ID: 954318385

View in Genome Browser
Species Human (GRCh38)
Location 3:49813609-49813631
Sequence CCTGCCATGCAGAGGATTCA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 201}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954318385_954318392 4 Left 954318385 3:49813609-49813631 CCCTGAATCCTCTGCATGGCAGG 0: 1
1: 0
2: 1
3: 18
4: 201
Right 954318392 3:49813636-49813658 CCCAGCACATACCTGTGGATGGG 0: 1
1: 0
2: 2
3: 13
4: 138
954318385_954318389 -1 Left 954318385 3:49813609-49813631 CCCTGAATCCTCTGCATGGCAGG 0: 1
1: 0
2: 1
3: 18
4: 201
Right 954318389 3:49813631-49813653 GTGAGCCCAGCACATACCTGTGG 0: 1
1: 0
2: 2
3: 33
4: 211
954318385_954318390 3 Left 954318385 3:49813609-49813631 CCCTGAATCCTCTGCATGGCAGG 0: 1
1: 0
2: 1
3: 18
4: 201
Right 954318390 3:49813635-49813657 GCCCAGCACATACCTGTGGATGG 0: 1
1: 0
2: 2
3: 22
4: 176
954318385_954318394 14 Left 954318385 3:49813609-49813631 CCCTGAATCCTCTGCATGGCAGG 0: 1
1: 0
2: 1
3: 18
4: 201
Right 954318394 3:49813646-49813668 ACCTGTGGATGGGAAGCAGAAGG 0: 1
1: 0
2: 3
3: 34
4: 363

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954318385 Original CRISPR CCTGCCATGCAGAGGATTCA GGG (reversed) Exonic
900464497 1:2818451-2818473 CCTGCCCTGCAGGGGCTGCAGGG + Intergenic
902674487 1:17999339-17999361 CCTGCCATGGAGCAGCTTCATGG - Intergenic
902858067 1:19223656-19223678 CCAGCCTGGCAGAGGAATCAGGG + Intronic
904327153 1:29734199-29734221 CCTGCCCTGCAGAGAAATCAGGG - Intergenic
905641076 1:39590394-39590416 CCTGAAATGCAAAGGGTTCAAGG - Intergenic
907741439 1:57170070-57170092 CCTGGGATGCAGAGGTTGCAGGG - Intronic
909072200 1:71008903-71008925 CCTGCAATACACAGGATTCTAGG - Intronic
909839591 1:80302501-80302523 CCTCCCATGCATAGGAAACATGG - Intergenic
910432483 1:87172838-87172860 CCTCTCATCCAGAGGACTCAAGG - Intergenic
910923358 1:92373244-92373266 CCTACCATGCAGAGAACTGAGGG + Intronic
912371887 1:109179964-109179986 GCTGCCATGCAGAGGAGGGAGGG + Intronic
916613965 1:166421020-166421042 CCTGCCATACAGAGGACTTTTGG - Intergenic
917497296 1:175552346-175552368 CCTGCCATTCAGAGCATTGTGGG - Intronic
920346592 1:205309785-205309807 ACTTCCATCCAGAGGATCCAGGG + Intronic
922452140 1:225745994-225746016 GCTGCCATGCAGTGAATTCACGG + Intergenic
923950520 1:238946894-238946916 CCTGCCCTGGAGAGTTTTCATGG + Intergenic
1063537685 10:6901012-6901034 CCTTCCATGGAGAGGAGACATGG + Intergenic
1063713033 10:8499222-8499244 GGTGCCATGGAGAGGACTCAAGG - Intergenic
1063996729 10:11626699-11626721 CCTGGGAGGCAGAGGTTTCAGGG + Intergenic
1068888099 10:62118134-62118156 CCTGGGAGGCAGAGGTTTCAGGG + Intergenic
1069545612 10:69325908-69325930 CCTGGCAGGCAGAGGTTGCAGGG - Intronic
1069842408 10:71348039-71348061 CCTGCCATGCTGAGGCAGCAGGG + Intronic
1070963000 10:80512019-80512041 TCTACCATGCAGAGAAATCAAGG - Intronic
1071260925 10:83918348-83918370 TGTGCACTGCAGAGGATTCACGG - Intergenic
1071606728 10:86998822-86998844 CCTGCGAGGCAGAGGGTGCAGGG + Intergenic
1073368445 10:102965001-102965023 CCTCCCCTCCAGAGGATGCAAGG + Intronic
1073571398 10:104583660-104583682 CCTCCCAGTCAGAGGATTCTGGG + Intergenic
1076396459 10:130141834-130141856 CCAGCAATGAAGAGGATCCAGGG - Intronic
1076754567 10:132562518-132562540 CCTGTCATGCAGAGGTGTGACGG - Intronic
1077112728 11:869053-869075 CCTGCCATGCAGCGGTGTCCAGG - Exonic
1078440639 11:11363861-11363883 CCTGCCATGAGGAGGGTTCCAGG - Intronic
1078723721 11:13908728-13908750 CCTGCAATGCAGTGGCCTCAGGG - Intergenic
1080060090 11:27948083-27948105 CCTGCCATGTAATGGTTTCATGG - Intergenic
1080599635 11:33809317-33809339 ACTCCCAGACAGAGGATTCAAGG + Intergenic
1081932970 11:46885365-46885387 GCTGCCACGCAGAGGAGGCAAGG + Intronic
1083982412 11:66183719-66183741 CCTGCTCTGCAGAGCAGTCACGG - Intronic
1084461213 11:69297693-69297715 CCTGCCTGGGAGAGGAGTCAGGG + Intronic
1084936921 11:72591805-72591827 CCTGCCATGGTGAGGATGGACGG + Intronic
1087256634 11:95963344-95963366 CAGGGTATGCAGAGGATTCAAGG + Intergenic
1087983256 11:104644023-104644045 CATTCCATCCAGAGGCTTCAGGG + Intergenic
1091544900 12:1495158-1495180 CCTGCCAGGCAGGGGCTTCAGGG - Exonic
1091845668 12:3654471-3654493 CCTGCCAAGCAGAGAAAACAAGG - Intronic
1094472733 12:30818522-30818544 CCTGCCATGCAGGGGTTTTCAGG + Intergenic
1102127454 12:110495629-110495651 CCTGAGAGGCAGAGGTTTCAGGG + Intronic
1102215845 12:111160889-111160911 CCTGCCATGGGGAAGATGCAGGG + Intronic
1102589871 12:113949036-113949058 CCTGCAATGAAGAGGAGTCAGGG + Exonic
1103371070 12:120419889-120419911 CCTGGGAGGCAGAGGTTTCAGGG + Intergenic
1105058411 12:133125725-133125747 TCTGCCATGAAGAGGATAGAAGG + Intronic
1105501788 13:20979340-20979362 CCTGCCCTGCAGAGAACACACGG - Intronic
1106589874 13:31089947-31089969 CCTCACCTGCAGAGGAATCAAGG - Intergenic
1107394110 13:39997226-39997248 CCTGCCATCCAAGGGACTCAGGG + Intergenic
1107938912 13:45367222-45367244 CCTGGGAGGCAGAGGTTTCAGGG + Intergenic
1114453556 14:22841578-22841600 GCTGCCATGCAGAAGTTTTACGG + Exonic
1114787374 14:25616420-25616442 TCTGCCATGCAGAAAAATCAGGG - Intergenic
1115982324 14:39067286-39067308 CTTTCCATGCAGAGGATACATGG - Exonic
1116752521 14:48904400-48904422 CCTTCCCTCCAGAGGACTCAGGG + Intergenic
1117050768 14:51857442-51857464 TATGCCATGCAGAGGAATTAAGG + Intronic
1117090197 14:52242299-52242321 CCTGCCTTGGTGAGGGTTCATGG - Intergenic
1117190366 14:53284480-53284502 CCTGCCTTTCAGAAAATTCAGGG - Intergenic
1117290003 14:54323018-54323040 CCTTCCCTGCAGGGGAGTCATGG - Intergenic
1117526244 14:56608895-56608917 CCTGCCATGCAAAGGAGTTCAGG + Intronic
1119473385 14:74912878-74912900 CCCACCATGCAGATGAGTCAAGG - Intronic
1121418020 14:93792519-93792541 TCTACCTTTCAGAGGATTCAAGG - Intergenic
1122781818 14:104146967-104146989 CCTCACATGCAGAGGTTTCCGGG + Intronic
1202857272 14_GL000225v1_random:59101-59123 CCTGCCATGCGGAGGCCTCCGGG - Intergenic
1123491232 15:20784088-20784110 CCTGCCCTTCAGCGGATTCCTGG + Intergenic
1123547734 15:21353179-21353201 CCTGCCCTTCAGCGGATTCCTGG + Intergenic
1125115896 15:36091321-36091343 CTTGACATGAAGAGGATCCAGGG - Intergenic
1128626978 15:69218436-69218458 CCTGGGAGGCAGAGGTTTCAGGG + Intronic
1202956064 15_KI270727v1_random:80409-80431 CCTGCCCTTCAGCGGATTCCTGG + Intergenic
1133299781 16:4775293-4775315 CCTGCCATGCACTGGATGCAGGG + Intergenic
1134050213 16:11131945-11131967 CCAGCCATGCAGAGGGCTCCAGG - Intronic
1134148921 16:11790181-11790203 CCAACAATGCAGAGGATTCCTGG + Intronic
1135196773 16:20401541-20401563 CCTGCCAGGCAAGGGATTCTGGG - Intronic
1135307815 16:21381979-21382001 CCTGCCACACAGAGGTTGCAGGG - Intergenic
1136304560 16:29361099-29361121 CCTGCCACACAGAGGTTGCAGGG - Intergenic
1139717279 16:68823584-68823606 CCTGCCATTCTGGGGATTCTTGG + Exonic
1140197158 16:72864783-72864805 CCTGCTATGTAGATGATTGATGG - Intronic
1141259989 16:82443980-82444002 CCTGTCATGGAAAGGTTTCAAGG - Intergenic
1142381241 16:89733460-89733482 CCTGCAATGAAGAGCATGCATGG - Exonic
1143033469 17:3981187-3981209 CCTGGGAGGCAGAGGTTTCAGGG + Intergenic
1143131260 17:4678933-4678955 TCTGTCATGCAGAGGCTCCAGGG - Intronic
1143725175 17:8839613-8839635 CCTGCCCTGCAGAGCAACCAAGG - Exonic
1148758995 17:49989753-49989775 GCTGCCAAGCAGTGGAGTCAGGG + Intergenic
1149572135 17:57679537-57679559 CCTGCCCTGCAGAGCATACCTGG + Exonic
1150493938 17:65593038-65593060 CCTGCCCTGCAAAGCCTTCATGG + Intronic
1150768362 17:68020406-68020428 CCTGCCCTGCAGAGGGTCCCGGG - Intergenic
1150791497 17:68203683-68203705 CCTGGGAGGCAGAGGTTTCAGGG - Intergenic
1150910864 17:69385985-69386007 CCTGCCATAAAGAGAATGCATGG - Intergenic
1151498202 17:74472403-74472425 GCTGCCAAGCAGAGGACACATGG - Intronic
1151713673 17:75820567-75820589 CCTGCCGGGCAGAGGCTCCAGGG + Intronic
1151819804 17:76491323-76491345 CCAGCCATGCAGCGGATCCTGGG - Intronic
1152389347 17:79993427-79993449 CCTGCAAGGCAGAGGACACAGGG - Intronic
1152838862 17:82553471-82553493 CTTGACATGCAGAGGAGACAAGG - Intronic
1154072207 18:11162768-11162790 CCTTCCTTGCAGAGTAGTCATGG + Intergenic
1157843310 18:50979433-50979455 CCTACAATGCAGAGAACTCAAGG - Intronic
1158289160 18:55919195-55919217 CCTGCCATGGTCAGGACTCAGGG + Intergenic
1163046126 19:14643784-14643806 CCTGGGAGGCAGAGGTTTCAGGG - Intronic
1164798711 19:31058033-31058055 GATGCCAGGCAGAGGATTCCAGG + Intergenic
1165458119 19:35926743-35926765 CATGCCATGCAGAGAATGAAAGG + Intergenic
1166277324 19:41763023-41763045 CCTGCCATGCAGAGTCCCCATGG - Intronic
1166437689 19:42782949-42782971 CCTGCCATGGAGGCCATTCATGG + Intronic
1166466594 19:43037611-43037633 CCTGCCATGGAGGCCATTCATGG + Intronic
1166472732 19:43093698-43093720 CCTGCCATGGAGGTCATTCATGG + Intronic
1167276547 19:48543560-48543582 CCTTCCCTGCAGTGGCTTCAGGG - Intergenic
1167926448 19:52825019-52825041 CCTGAAATGCAGAGGCTGCAGGG + Intronic
1168510588 19:56970586-56970608 CCTGCCAGGCACAGGGTTCCAGG - Intergenic
925771890 2:7289948-7289970 CCTGCCAGGCAGTGGAGTCAGGG - Intergenic
927109819 2:19856481-19856503 CATGGCATTCAGAGGATTCTAGG - Intergenic
931216545 2:60250146-60250168 CCTGGGAGGCAGAGGCTTCAGGG + Intergenic
931668943 2:64629618-64629640 CCAGGCATGCAGAGGTTTCATGG + Intergenic
932319642 2:70812324-70812346 CCTGCCTGGCAGAGGAGACATGG + Intronic
932633968 2:73371730-73371752 CCTGCCCTGCAGAGGTTGCAAGG - Intergenic
932655849 2:73610617-73610639 CCTGCCATGAAGAGGACACTGGG + Intronic
934153726 2:89174924-89174946 CTCCCCATACAGAGGATTCATGG + Intergenic
934213512 2:90007008-90007030 CTCCCCATACAGAGGATTCATGG - Intergenic
935274294 2:101463105-101463127 CCTGTCATACAGAGGCTGCAAGG - Intronic
936289595 2:111211309-111211331 CCTGGGATGCAGAGGTTGCAGGG - Intergenic
938007206 2:127797055-127797077 CCTGCCATGGTGATCATTCATGG - Intronic
946010078 2:216557535-216557557 CCTGCTGGGCAGAGGATTCGAGG + Intronic
947140276 2:227013965-227013987 CCTGTCATGAAAAGGATGCATGG + Intronic
1169939858 20:10925372-10925394 TCTGCCCAGCAGAGGTTTCAGGG - Intergenic
1171517721 20:25750895-25750917 CCTGGGGTGCAGAGGATTCGTGG + Intergenic
1172802972 20:37591274-37591296 CCTTCCATGTAGAGGGGTCAAGG - Intergenic
1173259635 20:41422175-41422197 ACTGCCATGCTGAGGAGCCAGGG - Intronic
1175153639 20:56954736-56954758 CCTGCCATCCAGGGGCTTCGTGG - Intergenic
1175673925 20:60931014-60931036 CCCTCCCTGCAGAGGACTCAGGG + Intergenic
1177320490 21:19513679-19513701 CCTGCCATCCAGAAGCTTCCTGG - Intergenic
1178918521 21:36723109-36723131 CCTGACCTGCAGCGGATACAAGG + Exonic
1182907452 22:33950365-33950387 TCTGCCATGCAGATCATTAAAGG + Intergenic
1183296306 22:37031523-37031545 CCCGCGAGGCAGAGGTTTCAGGG - Intergenic
1183815029 22:40292654-40292676 CCTGGGCTGCAGAGGAATCACGG - Intronic
1183948683 22:41340716-41340738 CCTGCCAGGCAGAGGAAGCAGGG + Intronic
1184404524 22:44292507-44292529 CCTCCCATGGTGAGGATTAATGG + Intronic
1184987982 22:48148309-48148331 CCTGCCAAGCACAGGCTTCGGGG + Intergenic
950992847 3:17459344-17459366 CCTCGCATGCACAGGGTTCATGG + Intronic
952271211 3:31833458-31833480 CCTGACATGCAGAAGCTGCATGG + Intronic
953080027 3:39608320-39608342 CCTGCCATCCAGATGCTTCCTGG + Intergenic
953795572 3:45983279-45983301 GCTGCCCTGCAGAGGAGTGAAGG + Intronic
954318385 3:49813609-49813631 CCTGCCATGCAGAGGATTCAGGG - Exonic
955237337 3:57150914-57150936 CCTGCTCTGCTGAGGATTCCTGG + Intronic
956488913 3:69750966-69750988 CCTTCCATGGATAGGATTCTTGG + Intronic
957856899 3:85891171-85891193 CTTGCTATGCAGAAGATTAAAGG - Intronic
961573603 3:127817576-127817598 CCTGCCAGGCAGTGAGTTCAAGG - Intronic
961581124 3:127883268-127883290 GCTGCCAAGAATAGGATTCAAGG + Intergenic
963702998 3:148649953-148649975 CCTGGCCTGCAGAGGAATCAGGG + Intergenic
965513686 3:169597703-169597725 CCTGCCAACCAGAGGTATCAAGG - Intronic
967521406 3:190436934-190436956 CCTGCCATCCTGAGCATTCCTGG + Intronic
967604945 3:191433815-191433837 CCTGGCATTAAGAGGATTTAGGG - Intergenic
967884058 3:194321491-194321513 CCTGGGATGCAGAGGTTGCAGGG + Intergenic
968731675 4:2272038-2272060 CGTGCCATGCAGGGGCTCCAGGG - Intronic
969229658 4:5821172-5821194 CCTGCCATTCCGAGAATTCACGG + Exonic
969284620 4:6195102-6195124 CCTGAGTTGCAGAGGGTTCAGGG + Intronic
969601613 4:8179735-8179757 CCTGACCTGCAGAGGGTCCATGG + Intergenic
970005529 4:11407369-11407391 TCAGACATGCAGAGGATTCAAGG - Intronic
971390933 4:26184601-26184623 CCAGTCAAGCAGAGGACTCAGGG + Intronic
971407802 4:26338649-26338671 CCTGGGAGGCAGAGGTTTCAGGG - Intronic
971653442 4:29309694-29309716 CCTGCAATGCTGAGGATCTATGG + Intergenic
973327548 4:48878632-48878654 TGTGCCATGCAGATGGTTCAGGG + Intergenic
974468814 4:62292778-62292800 TCTCCCATGCAGAGGAGGCAGGG - Intergenic
977281519 4:95045695-95045717 CCTGCTATGCTGAGGAAACATGG - Intronic
978787904 4:112630440-112630462 CCTGGGAGGCAGAGGCTTCAGGG + Intronic
978890842 4:113825425-113825447 CCTCCACTGCAGAGGCTTCAGGG + Intergenic
979107437 4:116705674-116705696 CCTTCCTTGCAGAGGCTGCAGGG - Intergenic
979802758 4:124931359-124931381 CCTGCCTTTATGAGGATTCAAGG - Intergenic
981172259 4:141637920-141637942 CCTGCCATGTAGAGGTTATAAGG + Intronic
982839123 4:160159975-160159997 CCTGCCATTCAGCGGGTTCCAGG + Intergenic
983990912 4:174118565-174118587 CAGGCCATGGAGAGGCTTCAGGG - Intergenic
985217257 4:187667164-187667186 CCTGCCACTCAGAGGCTGCAAGG + Intergenic
985730707 5:1546719-1546741 CCTGCTTTGCAGAGGATGGAAGG - Intergenic
987955032 5:24728088-24728110 TCTGCCATGCAGACCATGCATGG - Intergenic
993310034 5:86318090-86318112 CCTGGGAGGCAGAGGATGCAGGG - Intergenic
994730132 5:103481869-103481891 CCTGCCATCCAGTGGATTCAAGG + Intergenic
994761236 5:103856876-103856898 CCTGAGAGGCAGAGGTTTCAGGG - Intergenic
997330816 5:133059873-133059895 CCTGCCATGGATAGGGATCAGGG + Intronic
999736318 5:154516016-154516038 CCTGGGATGCGGAGGTTTCAGGG - Intergenic
1001781436 5:174372182-174372204 CCAGCCCAGCAGAGGATTGAAGG + Intergenic
1003198911 6:3940900-3940922 CCTGCCATCCAGTGGCGTCAGGG - Intergenic
1004157180 6:13180430-13180452 CCAGCCAAGCCCAGGATTCATGG + Intronic
1005442732 6:25888069-25888091 TCTGCCATACAGGGGATTCTGGG + Intergenic
1007651217 6:43423806-43423828 CCTGGGAAGCAGAGGTTTCAGGG - Intergenic
1008464877 6:51819142-51819164 CTTATCATGCTGAGGATTCAGGG - Intronic
1013674034 6:112437066-112437088 CCTGCCACTCAGATGTTTCATGG - Intergenic
1014035083 6:116757671-116757693 CCTGGCAGGCAGAGGATGCAGGG + Intronic
1016378062 6:143444300-143444322 CCTGCCATGCTGAGGATGAGTGG + Intronic
1019093376 6:169558839-169558861 CCTGCTATGCTGTGGATTTATGG - Intronic
1025795290 7:64733927-64733949 TCTGCCATGGAGAGGATCCATGG - Intergenic
1026108155 7:67437279-67437301 TCTGCCATGAAGAGGATACTTGG - Intergenic
1027053794 7:75036448-75036470 CCTGCCCTGCAGAGCAGCCAAGG - Intronic
1029188374 7:98755251-98755273 CCTGGCGTGCAGAGCATTGAGGG + Intergenic
1031229607 7:119088544-119088566 CCTGGGAGGCAGAGGTTTCAGGG + Intergenic
1037752342 8:21690998-21691020 CCTTCCATGCAGAGGCTGGAAGG + Exonic
1038409652 8:27348324-27348346 CCTGTCATGCAGAGGAAACAGGG - Intronic
1039347503 8:36723570-36723592 CCTGGGAGGCAGAGGATGCAGGG + Intergenic
1039702743 8:39978765-39978787 CCAGCCAAGCAGTGGCTTCAGGG + Intronic
1045676642 8:104614893-104614915 CCTGCCATCCAGATGCTTCTTGG + Intronic
1046911997 8:119638773-119638795 CTTGCCATGTCGAGGATTCTTGG + Exonic
1047420278 8:124702364-124702386 CCTCCCCTGCTCAGGATTCAGGG - Intronic
1048344493 8:133566520-133566542 CCTGCAATGCGGGGGATGCAGGG - Intronic
1049747007 8:144267237-144267259 CCTGCCAGGCAGAGGAGGCGAGG + Intronic
1049784119 8:144442485-144442507 CCTGCCATGCTGTGGTCTCAGGG + Intronic
1052836997 9:33258218-33258240 CCTGGCAGGCAGAGGCTACAGGG + Intronic
1053141521 9:35685541-35685563 CCTGCCTTTCAGAGGAATGAAGG - Exonic
1053196669 9:36125183-36125205 ACTTCCAAGCAGAGAATTCAGGG - Intergenic
1053427322 9:38019028-38019050 CCTGGCCTGCAGAGGAGTCCCGG - Intronic
1054949626 9:70835472-70835494 AATGCCAAGCAGAGGACTCAGGG - Intronic
1055052581 9:71995142-71995164 GCTGGAATGCAGAGGATTCACGG + Intergenic
1056798741 9:89676714-89676736 CCTGCCCTGCCCAGGTTTCAGGG - Intergenic
1059023407 9:110599543-110599565 CCTGCCTTGCTGAGGATCCTAGG + Intergenic
1059828320 9:118059466-118059488 CGTGCCATTCTGAGGATTGAGGG - Intergenic
1061023895 9:128035052-128035074 CCTGCCACGCAGTGGGGTCATGG - Intergenic
1061234421 9:129334332-129334354 CCTTCCAGGCAGAGCCTTCAGGG - Intergenic
1185682242 X:1898213-1898235 CATGTCCTGCAGAGGAATCAGGG + Intergenic
1186964487 X:14772685-14772707 CCTGCCTTGCAGGGGATCCCAGG + Intergenic
1188726894 X:33596373-33596395 CCAGACATGCAAAGGATTCAGGG - Intergenic
1191631458 X:63326286-63326308 CCTCCCATGGCCAGGATTCATGG + Intergenic
1192438930 X:71160579-71160601 TCTGCCTTGGAGAGGATCCATGG - Intronic
1194550314 X:95290290-95290312 ATTGCCATGGAGATGATTCATGG - Intergenic
1197133778 X:123037000-123037022 CCTGCCAAGCAGAAAATGCAGGG - Intergenic
1201399584 Y:13590691-13590713 ACTGCCATGAAGAAGATTCTTGG - Intergenic
1202088825 Y:21166618-21166640 ACTGCCATGCTTAGGATCCAAGG - Intergenic