ID: 954315047

View in Genome Browser
Species Human (GRCh38)
Location 3:49796561-49796583
Sequence GGCGTTGTCACCTGAGTTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 78}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954315047_954315056 11 Left 954315047 3:49796561-49796583 CCCTGAACTCAGGTGACAACGCC 0: 1
1: 0
2: 0
3: 5
4: 78
Right 954315056 3:49796595-49796617 CCCAAAGTGCTAGGATTATGTGG 0: 2
1: 87
2: 924
3: 5296
4: 5167
954315047_954315059 29 Left 954315047 3:49796561-49796583 CCCTGAACTCAGGTGACAACGCC 0: 1
1: 0
2: 0
3: 5
4: 78
Right 954315059 3:49796613-49796635 TGTGGGTGAGCCACTGTGCCTGG 0: 1
1: 6
2: 173
3: 2681
4: 23870
954315047_954315053 2 Left 954315047 3:49796561-49796583 CCCTGAACTCAGGTGACAACGCC 0: 1
1: 0
2: 0
3: 5
4: 78
Right 954315053 3:49796586-49796608 CCTTGGCCTCCCAAAGTGCTAGG 0: 84285
1: 209100
2: 236161
3: 152470
4: 88713
954315047_954315058 12 Left 954315047 3:49796561-49796583 CCCTGAACTCAGGTGACAACGCC 0: 1
1: 0
2: 0
3: 5
4: 78
Right 954315058 3:49796596-49796618 CCAAAGTGCTAGGATTATGTGGG 0: 1
1: 11
2: 105
3: 858
4: 4187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954315047 Original CRISPR GGCGTTGTCACCTGAGTTCA GGG (reversed) Intronic
900933519 1:5751253-5751275 GGCTTTGCAACCTGAGCTCACGG + Intergenic
903846206 1:26281017-26281039 GGGGTGGTCACCTGAATGCAGGG - Intronic
904254027 1:29243297-29243319 GGTTTTGTCCCCTGAGTTCTGGG - Intronic
904736204 1:32636049-32636071 GGTGGTGTCAGCTGAGTGCAGGG - Intronic
904921823 1:34013984-34014006 GGCTTTGCCACCTCAGTTAAGGG + Intronic
905031597 1:34887595-34887617 GACTTTGTCACCTGTGTTCTGGG - Intronic
907451741 1:54549808-54549830 GCTCTTGTCACCTGAGTGCAGGG + Intronic
911968376 1:104397316-104397338 GGCTTTATCAACTAAGTTCATGG + Intergenic
920956718 1:210626355-210626377 GGCTGTGGCACCTGAGTCCAAGG - Intronic
1064022818 10:11823430-11823452 GGCGTGGACACCTGAGTCCCGGG + Exonic
1076611327 10:131727626-131727648 GGCATTGGCACCTGAGGTGACGG - Intergenic
1076615758 10:131753443-131753465 CACGTCGTCACCTGAGGTCACGG - Intergenic
1076669744 10:132113076-132113098 GCAGTTGTCACCTCAGTTCAGGG + Intronic
1082976439 11:59077084-59077106 GGCCTGGTCACTAGAGTTCAAGG + Intergenic
1087836904 11:102884642-102884664 GAAGTTGTCACCTAGGTTCAAGG - Intergenic
1088822022 11:113464516-113464538 GTTGATTTCACCTGAGTTCATGG - Intronic
1089891239 11:121883476-121883498 GGCGGTCCCACCTGAGTTCTAGG + Intergenic
1090447025 11:126773297-126773319 GGCTTTGTCCCATCAGTTCAGGG + Intronic
1096470631 12:51873480-51873502 GGCCTGGGCACATGAGTTCAAGG - Intergenic
1105013026 12:132768374-132768396 GGGGTGGTCACCTGAGGTCAGGG - Intergenic
1105589757 13:21781008-21781030 TGCTTTGTCACCTAAGTCCATGG - Intergenic
1113748406 13:112762079-112762101 GGCATTGTAACCTAAGGTCATGG + Intronic
1115929962 14:38479876-38479898 GCTTTTGTCACCTGAGTTCTTGG - Intergenic
1130844555 15:87732876-87732898 GCCCTTGTCACCTGACTTCTTGG - Intergenic
1131301254 15:91201629-91201651 GGCCTTTTCATCTCAGTTCATGG + Intronic
1139578464 16:67857387-67857409 GGGGCTGTCACCTGAGGTCTAGG - Intronic
1139787372 16:69404731-69404753 GAACTTGTCACCTGTGTTCACGG + Intronic
1146052066 17:29562230-29562252 GGCATTTTCTCCTGAGTCCATGG + Exonic
1146604674 17:34247924-34247946 GGATTGGTCGCCTGAGTTCAAGG - Intergenic
1151648810 17:75452739-75452761 GGGTGTATCACCTGAGTTCAGGG - Intronic
1162530312 19:11232145-11232167 GGTGGTGTCACATGAGTGCAGGG + Intronic
1162926204 19:13931665-13931687 GGCGTTGTCTCCTCAGTCCACGG + Intronic
1166522630 19:43491083-43491105 GGAGTTGTCACCTGACTTGTTGG - Intronic
1167061971 19:47154720-47154742 GGGCGTGTCACCTGAGGTCAAGG - Intronic
926055452 2:9771468-9771490 GGCGCTGTCACCTGGGTTTGAGG + Intergenic
935996665 2:108781069-108781091 GCCGAGGTCACCTGAGGTCAGGG - Intronic
942175501 2:173329793-173329815 GGCAGGATCACCTGAGTTCAAGG - Intergenic
1183722140 22:39568794-39568816 GGAGTTTTCTCCTGAGCTCAGGG - Intergenic
1184782036 22:46654392-46654414 GGTGTTGTCCCCTCTGTTCATGG + Intronic
1185199559 22:49493398-49493420 GGGCTTGTCACTTGAGATCAGGG + Intronic
949964367 3:9342783-9342805 GGAGTTGTAACCAAAGTTCAAGG - Intronic
954315047 3:49796561-49796583 GGCGTTGTCACCTGAGTTCAGGG - Intronic
954744426 3:52779036-52779058 GGCCTTGTCAGGTGAGTTCTGGG + Exonic
954870683 3:53765262-53765284 GGCCTTGTCCCCTGAGCTGAGGG + Intronic
956341960 3:68235086-68235108 TGCATTTTCACCTCAGTTCAAGG + Intronic
961091932 3:124120218-124120240 GGCTCTGACTCCTGAGTTCATGG + Intronic
968299003 3:197599273-197599295 GGAGTTGTCATCTGTGATCAGGG - Intergenic
968417754 4:454901-454923 GGCTTTTGCACCTGAGCTCAAGG - Intronic
968463339 4:736849-736871 GGCGGTGTCCCCTGAGCGCACGG + Intronic
981843953 4:149145286-149145308 TGCTTTCCCACCTGAGTTCATGG - Intergenic
983479340 4:168253995-168254017 AGCGTTCTCCCCTGAGTTAAAGG - Intronic
996330496 5:122323131-122323153 GGCGCTGTTGCCCGAGTTCATGG - Intronic
999495008 5:152088337-152088359 GTTCTTGTAACCTGAGTTCATGG - Intergenic
1002785794 6:398925-398947 GGCGTTCTCAGGTGAGTGCAGGG + Exonic
1003179880 6:3782440-3782462 GGCTTAGTCATCTGATTTCAGGG + Intergenic
1007112024 6:39318374-39318396 TGGAATGTCACCTGAGTTCAAGG + Intronic
1008602119 6:53106596-53106618 GGCGTGGCCTCCTGAGTTGAAGG + Intergenic
1012500626 6:99884304-99884326 GGTGTCGTCACCTGTGTCCAGGG - Intergenic
1017061173 6:150486435-150486457 AGCCTTCTCACCTGCGTTCAAGG + Intergenic
1017604723 6:156121833-156121855 GGCCTTGTCCCCTGACTTGAAGG - Intergenic
1018231031 6:161675547-161675569 GGTGTCGGCATCTGAGTTCACGG + Intronic
1021846389 7:24767095-24767117 GGGGTGATCACCTGAGGTCAGGG + Intergenic
1023969870 7:44982935-44982957 GGAGTTGTCAGCTAAGTCCAAGG - Intergenic
1024010084 7:45259689-45259711 GGCTTGGTCATCTGGGTTCATGG + Intergenic
1026868776 7:73838410-73838432 GGCCTTGTCACCTCAGGTCCAGG + Intronic
1030906506 7:115190037-115190059 GGCCTTTTTACCTGACTTCAAGG - Intergenic
1032301189 7:130688870-130688892 AGCTTTGTTACCTGAGTTAATGG + Intergenic
1034449465 7:151129552-151129574 GGCATTGTCCCCTGAGCTGAGGG - Intronic
1035376696 7:158411306-158411328 GGAGATGTCACCTCATTTCAAGG - Intronic
1035784571 8:2250598-2250620 TGCGCTCTCACCTGAGTTCAGGG - Intergenic
1035808236 8:2471115-2471137 TGCGCTCTCACCTGAGTTCAGGG + Intergenic
1041154849 8:54974742-54974764 GGCTTAGTCACCTGAAATCAAGG + Intergenic
1043170691 8:76962236-76962258 AAAGTTGTCACCTGAGTTTAGGG - Intergenic
1046488326 8:114915161-114915183 GGCTTTATCACCTAAATTCAAGG - Intergenic
1047521296 8:125597212-125597234 CTCCTTGTCACCTGAGTCCACGG + Intergenic
1048123873 8:131611511-131611533 TGAGTTCTCTCCTGAGTTCATGG - Intergenic
1052031501 9:23634713-23634735 GCCCTTGTCATCTGAGTTCTGGG + Intergenic
1055578285 9:77681640-77681662 GGCCGGGTCACCTGAGGTCAGGG + Intergenic
1056091874 9:83214165-83214187 GGGCTGATCACCTGAGTTCAAGG + Intergenic
1056460830 9:86808283-86808305 GGAGTTTTCACCAGATTTCAAGG + Intergenic
1060423095 9:123483415-123483437 GGATTTGTCTCCTGAGTTCCTGG - Intronic
1189554523 X:42128167-42128189 AGGGGTGACACCTGAGTTCAAGG + Intergenic
1192506055 X:71684591-71684613 GGAGCTGGAACCTGAGTTCATGG + Intergenic
1192520642 X:71796957-71796979 GGAGCTGGAACCTGAGTTCATGG - Intergenic