ID: 954314709

View in Genome Browser
Species Human (GRCh38)
Location 3:49794890-49794912
Sequence GTGCTTGCAGTGGGAAGGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 583
Summary {0: 1, 1: 0, 2: 4, 3: 36, 4: 542}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954314709_954314722 2 Left 954314709 3:49794890-49794912 CCACCCCTTCCCACTGCAAGCAC 0: 1
1: 0
2: 4
3: 36
4: 542
Right 954314722 3:49794915-49794937 TGCAAGTGGGTCTGGGAGCTGGG 0: 1
1: 0
2: 0
3: 25
4: 276
954314709_954314726 18 Left 954314709 3:49794890-49794912 CCACCCCTTCCCACTGCAAGCAC 0: 1
1: 0
2: 4
3: 36
4: 542
Right 954314726 3:49794931-49794953 AGCTGGGGCTGGGCACCTCAAGG 0: 1
1: 0
2: 3
3: 54
4: 368
954314709_954314717 -6 Left 954314709 3:49794890-49794912 CCACCCCTTCCCACTGCAAGCAC 0: 1
1: 0
2: 4
3: 36
4: 542
Right 954314717 3:49794907-49794929 AAGCACCCTGCAAGTGGGTCTGG 0: 1
1: 0
2: 0
3: 8
4: 98
954314709_954314725 8 Left 954314709 3:49794890-49794912 CCACCCCTTCCCACTGCAAGCAC 0: 1
1: 0
2: 4
3: 36
4: 542
Right 954314725 3:49794921-49794943 TGGGTCTGGGAGCTGGGGCTGGG 0: 1
1: 0
2: 8
3: 110
4: 941
954314709_954314721 1 Left 954314709 3:49794890-49794912 CCACCCCTTCCCACTGCAAGCAC 0: 1
1: 0
2: 4
3: 36
4: 542
Right 954314721 3:49794914-49794936 CTGCAAGTGGGTCTGGGAGCTGG 0: 1
1: 0
2: 2
3: 36
4: 319
954314709_954314723 3 Left 954314709 3:49794890-49794912 CCACCCCTTCCCACTGCAAGCAC 0: 1
1: 0
2: 4
3: 36
4: 542
Right 954314723 3:49794916-49794938 GCAAGTGGGTCTGGGAGCTGGGG 0: 1
1: 0
2: 4
3: 46
4: 459
954314709_954314718 -5 Left 954314709 3:49794890-49794912 CCACCCCTTCCCACTGCAAGCAC 0: 1
1: 0
2: 4
3: 36
4: 542
Right 954314718 3:49794908-49794930 AGCACCCTGCAAGTGGGTCTGGG 0: 1
1: 0
2: 1
3: 11
4: 127
954314709_954314724 7 Left 954314709 3:49794890-49794912 CCACCCCTTCCCACTGCAAGCAC 0: 1
1: 0
2: 4
3: 36
4: 542
Right 954314724 3:49794920-49794942 GTGGGTCTGGGAGCTGGGGCTGG 0: 1
1: 0
2: 9
3: 107
4: 1163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954314709 Original CRISPR GTGCTTGCAGTGGGAAGGGG TGG (reversed) Intronic
901256279 1:7830026-7830048 GTGCTGGCAGTAGGATGGGATGG - Exonic
901533233 1:9866593-9866615 TTGCTTGAACTGGGAAGGTGGGG + Intronic
901550245 1:9990609-9990631 ATTCTTGCAGTAGGGAGGGGAGG + Intergenic
903033130 1:20477468-20477490 GTGATGGCAGTGGGGTGGGGTGG - Intergenic
903168707 1:21538784-21538806 GGGCTTGCAGTGGCAGGGAGGGG - Intronic
903216439 1:21846079-21846101 GTCCCTGCAGTGGGACGGGAAGG - Intronic
903255053 1:22091682-22091704 GTACTGGGAGGGGGAAGGGGGGG - Exonic
903332501 1:22603171-22603193 GTGCTGGCTATGGGGAGGGGGGG - Exonic
904311944 1:29634814-29634836 GTGGGTGGAGTGGGAGGGGGAGG - Intergenic
904815234 1:33191404-33191426 GTGCCTGCTTTGGGAAGGGAAGG - Intergenic
905560790 1:38925431-38925453 GAGGTTGCAGTGGGAGGCGGAGG + Intronic
906030804 1:42718530-42718552 GGGCTGGCCATGGGAAGGGGTGG - Intergenic
906211861 1:44016611-44016633 ATGGTTTCAGTGGCAAGGGGTGG - Intronic
906226388 1:44125865-44125887 GTCTCTTCAGTGGGAAGGGGAGG + Intronic
906320186 1:44810798-44810820 GTGTGTGCTGTGGGAAGAGGGGG + Intronic
906616993 1:47240262-47240284 GAGGTTGCAGTGAGAAGGAGAGG + Intergenic
906668457 1:47638259-47638281 ATGATTGCAGTGGCAAAGGGAGG + Intergenic
907384675 1:54118334-54118356 GTTCCTGCAGGGGGAGGGGGAGG - Intergenic
907679684 1:56551537-56551559 ATGCTTTGAGTGGGGAGGGGAGG - Intronic
907819613 1:57954097-57954119 GTGCTTCCAGTGGGGATGAGGGG + Intronic
908565238 1:65347696-65347718 GTGATTGCAGTGTTGAGGGGAGG - Intronic
910257074 1:85259214-85259236 GGGCTTGAGGTGGGAGGGGGTGG + Intronic
912707829 1:111927989-111928011 GTCCAGGCAGTGGGTAGGGGAGG - Intronic
913046781 1:115080397-115080419 ATGCTTGTAGTGGGAGGAGGAGG - Intronic
913532063 1:119740529-119740551 GACCTTGCAGAGGGAGGGGGAGG + Intronic
913565623 1:120069683-120069705 GGGCTTGCGGTGGGAGGAGGCGG - Intergenic
913632506 1:120723870-120723892 GGGCTTGCGGTGGGAGGAGGCGG + Intergenic
914286219 1:146229057-146229079 GGGCTTGCGGTGGGAGGAGGCGG - Intergenic
914547247 1:148679799-148679821 GGGCTTGCGGTGGGAGGAGGCGG - Intergenic
914619256 1:149390544-149390566 GGGCTTGCGGTGGGAGGAGGCGG + Intergenic
915109595 1:153554561-153554583 GAGATGGCTGTGGGAAGGGGAGG + Intergenic
915132540 1:153705701-153705723 GTTGTTGCAATGGAAAGGGGCGG - Intergenic
915442060 1:155951447-155951469 GGGCTTGAATGGGGAAGGGGAGG - Intronic
915630711 1:157152141-157152163 GTACTGCCAGTGGGGAGGGGTGG + Intergenic
917256481 1:173121498-173121520 GAGCTTGCAGTGAGCAGAGGTGG + Intergenic
917869166 1:179227026-179227048 GTGGTGGCAGTGGAAATGGGAGG - Intronic
917874845 1:179277088-179277110 GCTCTTGCAAAGGGAAGGGGAGG - Intergenic
918308901 1:183271433-183271455 TTGCTTTCTGTGGGAGGGGGTGG - Intronic
918457599 1:184739745-184739767 GTGTTTGTAGTGGGTAGGGAAGG - Intronic
919638804 1:200029767-200029789 GTGCTTGGGTTGGGAAGGGGCGG - Intronic
920147968 1:203879008-203879030 GTGCTAGCTTGGGGAAGGGGTGG + Intergenic
920156438 1:203955817-203955839 GGGTTTCCAGTGGGAAGGGAAGG + Intergenic
920216904 1:204367410-204367432 GTGGAGGCAGTGGGAAGGGAAGG - Intronic
920534182 1:206726858-206726880 CAGCTTGCAGAGGGAAGGGAAGG - Intronic
920595777 1:207268492-207268514 GTGGATGCAGTGAGAAGGGCAGG + Intergenic
922500518 1:226094019-226094041 GTGATTGCATCGGGAATGGGGGG + Intergenic
922504899 1:226120786-226120808 GTGGATGCAGAGGGAATGGGAGG + Intergenic
923986610 1:239388246-239388268 GTGTTTGCAATGTGAAAGGGCGG + Intronic
924425981 1:243950723-243950745 GCTCTTGCAGGGAGAAGGGGAGG - Intergenic
1062890770 10:1057568-1057590 CTGCTTTCAGGGGGAAGGGAAGG - Intronic
1063518535 10:6720176-6720198 GAGCTTGCAGTGAGCAGGGATGG + Intergenic
1064186957 10:13170194-13170216 GTGATTACAATGGGAAGTGGGGG + Intronic
1064276954 10:13915259-13915281 GCTCTAGCAGTGGGAAGGCGGGG + Intronic
1065044994 10:21739189-21739211 GAGCTTGCAGTGGCAAGGCATGG - Intronic
1065378087 10:25062777-25062799 GAGCATGCAGTGGGAAGGGGAGG - Intergenic
1065500838 10:26380893-26380915 CTGCATCCGGTGGGAAGGGGTGG + Intergenic
1065571376 10:27073534-27073556 GTGTTTTCAGGGGGAAGGGAGGG - Intronic
1066191742 10:33062234-33062256 GTGCTTCCAGCGGGTGGGGGTGG + Intergenic
1066227170 10:33394473-33394495 GGGCTTCCAGGGGGAAGAGGAGG + Intergenic
1066546662 10:36507513-36507535 GTGATTAGAGTGGGAAGGGCAGG - Intergenic
1067569464 10:47360807-47360829 GTGCCTGCAGGGAGAATGGGAGG - Intergenic
1068618496 10:59149753-59149775 GAGATAGCAGTGGGAAGGTGAGG - Intergenic
1069647079 10:70008218-70008240 GTGCTTGCAGGGAGAAGAGAAGG - Intergenic
1069673878 10:70233404-70233426 GTGCTCGCAGTGCGCAGGCGTGG - Exonic
1069705953 10:70459089-70459111 GGGCTTGGAGTGGGGTGGGGTGG - Intergenic
1069798982 10:71070633-71070655 GGGCTGGCAGTGAGCAGGGGTGG - Intergenic
1070373056 10:75803818-75803840 CTGCGTGCAGTGGTTAGGGGTGG - Intronic
1070775530 10:79107693-79107715 GGGCTTGCAGGGGGCAGGGAGGG + Intronic
1071703441 10:87968405-87968427 ATGCATGCAGATGGAAGGGGTGG + Exonic
1073108634 10:101047849-101047871 GGGATTGGGGTGGGAAGGGGGGG - Intergenic
1074036313 10:109742374-109742396 TTGGTTGCAGTGGGAAGCGGAGG + Intergenic
1074496012 10:113980756-113980778 GTGGTTGCAGAGGGAAGGATGGG - Intergenic
1074645665 10:115449383-115449405 TGGCTTGCAGTGGGAAGGGGAGG - Intronic
1075060989 10:119256544-119256566 GTACATGGAGTGGGAAGGGGAGG + Intronic
1075998633 10:126897584-126897606 TAGCAGGCAGTGGGAAGGGGAGG + Intergenic
1076256070 10:129025753-129025775 GGGCTTGAAGAGGGAGGGGGCGG - Intergenic
1076614979 10:131749212-131749234 AAGCTGGGAGTGGGAAGGGGAGG - Intergenic
1077406634 11:2385348-2385370 GTGGTTGCCCTGGGACGGGGAGG - Intronic
1077869982 11:6253600-6253622 TGGCTTGCAGGGGGAAGAGGTGG + Intergenic
1077913730 11:6597157-6597179 GAGCCTGCACTGGGAAAGGGAGG + Exonic
1079023589 11:16927977-16927999 GTGTGTGGAGGGGGAAGGGGGGG + Intronic
1079311733 11:19372565-19372587 GTGCTTGCAGAGGGGAGCAGTGG + Intronic
1079785991 11:24673448-24673470 GTCCTTGCAGGGTGCAGGGGTGG + Intronic
1080168971 11:29275869-29275891 GGGCTTGCAGTTGGATGAGGTGG - Intergenic
1080580092 11:33635211-33635233 GCACTTGCAGTGGGCAGAGGAGG + Intronic
1080837724 11:35955861-35955883 GTGTGTGCAGTGGGAATGGTGGG + Intronic
1080854289 11:36098351-36098373 GTTCTTGCAGTGGTAGCGGGCGG - Exonic
1081646323 11:44792996-44793018 ATGCTCCCAGGGGGAAGGGGAGG + Intronic
1081965131 11:47164816-47164838 GTGCTTACTGTAGAAAGGGGTGG + Exonic
1082219039 11:49610345-49610367 GTGGGGGCACTGGGAAGGGGAGG - Intergenic
1082747570 11:56981832-56981854 GAGGTTGTAGTGGTAAGGGGAGG - Intergenic
1083138373 11:60701124-60701146 GTGATGGCAGGGGGAAGGGAAGG + Intronic
1083170193 11:60919581-60919603 GTGCTTGCTTGGGGTAGGGGTGG + Intronic
1083866857 11:65459826-65459848 GTGGTTTCTGAGGGAAGGGGTGG - Intergenic
1083893172 11:65607053-65607075 GGTCTGGGAGTGGGAAGGGGTGG - Intronic
1084781693 11:71413960-71413982 GTGCCTGCAGAGGGAGTGGGAGG + Intergenic
1085297542 11:75439528-75439550 GTGCTCGCAGTGGGGAGGTGTGG - Intronic
1085831070 11:79901621-79901643 GAGCTTGCAGTGAGCAGGGGAGG - Intergenic
1085977241 11:81672777-81672799 GGGGTTGCAGTGGGGAGGTGGGG + Intergenic
1086793242 11:91067786-91067808 GTGGTTTCTGTGGGTAGGGGTGG - Intergenic
1086947145 11:92854282-92854304 GAGCTTGCAGGGGAAAGGGGTGG + Intronic
1087079098 11:94152612-94152634 GTGCTACTGGTGGGAAGGGGAGG + Intronic
1087136236 11:94723171-94723193 GTGCTAACAGTGGGAACGGAAGG + Intronic
1087926791 11:103928305-103928327 GGGCGTGCATTGGGAAAGGGTGG - Intronic
1089020997 11:115214777-115214799 AGGCCTGCAGGGGGAAGGGGAGG + Exonic
1089689283 11:120176946-120176968 GGGCTTTCTGTGGGAAGGGATGG - Intronic
1089798189 11:121000275-121000297 TTGCTTGCGGTGGGATGGGATGG - Intergenic
1089962564 11:122628848-122628870 GTGGCTGCTGTTGGAAGGGGAGG + Intergenic
1090164527 11:124533566-124533588 CAGCTGGCAGTGGGAAGTGGAGG - Intergenic
1090180649 11:124696227-124696249 GTGCTTTCAGTGGAATGGGAGGG - Exonic
1090647668 11:128778727-128778749 GTGCTGGCATCGGGAAGGTGGGG + Intronic
1090713853 11:129412654-129412676 GTCATTGCTGTGGAAAGGGGTGG + Intronic
1091061608 11:132468269-132468291 TTGCCTGCAGAGGGAAGGAGAGG - Intronic
1091908071 12:4205519-4205541 GTGGTTGCTGTGGGAGAGGGTGG + Intergenic
1092085165 12:5751102-5751124 GAGGTTGCACGGGGAAGGGGAGG + Intronic
1092547915 12:9467642-9467664 TTACTTGCTGAGGGAAGGGGAGG + Intergenic
1095459252 12:42425162-42425184 TTGCTTGAACTGGGAGGGGGAGG - Intronic
1095908759 12:47404775-47404797 GTGATGGCAGTGGAATGGGGAGG - Intergenic
1095981594 12:47977560-47977582 GTGTGTGCAGTGGGTTGGGGAGG - Intronic
1096133180 12:49177041-49177063 GTGCTGGCTGTTGGATGGGGCGG + Intergenic
1096257727 12:50073318-50073340 TTGATGGCAGTGGGAAAGGGAGG - Intronic
1097181654 12:57175206-57175228 GTGCTCCCTGTGGGAAGGGGAGG + Intronic
1097248016 12:57617255-57617277 GTCTTGGCAGAGGGAAGGGGAGG + Intronic
1098246098 12:68519443-68519465 CTGCATGCAGTGGGAAAGAGTGG - Intergenic
1100137680 12:91573722-91573744 GTGCTTGCAGAGGTTAGGGTGGG + Intergenic
1101007446 12:100414968-100414990 TTGCTTCCAGTAGGAAGCGGAGG + Intronic
1101036689 12:100714873-100714895 TGGTCTGCAGTGGGAAGGGGTGG - Intergenic
1101333534 12:103776784-103776806 GTGCTTGGATTGGCCAGGGGAGG - Exonic
1101963100 12:109264728-109264750 GTCCTTGCAATGGTGAGGGGTGG - Intronic
1102072696 12:110035027-110035049 GTGGTGGCAGGGGGAAGTGGAGG - Intronic
1102235113 12:111289610-111289632 GTGCTTGCGGTGTAAAGGGCTGG + Intronic
1102455315 12:113067207-113067229 CTGCTTGCAGTTGGAGGGGGAGG - Intronic
1102657950 12:114499085-114499107 GGGATTGCAGTGGGGTGGGGAGG + Intergenic
1102683042 12:114703380-114703402 GAGCCTGCAGGGGGCAGGGGAGG - Intergenic
1103372985 12:120433561-120433583 TTCCTTGCAGTGGGAGGGGGCGG - Intergenic
1103397514 12:120619378-120619400 GGGTTTGCAGGAGGAAGGGGAGG + Intergenic
1103807026 12:123581721-123581743 CTGCTTGAACTGGGAAGTGGAGG + Intergenic
1104903717 12:132202716-132202738 GTGCCTGCAGTGGCCAGGGAAGG + Intronic
1104973743 12:132542858-132542880 ACACTTGCACTGGGAAGGGGAGG + Intronic
1104980571 12:132571539-132571561 GTGCTGGCAGGGGGCGGGGGCGG + Intronic
1106095510 13:26639863-26639885 GTGGTTTCTGTGGGAAGGAGTGG + Intronic
1106112827 13:26792070-26792092 GCTCTTCCAATGGGAAGGGGTGG - Intergenic
1106692964 13:32138751-32138773 GTGCTGAAAGTGGGAAGGAGTGG + Intronic
1107428787 13:40319866-40319888 GTGCTGGGAATGGGGAGGGGTGG + Intergenic
1107557334 13:41528304-41528326 GTGTTGACAGTGGCAAGGGGTGG - Intergenic
1108682381 13:52790932-52790954 GAGCTCACAGTGGGGAGGGGAGG - Intergenic
1109692292 13:65909541-65909563 GGTCTTTCAGTGGGAAGGGCAGG + Intergenic
1109771447 13:66979704-66979726 GTGTTTGGAGTTGTAAGGGGGGG - Intronic
1110232304 13:73179545-73179567 GTACTTGCAGAGGGTGGGGGTGG + Intergenic
1114278528 14:21169417-21169439 GAGCTCCCAGTGGGAAGGGTGGG + Intergenic
1116425669 14:44787562-44787584 GAGCTTACAGTTTGAAGGGGAGG + Intergenic
1117732656 14:58739388-58739410 GAGCTTGCAGTGGGAAGAGTGGG + Intergenic
1118053559 14:62055430-62055452 GTCCTTGCAGTGAGAAAGGAGGG + Intronic
1118772194 14:68949477-68949499 GCGCTGGCAGGGGGAAGGGGTGG + Intronic
1118864628 14:69693270-69693292 GTGGTAACAGTGGGAGGGGGAGG + Intronic
1119516402 14:75251943-75251965 TTGCTTGAAGTGGGAGGTGGGGG + Intronic
1119867051 14:77982475-77982497 GTGCTGGCAGTGGGGTGGGATGG - Intergenic
1120319764 14:82944391-82944413 GAGCTTGCAGTGAGCAGGGATGG + Intergenic
1121245049 14:92456151-92456173 GAGCTGGCAGTAGGAAGGGGTGG + Intronic
1122261582 14:100526337-100526359 GTGGTGGCAGTGGGAGGGTGGGG - Intronic
1122354835 14:101116627-101116649 GTGCTTGGAGTGGGAAGGGAGGG - Intergenic
1125299936 15:38244677-38244699 GATGTTGCAGTGGGAAGAGGAGG + Intergenic
1126473585 15:49042941-49042963 CTGCTTGAACTGGGAAGGCGAGG + Intronic
1128146035 15:65333062-65333084 ATGCTTGCGTTGGGAATGGGTGG - Intronic
1129666853 15:77584217-77584239 GTGCTTGCAGGGAGAAGCCGTGG - Intergenic
1129940726 15:79494732-79494754 CTGATTGCAGTGAGCAGGGGTGG + Intergenic
1129974095 15:79806867-79806889 CTGGTTGCATTGGGAGGGGGAGG + Intergenic
1130857055 15:87849388-87849410 GTGGGGGCAGTGGGAAGAGGCGG + Intergenic
1130969069 15:88718267-88718289 GTGCCTGGGGTGGGATGGGGTGG + Intergenic
1131239266 15:90724573-90724595 GTGCTTGTAGTCTGAAGTGGGGG - Intronic
1131285861 15:91056661-91056683 GTGTTTGCCATGGGAAGGAGGGG + Intergenic
1131681950 15:94732738-94732760 GAGCTTGCAGTGGGAGGGAGGGG + Intergenic
1132314856 15:100881988-100882010 GTGCCTGCCGAGGGAAGGAGCGG + Intronic
1132337674 15:101058861-101058883 GTGCTTGCCGTGGGGTGGGTGGG + Intronic
1132386976 15:101407670-101407692 GTGGTTTCTGTGGGAAGGAGTGG - Intronic
1132693192 16:1190759-1190781 GTGGGTGCTGGGGGAAGGGGAGG + Intronic
1132901934 16:2261063-2261085 GAGCTTGCAGTGGGCCGAGGTGG + Intronic
1134067890 16:11240954-11240976 GGGTTCTCAGTGGGAAGGGGAGG + Intergenic
1134517559 16:14899311-14899333 GTGCGACCAGTGGGAAGTGGTGG + Intronic
1134705227 16:16297962-16297984 GTGCGACCAGTGGGAAGTGGTGG + Intergenic
1134962314 16:18414152-18414174 GTGCGACCAGTGGGAAGTGGTGG - Intergenic
1134966611 16:18496751-18496773 GTGCGACCAGTGGGAAGTGGTGG - Intronic
1135934299 16:26766504-26766526 TTGCTTGAACTGGGAGGGGGAGG + Intergenic
1136371713 16:29840853-29840875 TTGCTTGAACTGGGAAGCGGAGG + Intronic
1137781030 16:51098036-51098058 GTGTTGGCAGTGAGCAGGGGAGG + Intergenic
1139655490 16:68384742-68384764 GTGCTTGCGGGGGGAGTGGGGGG - Intronic
1140040128 16:71402027-71402049 ATGCCTGCAGTGGGAGAGGGAGG + Intergenic
1140430654 16:74899954-74899976 GTGTTTGGAGTGTGATGGGGTGG - Intronic
1140494892 16:75376829-75376851 GTCATTGCTCTGGGAAGGGGCGG - Intronic
1141310277 16:82907255-82907277 ATGTTTGCAGGAGGAAGGGGTGG + Intronic
1141550133 16:84801364-84801386 GTGCTTGCAGGTGGGTGGGGAGG + Intergenic
1141631802 16:85291817-85291839 GTGCTGGCGGGGGGATGGGGAGG - Intergenic
1141697419 16:85626613-85626635 GGGCTGTCAGGGGGAAGGGGCGG + Intronic
1141771267 16:86090942-86090964 AGGCTTGGAGTGGGAAGGGGTGG + Intergenic
1141841767 16:86578215-86578237 GTGCTTACAGCGTCAAGGGGTGG + Intronic
1142605470 17:1078782-1078804 GTGCTCGCTGTGGGAGGTGGCGG - Intronic
1142880425 17:2879067-2879089 GTGCATGCAGTGGGTAGGGCAGG - Intronic
1143878896 17:10014613-10014635 GTCTTTGCAGGGGGAGGGGGCGG - Intronic
1144341014 17:14310324-14310346 GTGCCTGCTCTGGGTAGGGGCGG - Intronic
1144343564 17:14331032-14331054 GTGCTGCCAATGGGCAGGGGCGG - Intronic
1144413574 17:15024209-15024231 ATGATTGCCGTGGAAAGGGGCGG + Intergenic
1144607104 17:16676444-16676466 GAGCTTGCAGTGGGCAGAGATGG + Intergenic
1146399937 17:32494381-32494403 GACCCTGCAGAGGGAAGGGGTGG - Exonic
1146523481 17:33545884-33545906 GTGCCTGGAGTGGGAAATGGTGG - Intronic
1146709061 17:35025050-35025072 GAGCTTGCAGTTGGACAGGGAGG - Intronic
1147746591 17:42698749-42698771 GGGCCTGAAGTGGGTAGGGGAGG - Exonic
1148145618 17:45362769-45362791 GTCCTTGCAGAGGGGAGGGAAGG + Intergenic
1148208898 17:45796384-45796406 GAGCTGGCAGTGGGAACGAGGGG - Intronic
1148336088 17:46842111-46842133 GAGCATAGAGTGGGAAGGGGCGG - Intronic
1148668653 17:49393702-49393724 GTCATTGCCATGGGAAGGGGCGG - Intronic
1148674793 17:49438935-49438957 GTGAGTGCAGGGGGACGGGGAGG + Intronic
1148861292 17:50605666-50605688 GGGCGGGCAGTGGGAAAGGGTGG - Intronic
1149443251 17:56692732-56692754 GTCCCTCCAGTGGGAAGGGGTGG - Intergenic
1149886881 17:60348824-60348846 ATGCTTGTGGTAGGAAGGGGGGG + Intronic
1150212331 17:63447946-63447968 CTGCTTCAAGTGGGGAGGGGTGG + Intergenic
1150532138 17:65995153-65995175 GTTCTTGGAGTGGGGTGGGGTGG + Intronic
1150533051 17:66006217-66006239 GTGCGGGGAGTGGGGAGGGGTGG - Intronic
1150819975 17:68427065-68427087 GAGCGTGCAGGGAGAAGGGGAGG + Intronic
1150864930 17:68839774-68839796 ATGCTTTCAGTGAGAAGGGGTGG + Intergenic
1151464772 17:74277468-74277490 GGGCTAGGAGTGGGATGGGGTGG + Intronic
1152068882 17:78125564-78125586 GTCCCTGCAGAGGGACGGGGGGG + Intronic
1152070637 17:78132161-78132183 GTGCCTGCGGGCGGAAGGGGTGG - Intronic
1152175371 17:78783281-78783303 GTGACTGCAGGGGGAAAGGGGGG - Intergenic
1152416577 17:80166648-80166670 GTGCGTGCAGTGGGCTGGGTGGG - Intergenic
1152944644 17:83192269-83192291 GTTCTTAGAGTGGGCAGGGGTGG - Intergenic
1153785274 18:8528800-8528822 GTGCTTCCAGAGGGAGGGGTGGG + Intergenic
1154181410 18:12142753-12142775 GGGCTTCCAGTGGGAGGGGCAGG - Intergenic
1154182494 18:12148831-12148853 GGGCTTCCAGTGGGAGGGGCAGG + Intergenic
1155088173 18:22477533-22477555 TTGGTTGTAGTAGGAAGGGGTGG - Intergenic
1155313926 18:24552409-24552431 GAGGGTGCAGTAGGAAGGGGAGG + Intergenic
1155373008 18:25123609-25123631 TTCCTTGCAGAGGGAAGGGAGGG + Intronic
1155577056 18:27259529-27259551 GAGCTTGCAGAGGGAGGGGCAGG - Intergenic
1156325094 18:36067597-36067619 GGGCTTGCAGCGGGAGGGGCGGG - Intergenic
1156469233 18:37367145-37367167 GTGTTTGCAGGAGGAAGAGGAGG + Intronic
1156861717 18:41844337-41844359 GGGCTAGCAGTGGGCATGGGTGG - Intergenic
1158500362 18:57995482-57995504 GTGATGGTAGTGGGAAGGGCAGG + Intergenic
1159152225 18:64535169-64535191 GTGCTTGCAGTGTGAGAGGCAGG - Intergenic
1160310815 18:77788455-77788477 GTGCTCCCAGTGGGCAGGAGGGG + Intergenic
1160364418 18:78312331-78312353 GTGTTTGCCGTGGAAATGGGGGG + Intergenic
1160462726 18:79051493-79051515 TTGCTTGAACTGGGAAGTGGAGG + Intergenic
1160660101 19:293956-293978 GTGCAGGCAGTGGGCAGGGAAGG + Intergenic
1161455378 19:4367181-4367203 GGGCCTGCAGGGGGAGGGGGAGG + Intronic
1161537537 19:4829403-4829425 GAGGTGGCAGTGGGCAGGGGAGG - Intronic
1162095312 19:8306618-8306640 GGGCTGGCAGTGGGGAGTGGGGG - Intronic
1162751711 19:12833726-12833748 GCGCTGGCGGGGGGAAGGGGCGG - Intronic
1163334749 19:16663591-16663613 GAGCTTGCAGTGAGCAGAGGCGG - Intronic
1163363941 19:16865711-16865733 CTCCCTGCAGTGGGGAGGGGAGG - Intronic
1163564407 19:18041673-18041695 GTCCCAGCAGTGGGGAGGGGAGG + Intergenic
1163596934 19:18225891-18225913 GTCCTGGCAGTGGGAGGAGGGGG - Intronic
1164534729 19:29076593-29076615 CTGCTTGCAGTTGGCAGAGGTGG - Intergenic
1165404326 19:35620360-35620382 CTGCTGGTAGTGGGAATGGGCGG - Intronic
1165429452 19:35764187-35764209 GTGACTCCAGTGGGAAGTGGGGG + Intronic
1165521390 19:36316979-36317001 AGAGTTGCAGTGGGAAGGGGTGG - Intergenic
1165622089 19:37256750-37256772 AAGCTTGCAGTGGGCCGGGGAGG - Intergenic
1165633701 19:37322968-37322990 AAGCTTGCAGTGGGTGGGGGAGG - Intronic
1166417640 19:42607936-42607958 GTGCTTGCAGTGGCTGGGAGGGG - Intronic
1167586499 19:50378440-50378462 GTGAGTGCAGCGGGAGGGGGCGG + Intronic
1167634856 19:50648691-50648713 GTGCCTCCAGAGGGAGGGGGAGG - Intronic
1167975899 19:53225791-53225813 GTCATTGCGGTGGAAAGGGGTGG - Intergenic
1168336373 19:55599685-55599707 GTGAGGGCAGCGGGAAGGGGCGG + Intronic
1168513118 19:56988957-56988979 TTGCTTGAACTGGGAAGCGGAGG + Intergenic
925193764 2:1907308-1907330 GTGCGGGGAGTGGGAGGGGGCGG + Intronic
925341578 2:3141679-3141701 GTGTTTGAAGTGGGAAGGGAGGG - Intergenic
925995040 2:9285347-9285369 GTGTTTGAAGTGGGGATGGGGGG - Intronic
926119408 2:10234145-10234167 GGGGTTTCAGTGGGAAGTGGAGG + Intergenic
927089027 2:19696412-19696434 GTGGTGGCAGTGGGGAGGGAAGG + Intergenic
927993502 2:27465290-27465312 TTGCTGGCAGTGGGAAGGGAGGG + Intronic
928720477 2:34115133-34115155 CTTATTGCAGAGGGAAGGGGAGG + Intergenic
929548593 2:42874783-42874805 GTGCTCTCAGGGGGAAGGGAGGG + Intergenic
931001998 2:57794925-57794947 GTCCTTGCAGAGGGAGGAGGTGG + Intergenic
931029428 2:58155642-58155664 GTGCTTGATGGGGGAAGGGTAGG + Intronic
932217564 2:69976697-69976719 GTGCCTGGAGGGGGAAAGGGAGG - Intergenic
932276719 2:70457223-70457245 CTGATTCCAGTGGGCAGGGGAGG + Intronic
932277174 2:70460266-70460288 CTGATTCCAGTGGGCAGGGGAGG + Intronic
932283426 2:70513767-70513789 GAGGTTCCAGTGGGAGGGGGCGG - Intronic
933276371 2:80288672-80288694 GTGCTTGGACTAGGAAGGGAGGG + Intronic
933707962 2:85305438-85305460 GTGCAGGCTGTGGGGAGGGGTGG + Intronic
933771764 2:85749145-85749167 GTGCTAGCACTGTGAATGGGAGG + Intergenic
935303898 2:101718546-101718568 GGGCTGACAGTGGGAAGGTGGGG + Intronic
935342275 2:102068782-102068804 GGGTTGGCAGTGGGTAGGGGAGG - Intronic
935958176 2:108399256-108399278 TGGCTTTCAGTGGGATGGGGAGG - Intergenic
936659611 2:114528152-114528174 GTGCTTGCAGTGTGTATGGGAGG - Intronic
937347629 2:121136391-121136413 GTGGTTGCCATGGAAAGGGGCGG + Intergenic
937351020 2:121161955-121161977 GTGGTTGCTGTGGGAGGGGAGGG - Intergenic
938730276 2:134141950-134141972 CTGCTTGCAGTGTGAAAAGGAGG + Intronic
938937430 2:136139340-136139362 CTGCTTCCAGTGAGAAGAGGAGG - Intergenic
942287687 2:174437264-174437286 GTGCTTGACGTGGGAAATGGTGG + Intronic
943521013 2:188949394-188949416 GAGCTGGAAGTGGGAAGGTGGGG - Intergenic
943612051 2:190045352-190045374 GTGCTTCCAGAGGGAGGGGTAGG - Intronic
943820465 2:192314929-192314951 GAGCTTGCAAGGGCAAGGGGGGG + Intergenic
944140551 2:196451347-196451369 TTGCTTGAACTGGGAAGCGGAGG + Intronic
945321183 2:208425406-208425428 GTCATTGCTGTGGAAAGGGGTGG - Intronic
945641545 2:212437574-212437596 GAGCTTTTAGTGGGAAGGGGAGG - Intronic
946093697 2:217253176-217253198 CTGCTGGAAGTGAGAAGGGGTGG + Intergenic
948144372 2:235697419-235697441 GGGATTGCAGGGGGAAGTGGGGG - Intronic
948164767 2:235852385-235852407 GGGCTTGGGGTGGAAAGGGGGGG + Intronic
948326792 2:237128323-237128345 GGGCATGCAGGGGAAAGGGGTGG - Intergenic
948621263 2:239236233-239236255 GAGCTTGCAGTGGGCGGGGCTGG - Intronic
948623736 2:239253635-239253657 GTTCTTACAGTGGGAAGCGAGGG - Intronic
948655433 2:239473915-239473937 GTGGTGGCAGTGAGAAGGAGAGG + Intergenic
948716469 2:239867840-239867862 GTGCTTGTGGTGTGTAGGGGTGG - Intergenic
948914167 2:241022612-241022634 GTGTTTGCAGTGGTGTGGGGTGG - Intronic
1168807839 20:683122-683144 GCCCTGGCAGGGGGAAGGGGAGG - Intergenic
1168893248 20:1307686-1307708 CTGCATGCACTGGGAGGGGGCGG + Exonic
1169271050 20:4199677-4199699 GTGGTTGCCATGGAAAGGGGTGG + Intergenic
1169275933 20:4233781-4233803 AGGCTTGCAGTGGGGTGGGGGGG + Intronic
1171292469 20:23990171-23990193 GTCCTGGGAGTGGGAAGAGGTGG - Intergenic
1171313935 20:24169515-24169537 GTGGTTGCCATGGAAAGGGGTGG - Intergenic
1171410422 20:24943413-24943435 GTGTAGGCAGTGGGAAGGAGAGG - Intergenic
1172102175 20:32491584-32491606 GTGCTGGCAGTGGGCAGGAAGGG - Intronic
1172975427 20:38902649-38902671 ATGCCTGCAGTGGGAAAGAGGGG - Exonic
1173401167 20:42727202-42727224 TTGCTTGCATTGGAACGGGGGGG - Intronic
1173863932 20:46302266-46302288 GTCTTTGCAGTGGGGTGGGGGGG + Intronic
1173869591 20:46332941-46332963 GTGCTGGAAGAGGGGAGGGGAGG + Intergenic
1174186372 20:48709024-48709046 GAGCTGGCAGTGGGAAACGGTGG - Intronic
1174566771 20:51470205-51470227 CTACATGGAGTGGGAAGGGGTGG + Intronic
1174574562 20:51527279-51527301 GGCCTGGCAGTGGGTAGGGGAGG - Intronic
1175013539 20:55764418-55764440 GTGCTTGCTGATGCAAGGGGTGG + Intergenic
1175360418 20:58405836-58405858 TTGCTTGAACTGGGAGGGGGAGG - Intronic
1175618052 20:60420273-60420295 GTGTTTTCAGGGGGAAGGGAGGG + Intergenic
1175618709 20:60424874-60424896 ATGGTGGCAGTGGCAAGGGGAGG + Intergenic
1175797338 20:61780143-61780165 GAGCTTGCTGTGCCAAGGGGTGG - Intronic
1175840322 20:62022438-62022460 TTCCCTGCAGTGGAAAGGGGTGG + Intronic
1176299809 21:5094323-5094345 GTCGTGGCAGCGGGAAGGGGAGG + Intergenic
1177347457 21:19891773-19891795 GTGCTTGCTGCGGGGAGCGGTGG + Intergenic
1177899822 21:26901094-26901116 GTGTTTGCGGTGGGAAGGGCAGG + Intergenic
1178309603 21:31518711-31518733 ATGCTTACACTGGGAAGGTGGGG + Intronic
1178753058 21:35322642-35322664 GTGTTTGGAGTGGGATGGGTTGG - Intronic
1179574544 21:42299632-42299654 GTTGTTGCAGTGGGAAGAGAAGG + Intergenic
1179584670 21:42366937-42366959 GACCTTGCAGGGGGAAGGGAAGG + Intergenic
1179600789 21:42476145-42476167 GTGCTGCCAGTGGGAGGGGGAGG - Intronic
1179660037 21:42868506-42868528 CTGCCTGCAGAGGGTAGGGGAGG - Intronic
1179715839 21:43287794-43287816 GTGGGTGCACTGGGAAGGGAAGG - Intergenic
1179857213 21:44167588-44167610 GTCGTGGCAGCGGGAAGGGGAGG - Intergenic
1179995329 21:44971446-44971468 GTCCCCGCAGTGGGGAGGGGAGG + Intronic
1181123964 22:20691031-20691053 GTCCTGGGAGTGGGAAGAGGTGG - Intergenic
1181980337 22:26761561-26761583 GGCCATGCAGTGGGAAGTGGTGG + Intergenic
1182281625 22:29220723-29220745 GTCCTTGCAGTGGGACGAGGGGG - Intronic
1182344829 22:29655044-29655066 CTGTTTGCAGTGGCGAGGGGCGG + Intronic
1183392282 22:37552411-37552433 GTGGCTGCAGTTGGAGGGGGCGG - Intergenic
1183469054 22:37996207-37996229 CTGCCTGCTGGGGGAAGGGGTGG - Intronic
1183588799 22:38768196-38768218 GAGCTCGGAGTGGGAAGAGGAGG + Intronic
1184068010 22:42131087-42131109 GAGCTTGGAGTGGGGAGAGGGGG - Intergenic
1184070743 22:42144760-42144782 GAGCTTGGAGTGGGGAGAGGGGG - Intergenic
1184616022 22:45639370-45639392 GCACTTGCAGTGCCAAGGGGAGG - Intergenic
1184632486 22:45794071-45794093 GTTGTTGCTGTGGAAAGGGGCGG + Intronic
1185067990 22:48641560-48641582 GGGCGTGCAGGGGGAAGGGGAGG - Intronic
1185329208 22:50244650-50244672 GTGCTTGGACTGGGGAGGGCAGG - Intronic
1185414279 22:50701191-50701213 GTGCCTGCTGTGGGATCGGGAGG + Intergenic
949573837 3:5319652-5319674 GTGGTTTCTGTGGGAAGGAGAGG + Intergenic
950406643 3:12809107-12809129 GGACTTGGAGTGGGCAGGGGAGG + Intronic
950802689 3:15567292-15567314 TTGCTTGAACTGGGAAGTGGAGG - Intronic
951485117 3:23202680-23202702 GTGCAGGCAGTGGGACGAGGAGG - Intergenic
951592034 3:24276779-24276801 CTGCTGGGAGTGGGTAGGGGAGG + Intronic
951992552 3:28691848-28691870 CTGCCTGCAGTGGGGAGGCGGGG + Intergenic
953691853 3:45126386-45126408 GTGCCTGCTGTGGGAGGGGTGGG + Intronic
953865346 3:46578622-46578644 TTGCTTGAACTGGGGAGGGGAGG + Intronic
954314709 3:49794890-49794912 GTGCTTGCAGTGGGAAGGGGTGG - Intronic
954639403 3:52089103-52089125 GTGTTTGCAGGGGGACTGGGTGG - Intronic
954938452 3:54348810-54348832 GTGCTTGAACTGGGAGGTGGAGG - Intronic
955045453 3:55355171-55355193 GTGGTTGCTGGGGGTAGGGGAGG - Intergenic
955219626 3:57012861-57012883 CTGCTTGCAGAGGGATGTGGAGG + Intronic
955270479 3:57492938-57492960 GAGCTTGCAGTGAGTAGGGATGG + Intronic
956435894 3:69234159-69234181 TTGCTTGCACTGGGAGGTGGAGG + Intronic
957117134 3:76040903-76040925 TTGCTTGAACTGGGAGGGGGAGG + Intronic
957837527 3:85617187-85617209 GTGAGTGCTGTCGGAAGGGGTGG - Intronic
958017719 3:87961178-87961200 GTGCTTGTAGTGGGGAAGGGTGG - Intergenic
958678522 3:97296159-97296181 GTGTTTGCAGTGGGCTGGGTGGG + Intronic
959893313 3:111580667-111580689 GAGGATGCAGAGGGAAGGGGAGG - Intronic
960701148 3:120440569-120440591 GAGCTTGCAGTCCGGAGGGGAGG - Intronic
961041955 3:123683877-123683899 CAGCTTGCAGTGGGGAGTGGAGG - Intronic
961438515 3:126936269-126936291 GCCCTTGCAGAGCGAAGGGGAGG + Intronic
961439246 3:126942798-126942820 GTGCTCTCAGTGGGAAGAGCTGG + Intronic
961495470 3:127288094-127288116 GTGATGGGAGTGGTAAGGGGCGG + Intergenic
961705829 3:128784476-128784498 CTGCCTGCAGTGGGGAGGGTAGG - Intronic
961706514 3:128790885-128790907 GTTTTTGAGGTGGGAAGGGGAGG - Intronic
961789614 3:129366235-129366257 GTGCCTGAATTGGGAACGGGAGG + Intergenic
962357908 3:134710578-134710600 GTGCCTGGGGTGGGAAGGAGGGG - Intronic
963056977 3:141193882-141193904 GAGCTTTCAGAGGGAAGGGTGGG + Intergenic
963075791 3:141345222-141345244 GTGGTTTCTGTGGGAAAGGGAGG + Intronic
963745814 3:149124405-149124427 GTCCCTGCAGGGGGAAGGAGTGG - Intergenic
965309675 3:167113602-167113624 CTGCTTCCAGTGGGAAAGGAAGG - Intergenic
965367044 3:167813879-167813901 GTGGCTGCAGTGGGGAGGGCAGG - Intronic
965473897 3:169130474-169130496 GTATTTGCAGGGGGAGGGGGAGG - Intronic
967232820 3:187356721-187356743 GTGCTAGCAGAGGGAATGGAAGG + Intergenic
967768935 3:193312897-193312919 TTGCTTGCACTGGGAATGTGGGG + Intronic
968600134 4:1504788-1504810 GTGGTTGCCATGGAAAGGGGCGG + Intergenic
968652815 4:1766895-1766917 CTGTTTGCCGGGGGAAGGGGGGG + Intergenic
968894580 4:3391570-3391592 TCCCTTGGAGTGGGAAGGGGTGG - Intronic
971038819 4:22727189-22727211 GTACTGGGAGGGGGAAGGGGGGG + Intergenic
971909034 4:32770131-32770153 TTGCTTGAACTGGGAAGTGGAGG + Intergenic
973789395 4:54364448-54364470 GTGATGGGAGTGGGAATGGGTGG - Intergenic
974109696 4:57511718-57511740 GAGCTCCCAGTGGGAAGGGAGGG - Intergenic
974284872 4:59851411-59851433 CTGGTTGCAGTGTGAAGGTGGGG + Intergenic
974787133 4:66633079-66633101 GTGGTAGCAAGGGGAAGGGGAGG + Intergenic
975299618 4:72774819-72774841 GAGCCTGTAGGGGGAAGGGGGGG - Intergenic
975696530 4:77019362-77019384 GGGCTGGCAGTGGGAGGGAGTGG + Intronic
975804027 4:78093970-78093992 TTGGTGGAAGTGGGAAGGGGAGG - Intronic
976474940 4:85473298-85473320 GTGCTATCAGTTGGAAAGGGTGG + Intergenic
976729093 4:88244516-88244538 GTTCCTTCCGTGGGAAGGGGCGG + Intergenic
978600111 4:110418834-110418856 GGGCAAGCAGAGGGAAGGGGCGG + Intronic
981230073 4:142342443-142342465 GGGCTTGCAAAGGTAAGGGGAGG - Intronic
981654364 4:147096352-147096374 ATCCTTGCACTGGGGAGGGGTGG - Intergenic
981734356 4:147933896-147933918 CTGATTGCAGTGGGAGGGGCGGG + Intronic
981773232 4:148334456-148334478 ATGCTTGAACTGGGAAGTGGAGG + Intronic
982571602 4:157057422-157057444 GTCCTTGCTCTGGCAAGGGGAGG - Intergenic
984836646 4:184028683-184028705 GTGCTTGCAACAGGAAGGGCTGG - Intergenic
985708202 5:1413815-1413837 GTGCTTGCAGTGGAAAGCTGTGG - Intronic
985718363 5:1475607-1475629 ATCCTTGCAGCGGGCAGGGGAGG + Intronic
986174690 5:5341721-5341743 GTGGCTGCAGTGGGCAGTGGGGG + Intergenic
986233553 5:5887159-5887181 GTGCCAGGGGTGGGAAGGGGTGG + Intergenic
988751452 5:34192650-34192672 GTCCTGGGAGTGGGAAGAGGTGG - Intergenic
988917098 5:35905503-35905525 ATGTTTTTAGTGGGAAGGGGTGG - Intronic
990548571 5:56849263-56849285 TTGCTTGAATTGGGAAGTGGAGG + Intronic
992646081 5:78812335-78812357 GTATTTACAGTGGGGAGGGGAGG + Intronic
992700187 5:79334171-79334193 TGTCTTGCAGTGGGAAGGGAGGG - Intergenic
992842209 5:80707035-80707057 TTGCTTGGAGTGGGAGGTGGAGG - Intronic
993044351 5:82850608-82850630 CTGCATGGAGTTGGAAGGGGGGG - Intergenic
993105766 5:83598889-83598911 GTATTTTCAGAGGGAAGGGGAGG + Intergenic
993262232 5:85673729-85673751 GTGGTTTCTGTGGGAAGGGTAGG + Intergenic
993351317 5:86853526-86853548 GAGCTCCCAGAGGGAAGGGGAGG - Intergenic
993379320 5:87188001-87188023 ATGTTGGCAGTGGGAAGTGGAGG - Intergenic
994821241 5:104653173-104653195 GTGACAGCAGTGGGTAGGGGTGG - Intergenic
994881220 5:105498783-105498805 GTTCCTGCAGTGGGTAGGGAGGG + Intergenic
995154882 5:108898879-108898901 GTGCTGGGAGTGTGAAGGGAGGG - Intronic
995281845 5:110344663-110344685 TTGCTTGAACTGGGAAGTGGAGG + Intronic
996392557 5:122977335-122977357 GTGTATGTATTGGGAAGGGGTGG - Intronic
996890329 5:128411413-128411435 TGGCTTTCAGTGGGATGGGGAGG + Intronic
997715609 5:136040538-136040560 ATGGTGGCAGGGGGAAGGGGTGG - Intronic
998773594 5:145573490-145573512 GTGCGGGCAGAGGAAAGGGGAGG - Intronic
999007434 5:147997837-147997859 GTGATTTCAGTGGAAATGGGAGG + Intergenic
999231906 5:150066689-150066711 GGGCTTGAAGTGGGCAGGGTGGG - Intronic
999288936 5:150410945-150410967 GTGCATTTTGTGGGAAGGGGAGG - Intronic
999798675 5:155012012-155012034 GTGGTTGCTGGGGGAATGGGGGG - Intergenic
999890980 5:155978348-155978370 GTGGTTGGAGTGGGACAGGGTGG + Intronic
1000991220 5:167914052-167914074 GTGCCTTAAATGGGAAGGGGAGG + Intronic
1001421317 5:171589396-171589418 GTGCTTGCACAGGGAAGAGACGG + Intergenic
1001632925 5:173189932-173189954 GTGATTGCCGAGGGATGGGGTGG - Intergenic
1001823677 5:174729031-174729053 GTGCTTTCAGTTGAGAGGGGAGG + Intronic
1002267376 5:178044897-178044919 GTGCTTGCTGTGGCAAAGGCAGG - Intronic
1002393710 5:178937017-178937039 GTGGTAGCAGTGGCGAGGGGTGG - Intergenic
1002412797 5:179096624-179096646 CTGATTGCAGTGGGAGGGGCTGG + Intergenic
1005348583 6:24912764-24912786 GTGATGGGAGTGGGAAGGTGGGG - Intronic
1005374283 6:25166175-25166197 GTTCTTGCTGGGGGATGGGGAGG - Intergenic
1005471761 6:26167722-26167744 GTGCCTGAAGTGGGAGAGGGTGG - Intronic
1005942616 6:30571914-30571936 GCGCGCGCAGGGGGAAGGGGAGG - Intronic
1006154846 6:32008461-32008483 GTGTTTACAGGGGGGAGGGGAGG - Intergenic
1006161159 6:32041196-32041218 GTGTTTACAGGGGGGAGGGGAGG - Exonic
1006188448 6:32193057-32193079 ATGGTTCCAGTGGGAAGTGGAGG + Intronic
1006303856 6:33207739-33207761 GAGCTCCCATTGGGAAGGGGGGG - Intergenic
1006602491 6:35235345-35235367 GGGCTGGCAGTGGGGAGGAGAGG + Intronic
1006986740 6:38180463-38180485 GGGGTTACGGTGGGAAGGGGAGG - Intronic
1008518075 6:52337052-52337074 GTGCTGGAAGTGGGAAGGGGCGG - Intergenic
1008533144 6:52483592-52483614 GTCGTTGCTGTGGAAAGGGGTGG + Intronic
1010024401 6:71199042-71199064 ATCCTTGCTGTGGGAGGGGGTGG + Intergenic
1010804421 6:80218132-80218154 GTGTTTCCAGTGAGAAGTGGCGG - Intronic
1011559399 6:88599554-88599576 GTGGTTGCGGCGGGAAGGGGGGG + Intergenic
1012570733 6:100724634-100724656 ATGCTTGTGGTGGGAAGGGCTGG + Intronic
1013180573 6:107713769-107713791 GGGCTGGCAAGGGGAAGGGGAGG + Intronic
1013232505 6:108170143-108170165 GGGATTGAGGTGGGAAGGGGCGG - Intronic
1013707198 6:112850773-112850795 GTGTTTGCAGTGGGGAGAGATGG + Intergenic
1013961723 6:115908965-115908987 GTGCATCCAGTGGGGAGGAGGGG - Intergenic
1013978756 6:116105243-116105265 GTGAATGCAGAGGGAATGGGGGG - Intronic
1015376678 6:132517516-132517538 GTGCTTGGACTGGGCAGAGGTGG + Intergenic
1015727096 6:136310434-136310456 GTGCTTGAACTGGGAGGTGGAGG - Intergenic
1016548742 6:145253692-145253714 GTGGTTGCAGTTGGATGGTGGGG - Intergenic
1017449811 6:154544383-154544405 GTGCTTGGAGTGGGTAGGGCAGG - Intergenic
1018814887 6:167323200-167323222 GTGCCAACAGTGGGAAGCGGGGG + Intergenic
1019359113 7:595622-595644 GTGCTTGCTGTGGGCGGCGGGGG - Intronic
1020016085 7:4832967-4832989 GTGGGTGCAGGGGGAAGAGGTGG + Intronic
1020126025 7:5532888-5532910 GTGGGTGTAGTGGGAAGGAGTGG - Intronic
1020256975 7:6508014-6508036 GCGCTTGCGGTGGGAACAGGTGG - Exonic
1020357679 7:7295273-7295295 ATGCATGCAGTGGGAAGAGTAGG - Intergenic
1021409664 7:20315687-20315709 GTGTGTGCTGGGGGAAGGGGAGG + Intergenic
1021809588 7:24390473-24390495 GTTCTGGCAGGGGGAATGGGTGG - Intergenic
1023159780 7:37285866-37285888 CTGCTGGCAGTGGGAAGGGCTGG - Intronic
1023582743 7:41699960-41699982 GTGCTGGCATTGGCAGGGGGTGG - Intronic
1024986055 7:55194120-55194142 GTGCCTGGAGTGGGAGGGGCGGG - Intronic
1025164162 7:56695982-56696004 GGGCTTGCAGTGGAGATGGGTGG - Intergenic
1025190579 7:56892783-56892805 GTGCGTGCAGTGTGAATGGCAGG + Intergenic
1025211228 7:57020469-57020491 GTGGTGGCAGTGGGCAGGGCCGG - Intergenic
1025660725 7:63556378-63556400 GTGGTGGCAGTGGGCAGGGCCGG + Intergenic
1025681373 7:63684193-63684215 GTGCGTGCAGTGTGAATGGCAGG - Intergenic
1025706120 7:63866089-63866111 GGGCTTGCAGTGGAGATGGGTGG + Intergenic
1026934913 7:74248872-74248894 GCTCTTTCACTGGGAAGGGGTGG + Intronic
1027264142 7:76484662-76484684 GTGGCTGCGGTGGGCAGGGGTGG - Intronic
1027315511 7:76982776-76982798 GTGGCTGCGGTGGGCAGGGGTGG - Intergenic
1028174560 7:87639085-87639107 GAGCTTGCAGTGAGAAGAGACGG + Intronic
1029098629 7:98108945-98108967 CTGCTTGAACTCGGAAGGGGGGG - Intronic
1029606334 7:101601510-101601532 GTGCTGGCAGTGGAAATGGCTGG + Intergenic
1031983637 7:128147999-128148021 GTTTTTGCAGTGGGATGGGTGGG + Intergenic
1032198304 7:129802049-129802071 GTCATTGCCATGGGAAGGGGTGG + Intergenic
1032239916 7:130152869-130152891 GTGGTTGCAGTGTGAGGGTGTGG - Intergenic
1033041586 7:137924102-137924124 GGGCTTTCAGTGGCAAGGGATGG - Intronic
1034048797 7:147959685-147959707 GTCATTGCCATGGGAAGGGGTGG + Intronic
1034349231 7:150405561-150405583 GGGCTTGCAGTCGGGCGGGGTGG + Intronic
1034552175 7:151828086-151828108 GTGCTTGCTGGGTGAATGGGTGG - Intronic
1034575425 7:151992900-151992922 GTGCGTGGGGTGAGAAGGGGCGG - Intronic
1034857533 7:154565955-154565977 GTGCTTGCAGTGCAGAGGGCAGG + Intronic
1035582279 8:747719-747741 GTGTCTGCGGTGGGATGGGGGGG + Intergenic
1035703593 8:1656445-1656467 GTGTTGGCAGAGTGAAGGGGTGG - Intronic
1035901877 8:3465496-3465518 GTGCTGGCAGGGGGTAGTGGGGG + Intronic
1036085006 8:5604058-5604080 CAGCTTGCAGAGGGATGGGGAGG - Intergenic
1037470106 8:19200152-19200174 GTGCCTTGGGTGGGAAGGGGTGG - Intergenic
1037585135 8:20270837-20270859 GTGTGTGGAGAGGGAAGGGGTGG + Intronic
1037858506 8:22388540-22388562 GTGCTTTGGGTGGGGAGGGGCGG + Intronic
1038282810 8:26181185-26181207 ATTCTTGGAGTGGGAATGGGAGG + Intergenic
1038347554 8:26746216-26746238 GTGCTTGCTTTGGGAATTGGAGG + Intergenic
1038384750 8:27132525-27132547 GTGTTTGCAGGGGAATGGGGAGG - Intergenic
1039895390 8:41713348-41713370 CTGCCTGCTGTGGGAAGGCGAGG - Intronic
1039920154 8:41888080-41888102 GGGCTTGCAGTGGGAGGAGCTGG - Intronic
1040900326 8:52411181-52411203 ATGCCTGCAGTGGGGAGGGGAGG - Intronic
1042291141 8:67170370-67170392 TTGCTTGAACTGGGAAGTGGAGG + Intronic
1042306971 8:67343112-67343134 GTGCTTGTTGTGGGGCGGGGAGG - Intronic
1042325422 8:67522811-67522833 GTGGATGCAGTGGGCAGGCGTGG + Intronic
1043500471 8:80849383-80849405 GTGCTTGCCGTGAGGAGGGTGGG - Intronic
1043652163 8:82609978-82610000 GAGCTTGCAGTGAGCCGGGGTGG + Intergenic
1043768292 8:84164495-84164517 GTGCTTCCAGTGAGAAGTGTAGG - Intergenic
1044058725 8:87605707-87605729 GTGGTGGCAGGGGGAAGGTGGGG + Intronic
1044628962 8:94261026-94261048 AGGGTTGCAGTGGGCAGGGGAGG - Intronic
1044933568 8:97273025-97273047 GTACTTTGAGTGGAAAGGGGGGG - Intergenic
1046029761 8:108769241-108769263 TTGCTTGAACTGGGAAGCGGAGG + Intronic
1046826389 8:118696181-118696203 GTCTTTGCAGGGGGAAGGGAGGG + Intergenic
1046847939 8:118939528-118939550 CTGGTTGCATTGGGAGGGGGTGG + Intronic
1046899766 8:119511395-119511417 TTCTTTCCAGTGGGAAGGGGAGG + Intergenic
1047208042 8:122819191-122819213 GTGCCTGCAGTGGGAAGGCTGGG + Intronic
1047565057 8:126034981-126035003 GTGCTGGGAGTGGGTCGGGGGGG + Intergenic
1047936663 8:129787250-129787272 GTTCTTACAGTGGAAAGGGAAGG - Intergenic
1049059217 8:140263242-140263264 GTGATAGCAGTGGGCAGGGCGGG - Intronic
1049278246 8:141730703-141730725 GTGTTTGCACAGGGAAAGGGAGG - Intergenic
1049284474 8:141767155-141767177 GAGCTTTCAGCGGGGAGGGGAGG - Intergenic
1049386472 8:142345371-142345393 GTGCTTGCTGTGGTTTGGGGAGG - Intronic
1049441307 8:142610999-142611021 GTGCTTGGGCTGGGCAGGGGTGG - Intergenic
1049448206 8:142641335-142641357 CTGCCTGCAGAGGGCAGGGGAGG - Intergenic
1049688012 8:143946713-143946735 GGGCCTGCAGCGGGAAGGGGAGG - Intronic
1049714372 8:144082933-144082955 GTGCTTCCAGAGGGCAGGAGCGG - Intronic
1049763719 8:144343234-144343256 GTGCTTGCAGTGCTTAGGTGGGG - Intergenic
1049779368 8:144421454-144421476 GGGCTTGCAGTGAGCAGGGATGG + Intergenic
1049993657 9:1013963-1013985 GGGCTGGCAGTAGGAAGGAGAGG - Intergenic
1051262958 9:15283106-15283128 GTGGTTGCTGTGGGTAGGCGTGG - Intronic
1052139870 9:24967410-24967432 GGACTTGGAGTGGGAAGGGTGGG + Intergenic
1053125123 9:35574893-35574915 GTCATTGCTGTGGAAAGGGGTGG - Intergenic
1053812561 9:41868908-41868930 GAGCTTGCAGTGAGAAGAGATGG - Intergenic
1054618034 9:67318531-67318553 GAGCTTGCAGTGAGAAGAGATGG + Intergenic
1055229987 9:74051511-74051533 GTGGATGGAGTGGGAGGGGGTGG + Intergenic
1057545690 9:96019421-96019443 GTACTGGCAGTGGGAAGAGAGGG - Intergenic
1057753207 9:97809216-97809238 GTGATGGCAGTGTGAAGGGATGG + Intergenic
1058438449 9:104985881-104985903 GTGCTAGGAGTGGAAAAGGGTGG + Intergenic
1058772318 9:108247804-108247826 GTGTGTGCAGTGGGTTGGGGTGG - Intergenic
1058877509 9:109257365-109257387 GTGCCTGCAGGGGGAATGGAGGG + Intronic
1058878403 9:109265081-109265103 GGGTTTGCAGTGGGAAGCTGGGG - Intronic
1059329898 9:113528328-113528350 GTGGCTGCAGTGGGCAGGGCAGG + Intronic
1059379782 9:113914058-113914080 GTGCTTAGAGGGGGAAAGGGTGG - Intronic
1059567558 9:115398298-115398320 GTGGTTGGCATGGGAAGGGGTGG - Intronic
1060162969 9:121383499-121383521 GAGCTTGCAGTGGGCAGAGATGG + Intergenic
1060290443 9:122297660-122297682 CTGCTGGGAGTGGGAAGTGGTGG + Intronic
1061770470 9:132916289-132916311 GTGGTTGCAGTGGGGAGGGATGG - Intronic
1061887634 9:133600574-133600596 GGGTCTGCAGTGGGATGGGGTGG + Intergenic
1061969851 9:134039062-134039084 GTGCTTGGAGGGAGGAGGGGAGG - Intronic
1062332972 9:136052626-136052648 GCGCTGGGAGTGGGATGGGGAGG - Intronic
1062561177 9:137142750-137142772 ATGCCTGCAGTGGGAAAGGCTGG - Intronic
1185600644 X:1336690-1336712 GATCTGGCAGTGGGGAGGGGTGG - Exonic
1186356889 X:8799790-8799812 ATGTGTGCAGTGGGGAGGGGTGG - Intronic
1186357215 X:8800905-8800927 ATGTGTGCAGTGGGTAGGGGTGG - Intronic
1186434120 X:9528682-9528704 GAGCTTGCGGGGGGAGGGGGTGG + Intronic
1186596816 X:10990682-10990704 GGGCTTGAAGTGGGAGGGTGAGG - Intergenic
1187361162 X:18628761-18628783 GTGCTGGTAGGGGGGAGGGGTGG + Intronic
1190628647 X:52363465-52363487 GTGGTTGCCATGGAAAGGGGTGG - Intergenic
1191738949 X:64417112-64417134 GAGCTTGCAGAGGGAGGGGCAGG - Intergenic
1192100635 X:68260847-68260869 GTGCTTGCTCTGGGAAAGAGGGG - Intronic
1192244520 X:69361618-69361640 GAGTCTGCAGTGGGAAAGGGTGG - Intergenic
1193593562 X:83419508-83419530 GTGGTTGCTGAGGGCAGGGGAGG - Intergenic
1195534282 X:105993318-105993340 GTGAGTGCAGTGGTAAGGTGTGG + Intergenic
1196019785 X:110979361-110979383 GAGCTTGCAGTGGGCAGAGATGG - Intronic
1196752769 X:119132454-119132476 GTGCTTGCAGTGGGGTGTGCTGG - Intronic
1196900613 X:120379301-120379323 CTCCTTGCAGTGGGAAAGTGTGG - Intronic
1197294720 X:124704940-124704962 TTGCTTGTGGTGGGAATGGGGGG - Intronic
1197727851 X:129788195-129788217 GTGCTTGGTGTGGGGAGAGGTGG - Intronic
1198308174 X:135403018-135403040 CAGCCTGCAGTGGGAAAGGGTGG + Intergenic
1198732290 X:139745257-139745279 GTGCTTCCATTGGGAAGAGGAGG + Intronic
1199219892 X:145305909-145305931 TGGCTTTCAGTGGGAAGGGGAGG + Intergenic
1200235454 X:154465862-154465884 CTGTTGGCAGTGGGCAGGGGCGG - Intronic
1200760205 Y:7031198-7031220 GGGCTTGCTGTGGAAAGAGGAGG - Intronic