ID: 954317620

View in Genome Browser
Species Human (GRCh38)
Location 3:49809869-49809891
Sequence TGCCGGGCCCACTGTGGAGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 3, 3: 14, 4: 176}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954317620 Original CRISPR TGCCGGGCCCACTGTGGAGG AGG Exonic
900488057 1:2932904-2932926 CGCGGGGCCCAGGGTGGAGGCGG - Intergenic
902625370 1:17673315-17673337 TGCCGGGCTCAGAGGGGAGGGGG - Intronic
903967373 1:27099167-27099189 TGTGGAGCCCATTGTGGAGGCGG - Exonic
908924643 1:69239542-69239564 TGCCAAGCCCAGTGTTGAGGAGG + Intergenic
915562069 1:156693238-156693260 TGCCGGCCCCTTTGTGGCGGGGG - Intergenic
916098986 1:161377318-161377340 TACAGGGCCCACCGTGGTGGTGG - Intergenic
917961107 1:180145417-180145439 TGCTGGAGCCAGTGTGGAGGGGG - Intergenic
918482817 1:184997878-184997900 TACCGTACCCACTGTGCAGGAGG + Intergenic
921221835 1:212979010-212979032 TGCAGGGTCTACTGTGTAGGAGG + Intronic
923788142 1:237087759-237087781 TCCAAGCCCCACTGTGGAGGGGG - Intronic
1063580036 10:7297927-7297949 TGGTGCTCCCACTGTGGAGGTGG - Intronic
1064171521 10:13037916-13037938 TGCTGGTTCCACAGTGGAGGAGG + Intronic
1067055692 10:43048565-43048587 TGGCAGGCCCAGTGTGGAGCTGG - Intergenic
1069573204 10:69506921-69506943 TGCCAAGCCCAGCGTGGAGGCGG + Exonic
1070250116 10:74766127-74766149 TACAGGGCCCACTGTGGGAGGGG - Intergenic
1070964465 10:80521109-80521131 TGCAGAGGCCACTGGGGAGGTGG + Exonic
1072683267 10:97521756-97521778 TGCCTGGCCCCCTTTGGAGTGGG + Intronic
1073485448 10:103814973-103814995 TGGCAGGCCAACTGGGGAGGTGG + Intronic
1075506322 10:123025771-123025793 TGCCTGGCCCAGTGTGGTGGTGG + Intronic
1076335823 10:129705902-129705924 TGCCCGGCCCTGTGTGGATGGGG - Intronic
1076566138 10:131400733-131400755 TGCCTGGGCCACCGCGGAGGCGG + Intergenic
1076610999 10:131725877-131725899 TGCAGGGCCCACAGAGGTGGAGG + Intergenic
1077011841 11:382268-382290 TGCCGGGCCCTGTGGGGAGGGGG + Intergenic
1079444299 11:20545674-20545696 GGCCTGGCCCTCTGTGGAGAAGG - Intergenic
1081935929 11:46903966-46903988 TGCTGGGCACGCTGGGGAGGGGG - Intronic
1083954678 11:65976853-65976875 TGCAGAGCCCACTCTGGATGAGG - Intronic
1086426420 11:86688350-86688372 TTCGGGGCCCTCTGAGGAGGAGG - Intergenic
1086426548 11:86689367-86689389 TGCTGGGATCAGTGTGGAGGTGG + Intergenic
1090804842 11:130196473-130196495 TGCCGGGCCCATGCTGCAGGGGG + Intronic
1091270307 11:134306656-134306678 AGCCAGGCCTACTGTAGAGGAGG + Intronic
1096255575 12:50059983-50060005 AGCCTGGCCCACAGAGGAGGAGG + Intronic
1097294778 12:57950493-57950515 TGCCTGACCTACTCTGGAGGTGG - Intronic
1102569220 12:113817448-113817470 AGCCGGGCCCACTCTGCAGAGGG - Exonic
1102911437 12:116717537-116717559 GGCCGGGCTCACGGTGGTGGTGG - Exonic
1106765674 13:32911383-32911405 TTCACAGCCCACTGTGGAGGTGG + Intergenic
1111546298 13:89741306-89741328 TGCCGGGCCTAGTGTGCAGAAGG + Intergenic
1112321312 13:98410208-98410230 AGCCAGCCCCACCGTGGAGGAGG - Intronic
1112955072 13:105047520-105047542 TGCCTGGCTCAGTGTGGAAGAGG - Intergenic
1113485692 13:110650829-110650851 GGCCCGGCCCACAGTGGATGTGG - Intronic
1113781361 13:112979425-112979447 GGCCGGGCACTCTGAGGAGGTGG + Intronic
1114654432 14:24307686-24307708 TGACAAGCCCACTGTGGAGTGGG + Exonic
1116970433 14:51059115-51059137 TCCCAGGACCATTGTGGAGGTGG - Intronic
1121382838 14:93489636-93489658 TTCCAGGCCCACTGGGGTGGAGG + Intronic
1122058607 14:99121812-99121834 TGGCTGGCCCACTGTGGACAAGG - Intergenic
1122123173 14:99565373-99565395 TGCCTGGCACAATGTGGAGAAGG + Intronic
1122925540 14:104897867-104897889 TCCCGGGGCCACACTGGAGGTGG + Intergenic
1125919739 15:43518328-43518350 TGCCGAGGCCACTCTGGAGACGG + Intronic
1126358082 15:47817309-47817331 TGCCAGCCCCACTGTGGGGCAGG + Intergenic
1127808899 15:62546127-62546149 TGCCTGGCACAGTGTGGAGAGGG + Intronic
1128379176 15:67098896-67098918 TGAGGGGGCCAGTGTGGAGGAGG + Intronic
1129094612 15:73191171-73191193 TCCCAGTCCCACTGTGGATGAGG + Intronic
1129244094 15:74269321-74269343 TGCCAGGCCCACGGTGCTGGTGG - Intronic
1131087857 15:89592052-89592074 TGCTGGGCCCACTCTGGAACAGG - Exonic
1132310502 15:100854138-100854160 CCCCGGGCCCACAGTGGAGAGGG + Intergenic
1132457913 16:34217-34239 TGCTGGGCCCACTGTGGGGGTGG + Intergenic
1133015581 16:2938028-2938050 TGCAGGGCCCAGAGGGGAGGAGG + Intronic
1137388511 16:48061774-48061796 TGCAAAACCCACTGTGGAGGCGG + Intergenic
1142008602 16:87702228-87702250 TGGCAGAGCCACTGTGGAGGAGG - Intronic
1142382457 16:89740753-89740775 TGCCTGGCCCACAGTGGGAGAGG + Intronic
1143651595 17:8266961-8266983 TCCCTCTCCCACTGTGGAGGGGG + Intronic
1143730904 17:8882161-8882183 TGCCGGGCCCAGAGTGAAGAAGG + Intronic
1144110003 17:12021467-12021489 AGCGGGGCCCACTGCGGCGGCGG - Intronic
1144128844 17:12226353-12226375 TGTTGGGACCACTGTGCAGGTGG + Intergenic
1144637965 17:16923117-16923139 GGCCGCCCACACTGTGGAGGGGG - Intergenic
1147422354 17:40328174-40328196 TGCCAAGGCCACTGTGGAAGAGG - Intronic
1147438727 17:40433775-40433797 AGCAGGGCCCACTGGGCAGGAGG + Intergenic
1148795809 17:50196145-50196167 TGCCGGGCCCCCTGTGAGTGTGG - Exonic
1148866744 17:50632777-50632799 TGCCTGGCCAACTGTGGGGCTGG + Intergenic
1150735295 17:67731765-67731787 TGCCAGGACCACTGTGGTGCTGG - Intronic
1152077889 17:78169861-78169883 TGCAGGGCCCTCTGTGGGGTGGG + Intronic
1152961912 18:84900-84922 TGCTGGGCCCGCTGTGGGGGTGG + Intergenic
1159926708 18:74276073-74276095 TGCCAGGCTCACAGAGGAGGTGG - Intronic
1159957403 18:74529598-74529620 TGCAGGGCCCCCTGGGCAGGTGG + Intergenic
1160919391 19:1512813-1512835 GGCAGGGCCCATTGAGGAGGGGG - Intronic
1160919734 19:1513805-1513827 TGCCGGGCCCACTGCTGGGATGG - Intergenic
1162141170 19:8586343-8586365 TGCTCGGCCCAGTGTGCAGGCGG - Exonic
1162496861 19:11028183-11028205 TGCTGGGCGCACTGGGGAAGGGG + Intronic
1163228068 19:15979106-15979128 TGCCGGGCACACAGTGGAGGAGG + Intergenic
1163370009 19:16896618-16896640 TGCCGTGGCCCCTGAGGAGGGGG - Exonic
1164824755 19:31277149-31277171 TGACGGGGCCACTCTGGAGGAGG - Exonic
1167729020 19:51239574-51239596 TGCCGCCCCTACTGTGGAGATGG + Exonic
1168515977 19:57010548-57010570 TTCAGGGGCCACTGTGGATGTGG - Intergenic
1168726571 19:58586143-58586165 TGCTGGGCCCGCTGTGGGTGTGG - Intergenic
925444257 2:3914356-3914378 TGCCAGGCACAGTGTGCAGGAGG + Intergenic
925687834 2:6491692-6491714 TGCCGTGGCCACTGTCGGGGAGG - Intergenic
928379081 2:30802717-30802739 TGCAGGGTCCACTGGGGAGATGG + Intronic
930026935 2:47034713-47034735 GGCCTTGCCCACTGTGGAGAGGG - Intronic
932757903 2:74421659-74421681 TGCCGGGGCAACTGTGGGCGGGG - Intronic
933544933 2:83697770-83697792 CTCCAGGCCCACTGGGGAGGAGG - Intergenic
934993308 2:98936306-98936328 CGCCGGGCCAGCTGCGGAGGCGG - Intergenic
936071709 2:109375620-109375642 GCCCTGGCCCACTGGGGAGGAGG - Intronic
936555669 2:113496858-113496880 TGCCGGGGGCGCTGGGGAGGAGG + Intergenic
937241782 2:120466516-120466538 TGCAGGGCCAAGTGTGGGGGAGG + Intergenic
937932825 2:127219544-127219566 AGCCGGGACCCCTGGGGAGGAGG - Intronic
938319893 2:130355820-130355842 TGCCGCGCCCACTGGTGGGGGGG - Intergenic
938626012 2:133110447-133110469 TGCAGGGGACACTGGGGAGGAGG + Intronic
939201573 2:139042328-139042350 TTCCAGGTCCACTGAGGAGGTGG - Intergenic
940896834 2:159089123-159089145 AGCCCAGCCCACTGTGGAAGGGG - Intronic
942955325 2:181766382-181766404 AGCCAGGCCCACTCTGGAGAAGG + Intergenic
944221599 2:197309977-197309999 GGCCGGTCCCTCTGAGGAGGAGG - Intronic
946391310 2:219418420-219418442 TGGCGGGCGCACGGAGGAGGCGG - Exonic
947793571 2:232880880-232880902 GGCTGGGCCCACTGCGAAGGAGG + Intronic
948730055 2:239957097-239957119 TGGCGAGCCCGCAGTGGAGGGGG - Intronic
1169012176 20:2259907-2259929 AGCTGGGCCCACTTTAGAGGAGG - Intergenic
1170904298 20:20498570-20498592 AGCCGGGCCCACTGAGGAGCAGG - Intronic
1173616864 20:44408949-44408971 TCCAGGGCCCACTGAGAAGGAGG + Intronic
1174080840 20:47969646-47969668 AGGCGGGGCCACTGTGGAGAGGG + Intergenic
1175156013 20:56972181-56972203 AGACAGGCCCACTGTGGAGTAGG + Intergenic
1175311027 20:58011653-58011675 GGCCGGGGCCCCTGAGGAGGTGG + Intergenic
1177544861 21:22543570-22543592 TTCTGGACCCACTGTGGCGGGGG - Intergenic
1177983759 21:27947493-27947515 TGCCAGGCCTCCTGGGGAGGAGG + Intergenic
1180155924 21:45977434-45977456 TGCCGGCCCTTCTGTGGATGGGG - Intergenic
1180172624 21:46067700-46067722 GGCCAGGCCCACTGAGGTGGAGG + Intergenic
1180188615 21:46152184-46152206 TTCAGGGCCCTCTGAGGAGGGGG - Intronic
1180997729 22:19973783-19973805 TACGTGGCCCACTGCGGAGGCGG + Exonic
1181013859 22:20057255-20057277 TGCCTGGCCCACACTGGAGCTGG + Intronic
1182150825 22:28026074-28026096 AGCCTGGCCTACAGTGGAGGTGG - Intronic
1183188953 22:36309204-36309226 AGCTCGGCCCACTGTGGAGGTGG + Intronic
1183307669 22:37091425-37091447 TGCTGGGCCCCCAGGGGAGGGGG + Intronic
1185326691 22:50229078-50229100 TGCCGGGCCCACTGGGGAGCAGG + Intronic
1185348263 22:50320026-50320048 TGCAGGGCCCACTGGGAATGGGG - Intronic
950656402 3:14439691-14439713 TGCAGGGACGCCTGTGGAGGAGG + Intronic
952967592 3:38630809-38630831 TGCCAGGCCCACTGGGAGGGAGG + Intronic
954317620 3:49809869-49809891 TGCCGGGCCCACTGTGGAGGAGG + Exonic
954635827 3:52070324-52070346 TGAGGGGCCCAGTGTAGAGGTGG + Intergenic
954717684 3:52534389-52534411 TGCCAGGCCCACGCTGGGGGAGG + Intronic
959893856 3:111585159-111585181 TGCCAGGCCCACTGTGTACCTGG - Intronic
960542985 3:118881332-118881354 TGCCTGCCACACTGTGGAGGTGG + Intergenic
961326250 3:126111109-126111131 TGCCGGGCCCATCGTGGCAGTGG + Intronic
961411832 3:126727708-126727730 TTCCTGGCCCACTGTGAAGCTGG + Intronic
966981112 3:185136572-185136594 AGCTGGGCCCACAGTGGTGGCGG + Intronic
969057313 4:4409945-4409967 GGCTGGGCCCACTTTCGAGGAGG - Intronic
969104126 4:4792009-4792031 TGCTGGGCCCTGTGTGGAGCTGG + Intergenic
969196280 4:5566322-5566344 TGCCTGGCCCAGTGTGGAAGAGG - Intronic
969415709 4:7056752-7056774 TGCAGGGGACAATGTGGAGGTGG - Exonic
974950935 4:68582421-68582443 TGCAGGGGCCACGGTGGAAGTGG + Intronic
975244737 4:72107038-72107060 TCCTGGGCACACTGTGGTGGGGG - Intronic
975420385 4:74157894-74157916 TCCCGGGCCCTCTGAGGATGTGG - Intronic
978219864 4:106256735-106256757 TGCCGGCTGCAGTGTGGAGGAGG - Intronic
980092544 4:128457457-128457479 TGCCGGGATCACTGTGGCAGGGG + Intergenic
984632749 4:182077863-182077885 GGCCCGTCCCACTGTGGATGGGG + Intergenic
985641529 5:1065566-1065588 TGCTGGGTCCACAGGGGAGGTGG - Intronic
985758407 5:1732723-1732745 GGCGGGGCCCACTGTGGAGCTGG + Intergenic
992066621 5:73115628-73115650 TGCTGTGGCCACTGTTGAGGGGG + Intergenic
992228555 5:74641386-74641408 TGCCGCACCCACTGGGGAGTGGG - Exonic
993098917 5:83512285-83512307 GCCAGGGCCCAGTGTGGAGGTGG + Exonic
994183089 5:96788930-96788952 TGCCGGGCACACTTTGGGGCTGG + Intronic
997579564 5:135008742-135008764 TCCCAGGCCCACTGAGGAGAAGG - Intronic
997735950 5:136212690-136212712 TCGCGGGCCCAGTCTGGAGGTGG - Intergenic
998612131 5:143700727-143700749 TGATGGGTACACTGTGGAGGGGG + Intergenic
999258537 5:150223205-150223227 TTCCGGGACCACACTGGAGGAGG + Exonic
1001709409 5:173766044-173766066 TTCCGGGACTACTGAGGAGGGGG + Intergenic
1002638471 5:180619475-180619497 TGCCGGCCCCACTGAGGCAGAGG + Intronic
1004924082 6:20402481-20402503 CGCCGGGGGCACTGGGGAGGAGG - Exonic
1006798638 6:36745860-36745882 TGCTGGGCCCAGTGTGCACGTGG - Intronic
1017795659 6:157841939-157841961 GGCCAGGATCACTGTGGAGGTGG - Intronic
1019420379 7:948027-948049 TGCTGGGTCCTCAGTGGAGGAGG - Intronic
1019713537 7:2528250-2528272 TGCTGGGCCCAGCGGGGAGGTGG - Exonic
1022108522 7:27213689-27213711 TGCCGGCCCGAGGGTGGAGGCGG - Intergenic
1022955740 7:35378398-35378420 TCCTTGGCCCACTGTGGGGGTGG + Intergenic
1024522098 7:50314738-50314760 TGCTGGGGCTCCTGTGGAGGCGG - Intronic
1026739064 7:72967108-72967130 GGCCTTGGCCACTGTGGAGGAGG + Intronic
1026790085 7:73325740-73325762 GGCCTTGGCCACTGTGGAGGAGG + Intronic
1026794127 7:73354901-73354923 TGCCGTTCCCACGGTGGCGGTGG - Intronic
1027104669 7:75397965-75397987 GGCCTTGGCCACTGTGGAGGAGG - Intronic
1029952693 7:104603834-104603856 TGCTGGGCACACTGGGGTGGGGG + Intronic
1032190670 7:129763843-129763865 TGGCGGGACCACTGGGGTGGTGG - Intergenic
1034276491 7:149826151-149826173 TGCTCGGCCCCCTGTGGTGGGGG + Intergenic
1034834132 7:154336423-154336445 TGCCGTGGCCACTGGGCAGGCGG + Intronic
1038328472 8:26589852-26589874 TGCTGGGTCCACTGTGGTGCTGG - Intronic
1039454527 8:37698113-37698135 TGCCGGGCCCAGCCTGAAGGCGG + Exonic
1044684143 8:94811104-94811126 TGCCAGGCTCACTGTGGGGAAGG - Intergenic
1049523928 8:143111064-143111086 TGCGGGGGCCAATGTTGAGGTGG - Intergenic
1049684038 8:143932126-143932148 GGCCCGGCCCACGGTGGAGGTGG - Exonic
1049690217 8:143955036-143955058 TGCTGGGTCTACGGTGGAGGTGG - Intronic
1049788578 8:144462777-144462799 GGCCGGGCCCACTGAGGCGGCGG - Intronic
1052786628 9:32834127-32834149 TGCCTGGGCCTGTGTGGAGGAGG - Intergenic
1056547087 9:87621897-87621919 TACCGAGCCCAGTGTGGATGTGG - Intronic
1057197160 9:93121551-93121573 TGCTGGGACCCCCGTGGAGGGGG + Exonic
1057225233 9:93289467-93289489 AGCTGGGACCCCTGTGGAGGTGG + Exonic
1060968550 9:127724910-127724932 TGCCCCGCCCACCGTGGGGGCGG - Intronic
1061450469 9:130664599-130664621 GGCCGGGCCGACGGGGGAGGTGG - Exonic
1061492918 9:130956197-130956219 GGCCGCCCCCACTGAGGAGGGGG + Intergenic
1062736232 9:138139200-138139222 CGCTGGGCCCGCTGTGGGGGTGG - Intergenic
1203775992 EBV:73498-73520 GGCCGGGCTCAGTGTGGACGTGG - Intergenic
1203788188 EBV:139590-139612 TGCCAGCCCCATTGGGGAGGGGG + Intergenic
1187157692 X:16736442-16736464 TGCTGGCCCCACTGGGGAGCTGG + Intronic
1187700969 X:21963975-21963997 TGGCCAGCCCACTGTGGAGGTGG - Intronic
1192431582 X:71116000-71116022 TGCCTGGCCCACTCTGGTGGGGG + Intergenic
1193374183 X:80738607-80738629 TGCTGTGCACACAGTGGAGGGGG + Intronic
1200098499 X:153675387-153675409 TCCCAGGCCCACTTTGGAGGTGG - Intronic
1200398469 X:156005266-156005288 TGCTGGGCCTGCTGTGGGGGTGG - Exonic
1201754958 Y:17477285-17477307 TGCAGGGCCTACAGTGAAGGTGG + Intergenic
1201846594 Y:18428700-18428722 TGCAGGGCCTACAGTGAAGGTGG - Intergenic