ID: 954307171

View in Genome Browser
Species Human (GRCh38)
Location 3:49734441-49734463
Sequence GAGTGGCATTTGAAGTTGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 156}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954307171_954307174 -4 Left 954307171 3:49734441-49734463 CCCAGCAACTTCAAATGCCACTC 0: 1
1: 0
2: 0
3: 13
4: 156
Right 954307174 3:49734460-49734482 ACTCTCCTCTCCAGAACTGCAGG 0: 1
1: 0
2: 4
3: 32
4: 228
954307171_954307177 16 Left 954307171 3:49734441-49734463 CCCAGCAACTTCAAATGCCACTC 0: 1
1: 0
2: 0
3: 13
4: 156
Right 954307177 3:49734480-49734502 AGGCCTCTCCTCTAACTGTGTGG 0: 1
1: 1
2: 6
3: 92
4: 1022

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954307171 Original CRISPR GAGTGGCATTTGAAGTTGCT GGG (reversed) Intronic
902519553 1:17008469-17008491 TAGAAGCATTTGAAGTTCCTGGG + Intronic
902808229 1:18873911-18873933 GATTGGCATCTGAAGTTGGGGGG + Intronic
903646413 1:24898760-24898782 GAGTGGTTTTTGAAGTCGGTGGG + Intergenic
903672357 1:25044085-25044107 GATTGGATTTTGAAATTGCTTGG - Intergenic
904489904 1:30852178-30852200 GAGTGGAAATGGAAGTTGCATGG + Intergenic
904830467 1:33303392-33303414 GGGTGGCATTTGAGCTTGCATGG + Intergenic
906809035 1:48807745-48807767 GAAGGGCAGTGGAAGTTGCTTGG + Intronic
907637122 1:56146444-56146466 GAGTGAGATTTGAAGAAGCTGGG - Intergenic
907797865 1:57735498-57735520 GAGAGGCATTTTATCTTGCTTGG - Intronic
908004625 1:59715100-59715122 GAAATGCATTTGAACTTGCTGGG + Intronic
908261910 1:62345627-62345649 CTCTGCCATTTGAAGTTGCTAGG + Intergenic
909191249 1:72555348-72555370 GGGCGACATTTGCAGTTGCTTGG + Intergenic
910087877 1:83425583-83425605 GAGGGGCATTTGAAGCAACTTGG + Intergenic
913360881 1:117978772-117978794 GAGGGGCATTTGACCTTGCAGGG + Intronic
917625819 1:176845124-176845146 GAGTGTGAGTTGATGTTGCTGGG - Exonic
922224237 1:223631445-223631467 AAGTGGCCTTAGAACTTGCTGGG - Intronic
922415213 1:225415578-225415600 GCGTGGCTGTTGCAGTTGCTTGG - Intronic
923409163 1:233690393-233690415 GAATGGCCCTTGAAGTTGCCTGG - Intergenic
1073078389 10:100839196-100839218 GATTGTCATATCAAGTTGCTGGG - Intergenic
1073493266 10:103869554-103869576 GAATGGCATATGAGGGTGCTGGG - Intergenic
1074161115 10:110837120-110837142 GAGTGGCATTGAAGTTTGCTGGG + Exonic
1074924878 10:118058000-118058022 GAGTTGCATTTGGAATTTCTGGG + Intergenic
1078466993 11:11557724-11557746 CAATGGCATCTGAGGTTGCTGGG + Intronic
1087483934 11:98737140-98737162 GAGATACATTTGAAGTTCCTGGG + Intergenic
1090726750 11:129534011-129534033 GAGTGGCATTTGGTCCTGCTGGG - Intergenic
1095634825 12:44420725-44420747 GAGTGGCGATTTAAGTGGCTTGG - Intergenic
1100921797 12:99496935-99496957 GAGAGGCAATTGAGGATGCTTGG - Intronic
1101520031 12:105474129-105474151 CTGTGGCATTTGAAGCTGCTGGG + Intergenic
1102666085 12:114574109-114574131 GAATGGCCTTAGAAGTTGTTTGG - Intergenic
1107171323 13:37345497-37345519 GAGGGGTCTTTGAAGTTTCTTGG + Intergenic
1110941592 13:81357281-81357303 GAGTGGCATTTCAATTTGAAAGG - Intergenic
1111296098 13:86279675-86279697 GAGTGGCATCTGAACTATCTGGG - Intergenic
1112617480 13:101020173-101020195 GAGTGGCATGTTAAGTTATTTGG - Intergenic
1113925261 13:113938457-113938479 GAGAGCAATTTGAAGATGCTGGG - Intergenic
1116223472 14:42117387-42117409 GAGTGGGATTAGAAGTTGAAAGG + Intergenic
1119556127 14:75554341-75554363 GACTGGCATCTGAAGTTGGTTGG - Intergenic
1120658965 14:87230319-87230341 GATTGGATTTTGAAGTTGCATGG - Intergenic
1122909039 14:104817517-104817539 AAGTGGCACTTGTAGTTACTTGG - Intergenic
1123014198 14:105365789-105365811 GAGTGGCATCTGATGTGGCAGGG - Intronic
1202899704 14_GL000194v1_random:28063-28085 GAGTGGAAGTTGAAGTTTGTGGG - Intergenic
1126275933 15:46881009-46881031 GATTGGCATTTAAGGTTTCTAGG + Intergenic
1129449571 15:75643214-75643236 GAGTGGTATTTGAAGTCATTCGG + Intronic
1129834171 15:78691669-78691691 GCTTGGCATTGGAAGTCGCTTGG - Intronic
1130087175 15:80787395-80787417 GATGGGCATTTGCAGTTGCCTGG + Intronic
1131128254 15:89874898-89874920 GAGTCGTATTTTAAGTTGGTGGG + Intronic
1131467636 15:92668173-92668195 AAGTGGCATTTGATGATGCCAGG + Intronic
1138868497 16:60851654-60851676 GAGTGGAATTCCATGTTGCTGGG - Intergenic
1142862465 17:2771160-2771182 GAGTGGCAGGTAAATTTGCTGGG + Intergenic
1143850524 17:9808258-9808280 AAGTGGCTTTAAAAGTTGCTTGG + Intronic
1144038145 17:11385642-11385664 GAGTGGCTTTTGAAGCTGGGAGG + Intronic
1145984959 17:29039564-29039586 GAGTGGCATATGGAGTTGTGAGG + Intronic
1148616921 17:49007636-49007658 GAGTGGCATTTGGGATTGCTTGG + Intronic
1149221391 17:54418505-54418527 GACTGGCCTTTTAAGTTGCATGG + Intergenic
1153163404 18:2235093-2235115 GATTGGAATTTGTATTTGCTTGG - Intergenic
1156839727 18:41597130-41597152 GGGTTGCATTTGCACTTGCTGGG - Intergenic
1158997578 18:62938799-62938821 GAGGGGTTTTTTAAGTTGCTTGG + Intronic
1161204777 19:3035342-3035364 GCGTGGCAAATGAAGTCGCTGGG - Intronic
1161732868 19:5972763-5972785 GAGTGGCATTTGGAGGAGCTTGG - Intronic
1166037722 19:40181269-40181291 AACTGGCATCTGAAGTTGGTGGG + Intergenic
1166129377 19:40736906-40736928 GGGAGGTATTTGAGGTTGCTGGG + Intronic
1202647752 1_KI270706v1_random:157565-157587 GAGTGGAAGTTGAAGTTTGTGGG + Intergenic
925232446 2:2245832-2245854 GAGAGGGATTTGGAGATGCTAGG + Intronic
926339918 2:11896402-11896424 GGGTGGCATTTGCAGATGATGGG - Intergenic
927044889 2:19267233-19267255 GAGTAGCACTGGAAGTTCCTGGG + Intergenic
928092894 2:28386862-28386884 AAGTGGGACTTGAAGATGCTTGG + Intergenic
928115216 2:28541309-28541331 AAATTGCATTTGAAGTTGCATGG + Intronic
929505667 2:42526037-42526059 AGGTGGCATTTGAAATTCCTGGG - Intronic
930077153 2:47415731-47415753 GAATGTCATTTTAAATTGCTAGG - Intronic
930798802 2:55420792-55420814 GAGTAGCATTTGATTTTGCCAGG - Intergenic
935429611 2:102961127-102961149 GAGTGCCATTTGCTTTTGCTGGG - Intergenic
937436667 2:121887225-121887247 GAGTGGGATTGGAAGCTGTTGGG - Intergenic
939201244 2:139037782-139037804 GAATGATATTTGAAGTAGCTAGG - Intergenic
944511461 2:200470187-200470209 CAGTGGCATTTGAAGACTCTAGG - Intronic
947415844 2:229894718-229894740 CAGTAGGATTTGAAGTTCCTTGG - Intronic
947937510 2:234020886-234020908 GGGATGCATTTGAAGTTGCTGGG + Intergenic
948068613 2:235101770-235101792 TAATGGCATTTGAAGTTACCTGG - Intergenic
1169885852 20:10396724-10396746 GGGTGGTATTTCAACTTGCTGGG + Intergenic
1173263648 20:41459060-41459082 GAGTTGGATTTGAAGTTACTGGG + Intronic
1176510383 21:7743748-7743770 AACTGGCATTTTCAGTTGCTGGG - Intergenic
1176604099 21:8815166-8815188 GAGTGGAAGTTGAAGTTTGTGGG - Intergenic
1176619079 21:9042837-9042859 GAGTGGAAGTTGAAGTTTGTGGG - Intergenic
1176706062 21:10120587-10120609 GAGTTGAATTTGAAGTTTGTGGG + Intergenic
1178032458 21:28543386-28543408 GATTGGCATCTGAAGTTGGGGGG + Intergenic
1178644496 21:34374277-34374299 AACTGGCATTTTCAGTTGCTGGG - Intergenic
1178879662 21:36439215-36439237 GAGTGGCATTTTAAATTGATTGG - Intergenic
1179140233 21:38718726-38718748 GAGTAGCACTTGAAGTTCTTTGG - Intergenic
1179451334 21:41470396-41470418 GAATGGCTTTTGAAGTATCTGGG - Intronic
1180346383 22:11706744-11706766 GAGTGGAAGTTGAAGTTTGTGGG - Intergenic
1180354155 22:11824897-11824919 GAGTGGAAGTTGAAGTTTGTGGG - Intergenic
1180384090 22:12167429-12167451 GAGTGGAAGTTGAAGTTTGTGGG + Intergenic
1182739561 22:32557729-32557751 GAGTGGCATGTGACGAGGCTGGG - Intronic
950185762 3:10944650-10944672 GAGAGGCATTGGAAGTACCTGGG + Intergenic
954307171 3:49734441-49734463 GAGTGGCATTTGAAGTTGCTGGG - Intronic
956877604 3:73479202-73479224 CAGTTTTATTTGAAGTTGCTGGG - Intronic
957002706 3:74905085-74905107 GAGTGGCATGGGAAGCTTCTTGG - Intergenic
958707923 3:97679365-97679387 GAGTAGCATTTGAAGTGTGTGGG + Intronic
962879427 3:139562256-139562278 GTGTGGCATTTGTAACTGCTGGG + Intronic
966023295 3:175242821-175242843 AACTGGCATTTAAAATTGCTTGG + Intronic
966158787 3:176946717-176946739 GTGTGGTTTTTGAAGTTGCAGGG - Intergenic
966676645 3:182597225-182597247 GGGTGGCATTTTCAGTAGCTGGG - Intergenic
966983465 3:185158859-185158881 TGGAGGCATTTGAAGGTGCTGGG - Intergenic
967501427 3:190202663-190202685 AAGTGACATTTTAAGTTGGTGGG + Intergenic
969128349 4:4971497-4971519 GATTGGCATCTGAAGTTGGGGGG - Intergenic
969564633 4:7970708-7970730 GGGTGGCTTCTGAAGTTGCTGGG + Intronic
973374016 4:49275754-49275776 GAGTGGAAGTTGAAGTTTGTGGG + Intergenic
973383396 4:49334485-49334507 GAGTGGAAGTTGAAGTTTGTGGG - Intergenic
973387003 4:49519499-49519521 GAGTGGAAGTTGAAGTTTGTGGG - Intergenic
975266716 4:72377717-72377739 AAGTGGCCTTTGATGTTGCCAGG + Intronic
976110897 4:81672684-81672706 TTTTTGCATTTGAAGTTGCTTGG + Intronic
978617202 4:110609916-110609938 CAGTGGCCTTTGAAGAAGCTAGG + Intergenic
982395999 4:154916326-154916348 GGGTGGCATTGGAAGTTGCCAGG + Intergenic
986049615 5:4076665-4076687 GGGTGGGCTTTGAAGTTGCATGG + Intergenic
986081384 5:4398432-4398454 GTGTGGAATTTAAAGTTGTTGGG + Intergenic
988800104 5:34688688-34688710 GAGAGCCATTTGAAATTGTTGGG - Intronic
990708785 5:58560185-58560207 GAGAGTCATGTCAAGTTGCTGGG + Intergenic
993485122 5:88474571-88474593 CAGTTGCAATTGAAGTTACTGGG + Intergenic
994804687 5:104429191-104429213 GTATGGCATGTGAAGTTGTTTGG + Intergenic
997633132 5:135385102-135385124 GAGGCCCATTTGAAGTAGCTGGG - Intronic
999118727 5:149189835-149189857 GAGTGGAATTTGGAATTGCTGGG - Intronic
1000170285 5:158695625-158695647 GCTTGGCTGTTGAAGTTGCTGGG + Intergenic
1002477093 5:179473339-179473361 GAGTGGCTGTTGATGTCGCTGGG - Intergenic
1003794283 6:9582417-9582439 GGATGGCATTTGAAGTAACTGGG + Intergenic
1005761898 6:28975196-28975218 CAGTGGCAGTTGATGTTGCTAGG + Intergenic
1005793938 6:29337153-29337175 AACTGGCATGTGAAGTTGGTTGG + Intergenic
1006340343 6:33443305-33443327 GAGGGGGATTCGCAGTTGCTGGG - Exonic
1006825603 6:36932806-36932828 GAGAGGCATTTGAACTTGGGAGG + Intergenic
1011106680 6:83789354-83789376 GTGTGGCAGTTGATGTTGCTTGG - Intergenic
1011140354 6:84148263-84148285 AAGTGGCATTTGAAGTATTTAGG - Intronic
1014276127 6:119391897-119391919 GATTAGCATTTGAAGATGCCTGG + Intergenic
1014389511 6:120843335-120843357 AAGGGGCATTTGAACTTTCTGGG - Intergenic
1017153984 6:151306751-151306773 GAGCTGCTTTTGAAGTTGGTGGG + Intronic
1018056758 6:160058817-160058839 TAGTGGGATTTGGAGTTGCTAGG + Intronic
1018751782 6:166812664-166812686 GAGTGAGATGTGAAGTTGCAGGG - Intronic
1019380635 7:720742-720764 GAGTGGCTGTTGAAATTCCTTGG - Intronic
1019765286 7:2844996-2845018 GAGTGGGGTCTGGAGTTGCTGGG + Intergenic
1021670064 7:23026657-23026679 GAGCGGCAGTTTAAGCTGCTGGG + Intergenic
1024342198 7:48277835-48277857 TTGTGGCTTTTTAAGTTGCTAGG + Intronic
1027304758 7:76882057-76882079 GAGGGGCATTTGAAGCAACTTGG + Intergenic
1028434251 7:90783087-90783109 GAGTGGCATATAAAGTTCATAGG - Intronic
1028613047 7:92733662-92733684 TAGTGGCATTTAAAATTGGTGGG - Intronic
1030756778 7:113295272-113295294 GGGTGGGTTTTGAAGTTCCTGGG - Intergenic
1038139624 8:24830080-24830102 AAGTGGTATTTCAAGTTACTAGG + Intergenic
1039236307 8:35506409-35506431 GATTGGCATATGAAATTGCAGGG + Intronic
1040747867 8:50668098-50668120 AAGCTGGATTTGAAGTTGCTGGG - Intronic
1041875483 8:62682660-62682682 GACTGGCCTTTTAAGTTGCATGG + Intronic
1049960041 9:729563-729585 GAGTGGGAAATGAAGTTGCGGGG + Intronic
1051318603 9:15873356-15873378 AAGTTATATTTGAAGTTGCTTGG + Intronic
1053216705 9:36277543-36277565 GAGTGGAATGTGAAGTTGTGTGG - Intronic
1053643335 9:40107704-40107726 GAGTTGAATTTGAAGTTTGTGGG + Intergenic
1053762817 9:41357786-41357808 GAGTTGAATTTGAAGTTTGTGGG - Intergenic
1054324189 9:63704932-63704954 GAGTTGAATTTGAAGTTTGTGGG + Intergenic
1054350912 9:64016316-64016338 GAGTGGAAGTTGAAGTTTGTGGG - Intergenic
1054541420 9:66268899-66268921 GAGTTGAATTTGAAGTTTGTGGG - Intergenic
1054720100 9:68595366-68595388 AAGGGGCATTTGAAGTGGCCTGG - Intergenic
1055221793 9:73942936-73942958 AAATTGCATTTAAAGTTGCTGGG + Intergenic
1055667681 9:78569001-78569023 GGGTGGCATTTGACATGGCTTGG - Intergenic
1060643691 9:125260525-125260547 GATTGACATTTGAAATAGCTGGG + Intergenic
1062423087 9:136493462-136493484 GAGTGGAATTTCAGGGTGCTGGG + Intergenic
1202791095 9_KI270719v1_random:90675-90697 GAGTTGAATTTGAAGTTTGTGGG + Intergenic
1203697695 Un_GL000214v1:113666-113688 GAGTGGAAGTTGAAGTTTGTGGG + Intergenic
1203551510 Un_KI270743v1:167320-167342 GAGTGGAAGTTGAAGTTTGTGGG - Intergenic
1188538575 X:31224156-31224178 CAGTTGCATATTAAGTTGCTAGG - Intronic
1190134238 X:47780588-47780610 GTGTGGCCTATGAAGTTGGTGGG - Intergenic
1194092499 X:89596659-89596681 GAATGCCATTTGAAGATCCTTGG - Intergenic
1197196378 X:123705810-123705832 GTGTGGGATTTGAAGCTTCTTGG - Intronic
1197492762 X:127139012-127139034 GAGTGGAAATGGAAGTTACTGGG + Intergenic
1198370338 X:135983601-135983623 GAGGGGCATACTAAGTTGCTGGG + Intergenic
1198384823 X:136118663-136118685 GATTGGCATAGGAAGATGCTAGG - Intergenic
1200445133 Y:3252695-3252717 GAATGCCATTTGAAGATCCTTGG - Intergenic
1201152787 Y:11102928-11102950 GAGTGGAAGTTGAAGTTTGTGGG - Intergenic