-5523859 GACGTTTCTCCAAAGACTGAAGG + Intergenic
926465429 2:13180835-13180857 CATGTGTCTCCCAAGAGTGGTGG - Intergenic
926624665 2:15081166-15081188 CCCTGGTCTCACCAGACTGAAGG + Intergenic
930375858 2:50565957-50565979 CACTGGTGTCCCAAGAATGCAGG - Intronic
934310541 2:91858411-91858433 CACCTGTCTCAGAGGACTGATGG - Intergenic
935641787 2:105297760-105297782 CACATATCTCCCAAGAATAAGGG - Intronic
937083028 2:119153990-119154012 CACATGCACCCCAAGACTGATGG + Intergenic
937495440 2:122414260-122414282 CACTTGTAGCTGAAGACTGAGGG + Intergenic
938496844 2:131802168-131802190 CACCTGTCTCAGAGGACTGATGG + Intergenic
939794181 2:146620787-146620809 CACCTGTCTCTCACCACTGAAGG + Intergenic
941067658 2:160921333-160921355 CATTTGGCTCCCATCACTGAGGG + Intergenic
946208984 2:218131915-218131937 CACTTTTCCCCCAAGAGTGATGG - Intronic
948953346 2:241269609-241269631 CAGATGTACCCCAAGACTGAAGG + Intronic
1169485949 20:6032829-6032851 CCCTTCTCTCCCAAAAATGATGG - Intronic
1171021585 20:21588863-21588885 CTCTTGTTGCCCAAGAGTGATGG - Intergenic
1171541391 20:25960219-25960241 CACATGTCTACCAACAATGAAGG + Intergenic
1171799679 20:29600173-29600195 CACATGTCTACCAACAATGAAGG - Intergenic
1172796591 20:37544087-37544109 CACCTATCCCCCAAGTCTGAGGG + Intergenic
1172931798 20:38591714-38591736 AACCTGTCTCCCCAGGCTGAGGG + Intergenic
1174141011 20:48413619-48413641 CACTTGTCTCCTGAGGCTGCTGG - Intergenic
1180455471 22:15510684-15510706 CACCTGTCTCAGAGGACTGATGG - Intergenic
1180537292 22:16404351-16404373 CACCTGTCTCAGAGGACTGATGG - Intergenic
1180596067 22:16974245-16974267 CGCTTGTCTTCCAGGACTGCAGG + Intronic
1180820822 22:18826365-18826387 CGGCTGTCTCCCAAGTCTGAAGG + Intergenic
1181192153 22:21149678-21149700 CGGCTGTCTCCCAAGTCTGAAGG - Intergenic
1181207042 22:21260831-21260853 CGGCTGTCTCCCAAGTCTGAAGG + Intergenic
1183678090 22:39310955-39310977 CACTTGACTCCCATGACTGCGGG + Intergenic
1203219878 22_KI270731v1_random:34586-34608 CGGCTGTCTCCCAAGTCTGAAGG - Intergenic
1203270949 22_KI270734v1_random:52241-52263 CGGCTGTCTCCCAAGTCTGAAGG + Intergenic
1203324011 22_KI270737v1_random:99895-99917 CACATGTATCCTAAGACTTAAGG - Intergenic
952659809 3:35831891-35831913 CACTTGTCTTTGAAAACTGAAGG + Intergenic
954305249 3:49722178-49722200 CACTTGTCTCCCAAGACTGAGGG + Intronic
954700610 3:52448932-52448954 CCCATGTCTCCCAAGACTGCTGG + Intergenic
956065873 3:65396690-65396712 CACTTATCTGCCAAGAGCGAAGG + Intronic
956398603 3:68852138-68852160 CTCTTGCATCTCAAGACTGACGG + Intronic
957759676 3:84539041-84539063 CACTTTTCTCCTAAGACTCCAGG - Intergenic
957774703 3:84742136-84742158 CACCTGTCTGCCAAGACATAAGG + Intergenic
960489535 3:118297443-118297465 CACTTGTCTTCCAAGATAGAAGG - Intergenic
960513736 3:118580186-118580208 CCTTTGTCTCCCAAGAGTGTTGG - Intergenic
965881524 3:173394293-173394315 CTCTTGTATCCCAAGGCTGTGGG - Intergenic
966300094 3:178469266-178469288 CACATGTATCCCAGGACTTAAGG - Intronic
972763211 4:42127540-42127562 CATTTGTTTCTCAAGACTTAGGG - Intronic
974637174 4:64580060-64580082 CCATTGTCCCCTAAGACTGACGG - Intergenic
980587850 4:134840990-134841012 CACTTGTCTTTCAAGACTTGGGG + Intergenic
980756753 4:137174023-137174045 CACTTGTATCCCAGAACTTAAGG + Intergenic
982118920 4:152120391-152120413 AACTTGTGGTCCAAGACTGAGGG - Intergenic
982453067 4:155575031-155575053 CACTTGTATCCCAGAACTTAAGG + Intergenic
982932432 4:161425888-161425910 CGCTTCTCTCTCAAGAGTGAGGG + Intronic
986339814 5:6779339-6779361 CACCTGTCTCTTAAGACTGATGG + Intergenic
990168576 5:53021652-53021674 CACATTTCTCCCATGCCTGAGGG - Intronic
990582144 5:57174799-57174821 CAGGTTTCTCCCAAAACTGAGGG - Intronic
998681100 5:144468214-144468236 TACTTGTCTCCTCAGACTTAAGG + Intronic
999138624 5:149341503-149341525 TACTTTTCTCCCAAGATTGTTGG + Exonic
1007018634 6:38496174-38496196 CACATGACTCACACGACTGAAGG + Intronic
1010144376 6:72649565-72649587 CATTTGTGTGCCAAGATTGATGG - Intronic
1010250053 6:73697797-73697819 CACTTGGCTCCCAAGACTGCAGG + Intronic
1010734717 6:79431118-79431140 CACCTGGTTCCCACGACTGATGG + Intergenic
1014347506 6:120292745-120292767 CACATGTACCCCAAGACTTAAGG - Intergenic
1015254820 6:131166492-131166514 GAATTGTCTCCCATGATTGAGGG + Intronic
1021384787 7:20015910-20015932 CCTTTGTCTCCCTAGACTCAAGG + Intergenic
1022596372 7:31717419-31717441 GGCTTGGCTCCCAAGGCTGAAGG - Intergenic
1023635611 7:42206964-42206986 CATTTGTCTCTGATGACTGAGGG - Intronic
1024712672 7:52034879-52034901 CACTTGTATTCCAACACTGTTGG - Intergenic
1025144201 7:56490853-56490875 CACATGCATTCCAAGACTGAAGG + Intergenic
1025608291 7:63054907-63054929 CACGTCTCTACCGAGACTGATGG - Intergenic
1028580820 7:92408248-92408270 CCCTTTTCTTCCAAAACTGAAGG - Intergenic
1031180210 7:118404659-118404681 CACTTGTCTCCCTCGACCGTGGG - Intergenic
1031222834 7:118993770-118993792 CTGTTGTATCCCAAGACAGATGG - Intergenic
1032460580 7:132107135-132107157 CTCTTGACTCCCAAGCCTGCTGG + Intergenic
1033196622 7:139333043-139333065 AACTTGTCTCCCCAGTCTGTGGG + Intergenic
1033499569 7:141934384-141934406 CTCATGTCACCCAAGATTGAAGG - Intronic
1034327255 7:150247949-150247971 CAATTGGCTCACAAGCCTGAAGG - Intronic
1034765956 7:153721508-153721530 CAATTGGCTCACAAGCCTGAAGG + Intergenic
1035133252 7:156675302-156675324 CCCTCGTCTCCAAAGACGGAGGG - Intronic
1037562438 8:20087084-20087106 CATTTGTTTCCCAAGACTCAAGG - Intergenic
1038532991 8:28333759-28333781 CACTTGTTTCCATAAACTGACGG + Intronic
1043079961 8:75754788-75754810 CACTCATCTCCCTAGTCTGATGG + Intergenic
1052228453 9:26118226-26118248 CACTTGTGCACCAAGACTAAGGG + Intergenic
1053249019 9:36559027-36559049 CTCTTGTCTCCCAGGCCAGAGGG - Intergenic
1055354075 9:75419331-75419353 CACTTGTCTTCCATGTCTTAAGG + Intergenic
1186144454 X:6610987-6611009 CACAGGTCTCACAAGACTGCAGG - Intergenic
1187733466 X:22280322-22280344 CACATGTATACCAAGACTGTAGG - Intergenic
1195525074 X:105878607-105878629 CATTTGTTTCCCAAGACTTTAGG + Intronic
1198573474 X:137984010-137984032 TATTTTTCTCCCAAGACAGAGGG + Intergenic
1199500637 X:148501762-148501784 CGCTTGGCTTTCAAGACTGAGGG + Intronic