ID: 954309542

View in Genome Browser
Species Human (GRCh38)
Location 3:49754438-49754460
Sequence CTTTGGAAGGCCAAGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 274879
Summary {0: 52, 1: 2206, 2: 28156, 3: 83347, 4: 161118}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954309535_954309542 11 Left 954309535 3:49754404-49754426 CCATGTATGGTGGCTCACACCTG 0: 4
1: 608
2: 13671
3: 52863
4: 126146
Right 954309542 3:49754438-49754460 CTTTGGAAGGCCAAGGTGGAAGG 0: 52
1: 2206
2: 28156
3: 83347
4: 161118
954309537_954309542 -8 Left 954309537 3:49754423-49754445 CCTGTCATCCTAACACTTTGGAA 0: 2
1: 129
2: 4617
3: 63396
4: 353757
Right 954309542 3:49754438-49754460 CTTTGGAAGGCCAAGGTGGAAGG 0: 52
1: 2206
2: 28156
3: 83347
4: 161118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954309542 Original CRISPR CTTTGGAAGGCCAAGGTGGA AGG Intronic
Too many off-targets to display for this crispr