ID: 954320568

View in Genome Browser
Species Human (GRCh38)
Location 3:49829705-49829727
Sequence GAGCCAGATGAGGAACTGGT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1632
Summary {0: 1, 1: 0, 2: 2, 3: 81, 4: 1548}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954320568_954320579 24 Left 954320568 3:49829705-49829727 CCAACCAGTTCCTCATCTGGCTC 0: 1
1: 0
2: 2
3: 81
4: 1548
Right 954320579 3:49829752-49829774 TGAGAGCTGGGACTCCTGCAGGG 0: 1
1: 0
2: 2
3: 40
4: 253
954320568_954320573 11 Left 954320568 3:49829705-49829727 CCAACCAGTTCCTCATCTGGCTC 0: 1
1: 0
2: 2
3: 81
4: 1548
Right 954320573 3:49829739-49829761 TCTGGCCACCCAGTGAGAGCTGG 0: 1
1: 0
2: 1
3: 21
4: 192
954320568_954320571 -7 Left 954320568 3:49829705-49829727 CCAACCAGTTCCTCATCTGGCTC 0: 1
1: 0
2: 2
3: 81
4: 1548
Right 954320571 3:49829721-49829743 CTGGCTCTCCTGCACAGCTCTGG 0: 1
1: 0
2: 2
3: 41
4: 294
954320568_954320574 12 Left 954320568 3:49829705-49829727 CCAACCAGTTCCTCATCTGGCTC 0: 1
1: 0
2: 2
3: 81
4: 1548
Right 954320574 3:49829740-49829762 CTGGCCACCCAGTGAGAGCTGGG 0: 1
1: 0
2: 0
3: 25
4: 219
954320568_954320578 23 Left 954320568 3:49829705-49829727 CCAACCAGTTCCTCATCTGGCTC 0: 1
1: 0
2: 2
3: 81
4: 1548
Right 954320578 3:49829751-49829773 GTGAGAGCTGGGACTCCTGCAGG 0: 1
1: 0
2: 4
3: 30
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954320568 Original CRISPR GAGCCAGATGAGGAACTGGT TGG (reversed) Exonic
900951031 1:5858428-5858450 GGGCCAGGGGAGGAGCTGGTGGG - Intergenic
901208821 1:7513010-7513032 GAGCAAGGTGAGAATCTGGTGGG + Intronic
901252580 1:7791836-7791858 GAGAGAGATGAGGAACTTGTTGG - Intronic
902271146 1:15306118-15306140 GATGGAGATGAGGAACTTGTTGG + Intronic
902570506 1:17344114-17344136 GATGGAGATGAGGAACTTGTTGG + Intronic
903514948 1:23903944-23903966 GAGCCAGCTGAGCAACTAGGAGG - Intronic
903884314 1:26532038-26532060 GAGGCAGGTGAGGGGCTGGTGGG + Intronic
904386254 1:30144125-30144147 GATGGAGATGAGGAACTTGTTGG - Intergenic
904486083 1:30825201-30825223 GAGCCAGATGAGGAACGGTGGGG + Intergenic
905213622 1:36391410-36391432 GAGAGAGATGAGGAACTGGTGGG - Intronic
905290160 1:36916094-36916116 GATGGAGATGAGGAACTTGTTGG + Intronic
906020709 1:42627149-42627171 GATGGAGATGAGGAACTTGTTGG + Intronic
906372796 1:45268917-45268939 GATGGAGATGAGGAACTTGTTGG + Intronic
906833429 1:49058789-49058811 GATGGAGATGAGGAACTTGTTGG + Intronic
906835998 1:49084016-49084038 GATGGAGATGAGGAACTTGTTGG - Intronic
906840909 1:49138275-49138297 GAACCAAAGGAGGAACAGGTAGG + Intronic
906938371 1:50234513-50234535 GATAGAGATGAGGAACTTGTTGG + Intergenic
907002030 1:50870738-50870760 GAGAGAGATGGGGAACTGGCAGG - Intronic
907007862 1:50933456-50933478 GATGGAGATGAGGAACTTGTTGG - Intronic
907021114 1:51067583-51067605 GATAGAGATGAGGAACTTGTTGG - Intergenic
907392333 1:54166365-54166387 GATGGAGATGAGGAACTTGTTGG - Intronic
907508740 1:54942738-54942760 GATGGAGATGAGGAACTTGTTGG + Intergenic
907522222 1:55031530-55031552 GGGGCAGATGAGGAACTTGTTGG + Intergenic
907555806 1:55343467-55343489 GATGGAGATGAGGAACTTGTTGG + Intergenic
907625219 1:56022922-56022944 GATAGAGATGAGGAACTTGTTGG - Intergenic
907647057 1:56254731-56254753 GAGCCAGAGCATGAACTGCTAGG - Intergenic
907686200 1:56614288-56614310 GATGGAGATGAGGAACTTGTTGG - Intronic
907726931 1:57028661-57028683 GATAGAGATGAGGAACTGGTTGG + Intronic
907925584 1:58952668-58952690 GATGGAGATGAGGAACTTGTTGG + Intergenic
908442719 1:64170889-64170911 GATGGAGATGAGGAACTTGTTGG - Intronic
908624872 1:66028793-66028815 GATGGAGATGAGGAACTTGTTGG - Intronic
908667870 1:66511949-66511971 GATGTAGATGAGGAACTTGTTGG + Intergenic
908881916 1:68742434-68742456 GATAGAGATGAGGAACTTGTTGG + Intergenic
908887363 1:68804857-68804879 GAGCCACAGGAGGAACAGGGGGG + Intergenic
908919186 1:69169638-69169660 GATGGAGATGAGGAACTTGTTGG + Intergenic
908932968 1:69339836-69339858 GATACAGATGAGGAACTTGTTGG + Intergenic
908936649 1:69384187-69384209 GATGGAGATGAGGAACTTGTTGG - Intergenic
909044301 1:70690550-70690572 GATGAAGATGAGGAACTTGTTGG + Intergenic
909054128 1:70803178-70803200 GATGGAGATGAGGAACTTGTTGG + Intergenic
909057875 1:70844489-70844511 GATGGAGATGAGGAACTTGTTGG + Intergenic
909065657 1:70932180-70932202 GATGGAGATGAGGAACTTGTTGG - Intronic
909104438 1:71391398-71391420 GATGGAGATGAGGAACTTGTTGG + Intergenic
909224918 1:73007056-73007078 GAGCCAGCTGAGGTGGTGGTGGG + Intergenic
909265349 1:73550728-73550750 GATGGAGATGAGGAACTTGTTGG - Intergenic
909269260 1:73601640-73601662 GATGGAGATGAGGAACTTGTTGG - Intergenic
909360721 1:74756407-74756429 GATGGAGATGAGGAACTTGTTGG + Intronic
909373560 1:74914649-74914671 GATGGAGATGAGGAACTTGTTGG - Intergenic
909580017 1:77223006-77223028 GATGGAGATGAGGAACTTGTTGG - Intergenic
909599920 1:77450121-77450143 GATGGAGATGAGGAACTTGTTGG - Intronic
909755449 1:79220288-79220310 GATGGAGATGAGGAACTTGTTGG + Intergenic
909794813 1:79719898-79719920 GATGGAGATGAGGAACTTGTTGG - Intergenic
909826089 1:80128341-80128363 GATGGAGATGAGGAACTTGTTGG - Intergenic
909882111 1:80892549-80892571 GAGCCAAATGAAGACCTGCTAGG + Intergenic
910166963 1:84337993-84338015 GATGGAGATGAGGAACTTGTTGG - Intronic
910233305 1:85008669-85008691 GAGGGAGATGAGGAACTTGTTGG - Intronic
910256213 1:85249657-85249679 GATGGAGATGAGGAACTTGTTGG - Intergenic
910707000 1:90140400-90140422 GATAGAGATGAGGAACTTGTTGG - Intergenic
910817781 1:91311130-91311152 GATGAAGATGAGGAACTTGTTGG + Intronic
911007698 1:93243780-93243802 GAGAGAAATGAGGAACTTGTTGG - Intronic
911134870 1:94429051-94429073 GATGGAGATGAGGAACTTGTTGG + Intronic
911358414 1:96848577-96848599 GATGGAGATGAGGAACTTGTTGG + Intergenic
911376303 1:97056191-97056213 GATGGAGATGAGGAACTTGTTGG + Intergenic
911407736 1:97463710-97463732 GATGGAGATGAGGAACTTGTTGG + Intronic
911490699 1:98562620-98562642 GATGGAGATGAGGAACTTGTTGG + Intergenic
911500660 1:98680744-98680766 GATGGAGATGAGGAACTTGTTGG - Intronic
911629504 1:100166462-100166484 GATGGAGATGAGGAACTTGTTGG + Intronic
911662262 1:100515091-100515113 AAGCCAGATGAGTGCCTGGTGGG - Intronic
911686353 1:100781351-100781373 GATGGAGATGAGGAACTTGTTGG - Intergenic
911907536 1:103588960-103588982 GATAAAGATGAGGAACTTGTTGG - Intergenic
912052141 1:105542496-105542518 GATGGAGATGAGGAACTTGTTGG - Intergenic
912099122 1:106184316-106184338 GATGGAGATGAGGAACTTGTTGG + Intergenic
912182619 1:107237156-107237178 GATGGAGATGAGGAACTTGTTGG + Intronic
912267513 1:108173817-108173839 GATGGAGATGAGGAACTTGTTGG + Intronic
912540834 1:110413927-110413949 GACCCAGATGCAGAACAGGTTGG + Intergenic
912550308 1:110481039-110481061 GAGCCAGATGGGCAACTGGGAGG + Intergenic
912907228 1:113719556-113719578 GATGGAGATGAGGAACTTGTTGG - Intronic
912926613 1:113918679-113918701 CAGCCAGGTGAAGACCTGGTGGG + Intergenic
913018463 1:114763435-114763457 GATGGAGATGAGGAACTTGTTGG + Intergenic
913094392 1:115502771-115502793 GATGGAGATGAGGAACTTGTTGG + Intergenic
913254296 1:116939947-116939969 GATGGAGATGAGGAACTTGTTGG - Intronic
913289537 1:117259386-117259408 GATGGAGATGAGGAACTTGTTGG - Intergenic
913336853 1:117716628-117716650 GATGGAGATGAGGAACTGCTTGG + Intergenic
913396432 1:118377141-118377163 GATGGAGATGAGGAACTTGTTGG - Intergenic
913458910 1:119063120-119063142 GATGGAGATGAGGAACTTGTTGG + Intronic
913490722 1:119377334-119377356 GATGGAGATGAGGAACTTGTTGG - Intronic
914905019 1:151736934-151736956 GAAGGAGATGAGGAACTGATTGG + Intergenic
915654933 1:157351572-157351594 GATGGAGATGAGGAACTTGTTGG - Intergenic
915665515 1:157440697-157440719 GATGGAGATGAGGAACTTGTTGG - Intergenic
915689509 1:157674982-157675004 GATGCAGATGAGGAACTTATTGG + Intronic
915855924 1:159386473-159386495 GATGGAGATGAGGAACTTGTTGG + Intergenic
916035729 1:160921118-160921140 GATGGAGATGAGGAACTTGTTGG + Intergenic
916411635 1:164552178-164552200 GATGGAGATGAGGAACTTGTTGG - Intergenic
916467143 1:165083819-165083841 GATGGAGATGAGGAACTTGTTGG + Intergenic
916814520 1:168338388-168338410 GATGGAGATGAGGAACTTGTTGG - Intergenic
916959132 1:169871741-169871763 GATGGAGATGAGGAACTTGTTGG + Intronic
917022318 1:170602488-170602510 GATGGAGATGAGGAACTTGTTGG - Intergenic
917035524 1:170743666-170743688 GATGGAGATGAGGAACTTGTTGG - Intergenic
917083810 1:171285304-171285326 GAGCCAGATGTGGATCCGTTAGG - Exonic
917195092 1:172456373-172456395 GAGAGAGGTGAGGAAATGGTGGG - Intronic
918029587 1:180792018-180792040 CTGCCAGATCAGGAAGTGGTAGG + Intronic
918526167 1:185467253-185467275 GAGACAGATGGGGAACTGGAAGG + Intergenic
918633431 1:186747142-186747164 GATGGAGATGAGGAACTTGTAGG + Intergenic
918752540 1:188290537-188290559 GATGAAGATGAGGAACTTGTTGG - Intergenic
918772252 1:188576320-188576342 CAGAAAGATGAGGAACTGGTAGG - Intergenic
918955788 1:191205256-191205278 GATAAAGATGAGGAACTTGTTGG + Intergenic
919011818 1:191974614-191974636 GATGGAGATGAGGAACTTGTTGG - Intergenic
919027996 1:192202123-192202145 GATGGAGATGAGGAACTTGTTGG - Intergenic
919066099 1:192694237-192694259 GATGGAGATGAGGAACTTGTTGG - Intergenic
919156877 1:193776645-193776667 GATGAAGATGAGGAACTTGTTGG - Intergenic
919242650 1:194935274-194935296 GATGGAGATGAGGAACTAGTTGG + Intergenic
919256337 1:195129326-195129348 GAGGGAGATGAGGAACTTGGTGG - Intergenic
919362417 1:196611661-196611683 GATGGAGATGAGGAACTTGTTGG + Intergenic
919398524 1:197080900-197080922 GATGGAGATGAGGAACTTGTTGG + Intergenic
919409779 1:197228494-197228516 GATGGAGATGAGGAACTTGTTGG - Intergenic
919473857 1:198010865-198010887 GATGGAGATGAGGAACTTGTTGG - Intergenic
919554387 1:199032273-199032295 GATGGAGATGAGGAACTTGTTGG - Intergenic
919842550 1:201619752-201619774 GAGCTAGATGAGGAAGAGGCAGG + Intergenic
920230511 1:204466871-204466893 GAGCCAGCTCTGGAACTGGCTGG - Intronic
920594594 1:207256184-207256206 GATGGAGATGAGGAACTTGTTGG - Intergenic
920860401 1:209700912-209700934 GATAGAGATGAGGAACTTGTTGG - Intronic
921230112 1:213061443-213061465 GAGCCACAGGTGGCACTGGTTGG - Intronic
921424276 1:214984283-214984305 GATGGAGATGAGGAACTTGTTGG + Intergenic
921610316 1:217205984-217206006 GATAGAGATGAGGAACTTGTTGG + Intergenic
921676780 1:217984897-217984919 GAGACACATCAGAAACTGGTGGG + Intergenic
921724282 1:218507144-218507166 GATGGAGATGAGGAACTTGTTGG + Intergenic
921737187 1:218642318-218642340 GAGCCAGGTGAGGGAGTGCTTGG + Intergenic
921773473 1:219070968-219070990 GATGGAGATGAGGAACTTGTTGG + Intergenic
922115500 1:222608946-222608968 GAGGCATATAAGGAACTTGTTGG - Intergenic
922181287 1:223234971-223234993 GTGCTAGTTGAGGAACAGGTAGG + Intronic
922466799 1:225849937-225849959 GAGCCAGAAGAGGCACAGGATGG + Exonic
922900705 1:229134383-229134405 GATGGAGATGAGGAACTTGTTGG + Intergenic
923095024 1:230768360-230768382 GAGGCAGCTGAGAAACGGGTGGG - Intronic
923198092 1:231686990-231687012 GATGGAGATGAGGAACTTGTTGG - Intronic
923232987 1:232006391-232006413 GATGGAGATGAGGAACTTGTTGG + Intronic
923427957 1:233890945-233890967 GAGGGAGATAAGGAACTTGTTGG + Intergenic
923878450 1:238076135-238076157 GATGAAGATGAGGAACTTGTTGG - Intergenic
923919461 1:238547021-238547043 GATGGAGATGAGGAACTTGTTGG - Intergenic
924040431 1:239979232-239979254 GATGGAGATGAGGAACTTGTTGG + Intergenic
924152509 1:241143066-241143088 GATGGAGATGAGGAACTTGTTGG - Intronic
924806453 1:247365571-247365593 GATGGAGATGAGGAACTTGTTGG + Intergenic
1062859178 10:796676-796698 GATGGAGATGAGGAACTTGTTGG + Intergenic
1063335748 10:5211522-5211544 GATGGAGATGAGGAACTTGTTGG - Intronic
1063481575 10:6381114-6381136 GATGGAGATGAGGAACTTGTTGG - Intergenic
1063636901 10:7790788-7790810 TTGACAGATGAGGAACTGGTGGG - Intronic
1064628084 10:17282112-17282134 GATGAAGATGAGGAACTTGTTGG + Intergenic
1064793807 10:18989009-18989031 GATCGAGATGAGAAACTTGTTGG - Intergenic
1065326849 10:24556965-24556987 GATCAGGATGAGGAAGTGGTGGG - Intergenic
1065864632 10:29903392-29903414 AAGCCAAATGAGGAATAGGTGGG - Intergenic
1066040847 10:31546913-31546935 GATGGAGATGAGGAACTTGTTGG - Intergenic
1066242702 10:33553506-33553528 GAGCCACATGGAGAACAGGTAGG - Intergenic
1066273391 10:33845134-33845156 GATGGAGATGAGGAACTTGTTGG - Intergenic
1066451779 10:35536607-35536629 GATGGAGATGAGGAACTTGTTGG + Intronic
1067814608 10:49464178-49464200 GACGGAGATGAGGAACTTGTTGG + Intronic
1067911357 10:50350115-50350137 GATGGAGATGAGGAACTTGTTGG + Intronic
1068128348 10:52868148-52868170 GATGGAGATGAGGAACTTGTTGG + Intergenic
1068163073 10:53293116-53293138 GATACAGATGAGGAACTTATTGG + Intergenic
1068215656 10:53978867-53978889 GATGGAGATGAGGAACTTGTTGG - Intronic
1068229919 10:54157939-54157961 GAGGGAGATGAGGAACTTCTTGG - Intronic
1068235523 10:54227900-54227922 GATAGAGATGAGGAACTTGTTGG - Intronic
1068250846 10:54438116-54438138 GAGCTAGGTGAGGAACAGGTAGG - Intronic
1068312312 10:55293718-55293740 GATGAAGATGAGGAACTTGTTGG - Intronic
1068519560 10:58063490-58063512 GATGGAGATGAGGAACTTGTTGG - Intergenic
1068805853 10:61193148-61193170 GATGAAGATGAGGAACTTGTTGG - Intergenic
1069040726 10:63693257-63693279 GATGGAGATGAGGAACTTGTCGG + Intergenic
1069239734 10:66124324-66124346 GATGGAGATGAGGAACTTGTTGG - Intronic
1069577640 10:69542225-69542247 GATGGAGATGAGGAACTTGTTGG - Intergenic
1069794876 10:71045660-71045682 TACCCAGAAGAGGAACTGGGAGG + Intergenic
1069955731 10:72050251-72050273 GACCCAGAGGAGGAACGTGTGGG + Intergenic
1071327660 10:84533310-84533332 GATGGAGATGAGGAACTTGTTGG + Intergenic
1071671215 10:87611093-87611115 GATGGAGATGAGGAACTTGTTGG + Intergenic
1071776769 10:88797955-88797977 GATGGAGATGAGGAACTTGTTGG - Intergenic
1071990647 10:91097883-91097905 GATGGAGATGAGGAACTTGTTGG - Intergenic
1072272162 10:93787280-93787302 GAGCCAGAGGGAGAAATGGTGGG - Intronic
1072647476 10:97268221-97268243 GATGGAGATGAGGAACTTGTTGG - Intronic
1072866571 10:99068054-99068076 GATGGAGATGAGGAACTTGTTGG - Intronic
1072963322 10:99950581-99950603 GAAGGAGATGAGGAACTTGTTGG + Intronic
1073260201 10:102183959-102183981 GATGGAGATGAGGAACTTGTTGG - Intergenic
1073634740 10:105186137-105186159 AAGCCAGAAGTGGAATTGGTGGG + Intronic
1073964831 10:108977385-108977407 GATGGAGATGAGGAACTTGTTGG + Intergenic
1074041507 10:109793943-109793965 GATGGAGATGAGGAACTTGTTGG - Intergenic
1074223544 10:111461631-111461653 GATGGAGATGAGGAACTTGTTGG + Intergenic
1074262633 10:111869711-111869733 GATGCAGATGAGGAACTTATTGG + Intergenic
1074286340 10:112101387-112101409 GATAGAGATGAGGAACTTGTTGG - Intergenic
1074640159 10:115370476-115370498 GATGGAGATGAGGAACTTGTTGG + Intronic
1074836713 10:117303222-117303244 GATGGAGATGAGGAACTTGTTGG + Intronic
1074878347 10:117631997-117632019 AACCCAGCTGAGGGACTGGTGGG - Intergenic
1075299311 10:121307226-121307248 GTGCCAGATGGGGAGCTGGTAGG + Intergenic
1075543759 10:123337929-123337951 GATGGAGATGAGGAACTTGTTGG - Intergenic
1075550265 10:123387655-123387677 GATGGAGATGAGGAACTTGTTGG + Intergenic
1076219004 10:128718050-128718072 GAGCCAGGTGAGCATCTTGTAGG - Intergenic
1076225609 10:128772607-128772629 GATGGAGATGAGGAACTTGTTGG + Intergenic
1076464913 10:130672514-130672536 GATGGAGATGAGGAACTTGTTGG - Intergenic
1076582296 10:131519998-131520020 GAACAAGGTGAGGTACTGGTGGG + Intergenic
1076582401 10:131520422-131520444 GAACAAGGTGAGGTACTGGTGGG - Intergenic
1076651606 10:131993121-131993143 CAGCCAGATGAGGAACCTTTTGG - Intergenic
1076689622 10:132215911-132215933 GATGGAGATGAGGAACTTGTTGG + Intronic
1076760175 10:132600394-132600416 GATAGAGATGAGGAACTTGTTGG - Intronic
1077735045 11:4782289-4782311 GATGGAGATGAGGAACTTGTTGG + Intronic
1077942640 11:6859689-6859711 GATGGAGATGAGGAACTTGTTGG - Intergenic
1078364946 11:10698948-10698970 GATGGAGATGAGGAACTTGTTGG + Intergenic
1078514890 11:12013657-12013679 GATGGAGATGAGGAACTTGTTGG + Intergenic
1078843926 11:15105072-15105094 CAGCCAGCAGAGGAACTGGCTGG + Intergenic
1078989792 11:16635339-16635361 GATGGAGATGAGGAACTTGTTGG + Intronic
1079093053 11:17494167-17494189 GGGCCAGATAAGGAACAGCTCGG - Intronic
1079147692 11:17868388-17868410 GATGGAGATGAGGAACTTGTTGG - Intronic
1079182027 11:18202166-18202188 GATGGAGATGAGGAACTTGTTGG - Intronic
1079272869 11:19005079-19005101 GATGGAGATGAGGAACTTGTTGG + Intergenic
1079341140 11:19612642-19612664 GATGGAGATGAGGAACTTGTTGG - Intronic
1079500334 11:21095220-21095242 GATGGAGATGAGGAACTTGTTGG - Intronic
1079521085 11:21327795-21327817 GATGGAGATGAGGAACTTGTTGG + Intronic
1079652201 11:22943288-22943310 GATGGAGATGAGGAACTTGTTGG - Intergenic
1079656192 11:22988785-22988807 GATGGAGATGAGGAACTTGTTGG - Intergenic
1079686352 11:23363785-23363807 GATGGAGATGAGGAACTTGTTGG - Intergenic
1079739126 11:24035757-24035779 GATGGAGATGAGGAACTTGTTGG + Intergenic
1079798868 11:24844232-24844254 GATGCAGAAGAGGAACTTGTTGG + Intronic
1079856463 11:25611159-25611181 GATCGAGATGAGGAACTTGTTGG - Intergenic
1079962511 11:26941604-26941626 GATGGAGATGAGGAACTTGTTGG - Intergenic
1080151379 11:29056246-29056268 GATGTAGATGAGGAACTTGTTGG + Intergenic
1080903905 11:36521805-36521827 GATGGAGATGAGGAACTTGTTGG + Intronic
1080946820 11:36982704-36982726 GATGGAGATGAGGAACTTGTTGG - Intergenic
1081108377 11:39100838-39100860 GATGGAGATGAGGAACTTGTTGG - Intergenic
1081108921 11:39107356-39107378 GACCCAGAAGAGGAACTAATGGG - Intergenic
1081224388 11:40502114-40502136 GATGGAGATGAGGAACTAGTTGG - Intronic
1081238824 11:40679066-40679088 GATGGAGATGAGGAACTTGTTGG + Intronic
1081309447 11:41552902-41552924 GATAGAGATGAGGAACTTGTTGG + Intergenic
1081376704 11:42367837-42367859 GATGGAGATGAGGAACTTGTTGG + Intergenic
1081480001 11:43477151-43477173 GATGCAGATGGGGAACTTGTTGG - Intronic
1081939347 11:46927698-46927720 GATGCAGATGAGGAACTTGTTGG + Intergenic
1082229495 11:49745776-49745798 GATGTAGATGAGGAACTTGTTGG - Intergenic
1082766313 11:57170623-57170645 GATGGAGATGAGGAACTTGTTGG - Intergenic
1083034282 11:59622111-59622133 AAGCAAGATTAGGACCTGGTAGG - Intergenic
1083084976 11:60133633-60133655 GATGGAGATGAGGAACTTGTTGG + Intergenic
1083637760 11:64129563-64129585 GAGCCAGGTGCTGAGCTGGTTGG + Intronic
1083977709 11:66137031-66137053 GAGACAAATGACGAAATGGTGGG - Intronic
1084880598 11:72168790-72168812 GATGAAGATGAGGAACTTGTTGG + Intergenic
1084958676 11:72704627-72704649 GCTCCAGATGTGGAACTGGGTGG - Intronic
1085236408 11:75018931-75018953 GATGGAGATGAGGAACTTGTTGG + Intergenic
1085299812 11:75451267-75451289 GAGGCAGGTGAGGAGCTGGAAGG + Intronic
1085647513 11:78235701-78235723 GATGGAGATGAGGAACTTGTTGG - Intronic
1085651441 11:78272389-78272411 GATGGAGATGAGGAACTTGTTGG + Intronic
1085890613 11:80574130-80574152 GACAGAGATGAGGAACTTGTTGG - Intergenic
1085987044 11:81800261-81800283 GATGGAGATGAGGAACTGGTTGG + Intergenic
1086038448 11:82445135-82445157 GAGCCAGAGGAGGAGCTGTTAGG - Intergenic
1086078211 11:82877032-82877054 GACGGAGATGAGGAACTTGTTGG + Intronic
1086084969 11:82944822-82944844 GATGGAGATGAGGAACTTGTTGG - Intronic
1086309245 11:85518342-85518364 GATGGAGATGAGGAACTTGTTGG + Intronic
1086604917 11:88685189-88685211 GATGGAGATGAGGAACTTGTTGG + Intronic
1086620585 11:88883346-88883368 GATGTAGATGAGGAACTTGTTGG + Intronic
1086721653 11:90128527-90128549 GATGGAGATGAGGAACTGGTTGG - Intergenic
1086764242 11:90675242-90675264 GATGGAGATGAGGAACTTGTTGG + Intergenic
1086933910 11:92723338-92723360 GATGGAGATGAGGAACTTGTTGG - Intronic
1086995828 11:93354264-93354286 GATGGAGATGAGGAACTTGTTGG - Intronic
1087075727 11:94125845-94125867 AAGCCAGATGGAGAACTTGTTGG - Intergenic
1087126091 11:94626974-94626996 GATGGAGATGAGGAACTTGTTGG - Intergenic
1087541817 11:99531165-99531187 GATGGAGATGAGGAACTTGTGGG + Intronic
1087571171 11:99929130-99929152 GATGGAGATGAGGAACTTGTTGG - Intronic
1087578707 11:100024637-100024659 GATGGAGATGAGGAACTTGTTGG + Intronic
1087725058 11:101707259-101707281 GATGGAGATGAGGAACTTGTTGG + Intronic
1087731027 11:101778937-101778959 GATGGAGATGAGGAACTTGTTGG + Intronic
1087908699 11:103727841-103727863 GAGGGAGATGAGGAACTTGTTGG - Intergenic
1087932094 11:103989690-103989712 GAAGCAGAAGAGGAACAGGTAGG + Intronic
1088075859 11:105847592-105847614 GAGCCAGATGGTGAAGTGGCAGG + Intronic
1088178609 11:107082796-107082818 GATGGAGATGAGGAACTTGTTGG - Intergenic
1088427039 11:109715389-109715411 GATGAAGATGAGGAACTTGTTGG - Intergenic
1088869763 11:113880592-113880614 GATGCAGATGAGGAACTTGTTGG - Intergenic
1088884513 11:113996514-113996536 GAGCCAGGTGTGGACCTGGCTGG - Intergenic
1089135717 11:116247421-116247443 GAGACAGAAGAGGCCCTGGTAGG + Intergenic
1089285600 11:117405871-117405893 GATGGAGATGAGGAACTTGTTGG - Intronic
1089359655 11:117877265-117877287 GAGCCAGGTGGGGAGCTGGGGGG + Intronic
1089365061 11:117916367-117916389 GGGCCAGATGAAGACCTGGAAGG - Intronic
1089405071 11:118191091-118191113 GATGGAGATGAGGAACTTGTTGG + Intergenic
1089851135 11:121497613-121497635 GAGCCAGATGCCGAAATGGTGGG + Intronic
1090087482 11:123663370-123663392 GATGGAGATGAGGAACTTGTTGG - Intergenic
1090205713 11:124882959-124882981 GAGCCACAGGAGGCACTGGAGGG - Intergenic
1090506598 11:127321466-127321488 GATGGAGATGAGGAACTTGTTGG - Intergenic
1090573078 11:128068859-128068881 GATGGAGATGAGGAACTTGTTGG - Intergenic
1090692496 11:129198955-129198977 GATGGAGATGAGGAACTTGTTGG + Intronic
1090727467 11:129540647-129540669 GATGGAGATGAGGAACTTGTTGG - Intergenic
1091065620 11:132509079-132509101 GATGGAGATGAGGAACTTGTTGG + Intronic
1091350633 11:134891369-134891391 GATGGAGATGAGGAACTTGTTGG + Intergenic
1092106843 12:5927368-5927390 GAGGCAGATGAAGAAGGGGTAGG + Intronic
1092184297 12:6467404-6467426 GATGGAGATGAGGAACTTGTTGG + Intronic
1092272264 12:7032608-7032630 CAGCCAGATGCGGAGCTGGGAGG + Intronic
1092325698 12:7528788-7528810 GATGGAGATGAGGAACTTGTTGG + Intergenic
1092643122 12:10538361-10538383 GATAGAGATGAGGAACTTGTTGG - Intergenic
1093068747 12:14686501-14686523 GAGGCAGAAGAGGGACTGGGAGG + Intronic
1093076083 12:14760270-14760292 GATGGAGATGAGGAACTTGTTGG + Intergenic
1093192660 12:16092565-16092587 GATGGAGATGAGGAACTTGTTGG - Intergenic
1093313290 12:17617964-17617986 GATGGAGATGAGGAACTTGTTGG - Intergenic
1093536746 12:20231535-20231557 GATGGAGATGAGGAACTTGTTGG - Intergenic
1093605041 12:21078860-21078882 GATGGAGATGAGGAACTTGTTGG - Intronic
1093691202 12:22111553-22111575 GAGCAAGATGAGTAACCAGTAGG + Intronic
1093753615 12:22829191-22829213 GATGGAGATGAGGAACTTGTTGG + Intergenic
1094282547 12:28755591-28755613 GATGGAGATGAGGAACTTGTTGG - Intergenic
1094489337 12:30949073-30949095 GATGGAGATGAGGAACTTGTTGG - Intronic
1094705985 12:32914920-32914942 GAAGGAGATGAGGAACTTGTTGG + Intergenic
1094781498 12:33796688-33796710 GATGGAGATGAGGAACTTGTTGG + Intergenic
1095051055 12:37554637-37554659 GAGCCAGATGGAAAAGTGGTGGG + Intergenic
1095300908 12:40582500-40582522 GATAGAGATGAGGAACTTGTTGG - Intergenic
1096123624 12:49104502-49104524 GAGGAAGATGAGGGACAGGTTGG + Exonic
1096441873 12:51650132-51650154 GACAGAGATGAGGAACTTGTTGG - Intronic
1096566011 12:52479897-52479919 GATAAAGATGAGGAACTTGTTGG + Intergenic
1096960334 12:55570657-55570679 GATGGAGATGAAGAACTGGTTGG - Intergenic
1097143717 12:56925297-56925319 GATGCAGATGAGGGCCTGGTGGG - Intronic
1097146484 12:56942860-56942882 GATGGAGATGAGGAACTTGTTGG + Intergenic
1097329695 12:58319299-58319321 GAGAGAGATGAGGAACTTTTTGG - Intergenic
1097368032 12:58741800-58741822 GATGGAGATGAGGAACTTGTTGG + Intronic
1097410938 12:59252447-59252469 GATAGAGATGAGGAACTTGTTGG + Intergenic
1097443895 12:59645874-59645896 GATGGAGATGAGGAACTTGTTGG + Intronic
1097445554 12:59667443-59667465 GATGGAGATGAGGAACTTGTTGG + Intronic
1097476087 12:60057971-60057993 GATGGAGATGAGGAACTGTTGGG + Intergenic
1097609834 12:61806724-61806746 GATGGAGATGAGGAACTTGTTGG + Intronic
1097617989 12:61906785-61906807 GATGGAGATGAGGAACTTGTTGG + Intronic
1097669021 12:62514106-62514128 GATGGAGATGAGGAACTTGTTGG - Intronic
1097735299 12:63175717-63175739 GATGGAGATGAGGAACTTGTTGG + Intergenic
1098145033 12:67489227-67489249 GATGGAGATGAGGAACTTGTTGG - Intergenic
1098238718 12:68443673-68443695 GATGGAGATGAGGAACTTGTTGG - Intergenic
1098493919 12:71112950-71112972 GATGGAGATGAGGAACTTGTTGG - Intronic
1098592393 12:72228900-72228922 GATGGAGATGAGGAACTTGTTGG - Intronic
1098648866 12:72939994-72940016 GATGGAGATGAGGAACTTGTTGG - Intergenic
1098676282 12:73293774-73293796 GATGGAGATGAGGAACTTGTTGG + Intergenic
1098795965 12:74888502-74888524 GATGGAGATGAGGAACTTGTTGG - Intergenic
1098837631 12:75441403-75441425 GATGGAGATGAGGAACTTGTTGG + Intergenic
1098926978 12:76361320-76361342 GATGGAGATGAGGAACTTGTTGG - Intronic
1099004021 12:77215956-77215978 GATGGAGATGAGGAACTTGTTGG + Intergenic
1099076392 12:78114108-78114130 GATGGAGATGAGGAACTTGTTGG - Intronic
1099088555 12:78277758-78277780 GAGGGAGATGAGGAACTTGTTGG + Intergenic
1099384489 12:81998061-81998083 GATGAAGATGATGAACTGGTTGG - Intergenic
1099390236 12:82070493-82070515 GATTGAGATGAGGAACTTGTTGG - Intergenic
1099396436 12:82146491-82146513 GATGGAGATGAGGAACTTGTTGG + Intergenic
1099467181 12:83001794-83001816 GATGGAGATGAGGAACTTGTTGG - Intronic
1099655161 12:85479870-85479892 GAGGGAGATGAGGAACTTTTTGG - Intergenic
1099663559 12:85597198-85597220 GATAAAGATGAGGAACTTGTTGG - Intergenic
1099668287 12:85658901-85658923 GATGGAGATGAGGAACTTGTTGG + Intergenic
1099707776 12:86179577-86179599 GATGTAGATGAGGAACTTGTTGG + Intronic
1099722476 12:86382218-86382240 GATGGAGATGAGGAACTTGTTGG + Intronic
1099800485 12:87451150-87451172 GATGGAGATGAGGAACTGTTGGG + Intergenic
1099846257 12:88031800-88031822 GACAGAGATGAGGAACTTGTTGG - Intronic
1099858860 12:88204440-88204462 GATGGAGATGAGGAACTTGTTGG + Intergenic
1100038387 12:90281290-90281312 GATGGAGATGAGGAACTTGTTGG + Intergenic
1100658048 12:96668011-96668033 GATGGAGATGAGGAACTTGTTGG - Intronic
1100714213 12:97289110-97289132 GATGAAGATGAGGAACTTGTGGG - Intergenic
1100933578 12:99638402-99638424 GATGGAGATGAGGAACTTGTTGG + Intronic
1100971851 12:100079366-100079388 GATGGAGATGAGGAACTTGTTGG + Intronic
1101113180 12:101506171-101506193 GATGGAGATGAGGAACTTGTTGG + Intergenic
1101190366 12:102326232-102326254 GATGGAGATGAGGAACTTGTTGG + Intergenic
1101222856 12:102658679-102658701 GATGGAGATGAGGAACTTGTTGG - Intergenic
1101358930 12:104008292-104008314 GATGTAGATGAGGAACTTGTTGG + Intronic
1101712592 12:107282322-107282344 GATAGAGATGAGGAACTTGTTGG - Intergenic
1101878970 12:108613707-108613729 GAGCCAGAAGCAGAACTGGGGGG - Intergenic
1102523091 12:113491555-113491577 GATGGAGATGAGGAACTTGTTGG + Intergenic
1102620216 12:114188670-114188692 GAGAAAGAAGAGGAACTTGTGGG + Intergenic
1102668800 12:114599861-114599883 GATGGAGATGAGGAACTTGTTGG + Intergenic
1103173817 12:118844482-118844504 GAACCAGATGTGGAACTGCGAGG - Intergenic
1103588301 12:121972344-121972366 GATGGAGATGAGGAACTTGTTGG + Intronic
1103641031 12:122352611-122352633 CAGCCAGCTGAGGAAGTGGCGGG - Intronic
1104079932 12:125421001-125421023 GATGGAGATGAGGAACTTGTTGG - Intronic
1104367507 12:128191408-128191430 GAGCAAGAGGAGGAAGTGGAGGG - Intergenic
1104421182 12:128636790-128636812 GAGGCAGAGAAGGAAATGGTGGG - Intronic
1104603342 12:130168649-130168671 GACCCAGAACAGGAACTGGGTGG + Intergenic
1104830090 12:131744479-131744501 GATGGAGATGAGGAACTTGTTGG - Intronic
1105235874 13:18553187-18553209 GATGGAGATGAGGAACTTGTTGG + Intergenic
1105286419 13:19008253-19008275 AGTCCAGATGAGGAACTGGGAGG - Intergenic
1105530163 13:21211898-21211920 GATGGAGATGAGGAACTTGTTGG + Intergenic
1105608272 13:21945209-21945231 GATGAAGATGAGGAACTTGTTGG - Intergenic
1105694051 13:22871024-22871046 GATGGAGATGAGGAACTTGTTGG + Intergenic
1106262444 13:28079268-28079290 GATGGAGATGAGGAACTTGTTGG - Intronic
1106631653 13:31480343-31480365 GATAGAGATGAGGAACTTGTTGG - Intergenic
1106871608 13:34027835-34027857 GAGTTACATTAGGAACTGGTAGG - Intergenic
1106929750 13:34651523-34651545 GATGGAGATGAGGAACTTGTTGG + Intergenic
1107554830 13:41508412-41508434 GATGGAGATGAGGAACTTGTTGG - Intergenic
1108155983 13:47584928-47584950 GATGGAGATGAGGAACTCGTTGG - Intergenic
1108277626 13:48827039-48827061 GATGGAGATGAGGAACTTGTTGG - Intergenic
1108419381 13:50233299-50233321 GATGGAGATGAGGAACTTGTTGG + Intronic
1108936868 13:55892104-55892126 GATGAAGATGAGGAACTCGTTGG - Intergenic
1108971551 13:56382152-56382174 GATGGAGATGAGGAACTTGTTGG - Intergenic
1109076853 13:57846577-57846599 GATGGAGATGAGGAACTTGTTGG - Intergenic
1109102154 13:58199125-58199147 GATGGAGATGAGGAACTTGTTGG + Intergenic
1109171836 13:59107011-59107033 GATGGAGATGAGGAACTTGTTGG + Intergenic
1109221639 13:59646307-59646329 GATGGAGATGAGGAACTTGTTGG + Intergenic
1109276253 13:60307138-60307160 GATGGAGATGAGGAACTTGTCGG - Intergenic
1109334027 13:60970527-60970549 GATGGAGATGAGGAACTTGTTGG + Intergenic
1109337090 13:61007456-61007478 GATGGAGATGAGGAACTTGTTGG + Intergenic
1109344589 13:61099517-61099539 GATAGAGATGAGGAACTTGTTGG + Intergenic
1109347032 13:61126496-61126518 GACAGAGATGAGGAACTTGTTGG - Intergenic
1109485322 13:63010768-63010790 GAGGGAGATGAGGAACTTATTGG - Intergenic
1109496326 13:63177441-63177463 GATGGAGATGAGGAACTTGTTGG + Intergenic
1109526381 13:63581061-63581083 GATGGAGATGAGGAACTTGTTGG - Intergenic
1109614077 13:64808229-64808251 GATAGAGATGAGGAACTTGTTGG + Intergenic
1109641890 13:65202259-65202281 GATGGAGATGAGGAACTTGTTGG + Intergenic
1109667668 13:65559799-65559821 GAGAGAGATGAGGAACTTGTTGG - Intergenic
1109718282 13:66245536-66245558 GATAGAGATGAGGAACTTGTTGG + Intergenic
1109749503 13:66671567-66671589 GATGGAGATGAGGAACTTGTTGG + Intronic
1109863081 13:68225590-68225612 GATGGAGATGAGGAACTTGTTGG - Intergenic
1109883376 13:68511178-68511200 GATGGAGATGAGGAACTTGTTGG + Intergenic
1110028196 13:70570150-70570172 GACGGAGATGAGGAACTTGTTGG + Intergenic
1110057016 13:70986144-70986166 GATGGAGATGAGGAACTTGTTGG - Intergenic
1110062752 13:71063028-71063050 GATAGAGATGAGGAACTTGTTGG - Intergenic
1110250761 13:73377889-73377911 GATGGAGATGAGGAACTTGTTGG - Intergenic
1110492296 13:76123964-76123986 GATGGAGATGAGAAACTGGTTGG + Intergenic
1110499088 13:76205004-76205026 GAACCAGATGTGTAACTTGTAGG - Intergenic
1110566314 13:76960594-76960616 GATGGAGATGAGGAACTTGTTGG - Intergenic
1110649494 13:77926519-77926541 GATGGAGATGAGGAACTTGTTGG - Intergenic
1110740655 13:78991953-78991975 GATGGAGATGAGGAACTTGTTGG - Intergenic
1110806214 13:79757222-79757244 GATGGAGATGAGGAACTTGTTGG - Intergenic
1110924261 13:81131034-81131056 GATGGAGATGAGGAACTTGTTGG + Intergenic
1110926951 13:81165247-81165269 GATGGAGATGAGGAACTTGTTGG - Intergenic
1110979982 13:81885161-81885183 GATGGAGATGAGGAACTTGTTGG - Intergenic
1111221250 13:85207891-85207913 GAGGGAGATGAGGAACTTCTTGG + Intergenic
1111307450 13:86434026-86434048 GATGGAGATGAGGAACTTGTTGG + Intergenic
1111336917 13:86837160-86837182 GATGGAGATGAGGAACTTGTTGG - Intergenic
1111403393 13:87770030-87770052 GATGCAGATGAGGAACTTGTTGG - Intergenic
1111457648 13:88505929-88505951 TAGTGAGATGAGGAACTTGTTGG + Intergenic
1111459351 13:88519445-88519467 GATGGAGATGAGGAACTTGTTGG + Intergenic
1111527697 13:89493089-89493111 GATGGAGATGAGGAACTTGTTGG - Intergenic
1111566753 13:90027126-90027148 GATGGAGATGAGGAACTTGTTGG + Intergenic
1111614984 13:90651783-90651805 GATGGAGATGAGGAACTTGTTGG + Intergenic
1112101943 13:96198669-96198691 GATGGAGATGAGGAACTTGTTGG - Intronic
1112163125 13:96889692-96889714 GATGGAGATGAGGAACTTGTTGG - Intergenic
1112701774 13:102018411-102018433 GAGCCAGAGGAGGAAGAGGAAGG - Intronic
1112825118 13:103383024-103383046 GATGGAGATGAGGAACTTGTTGG - Intergenic
1112887532 13:104192930-104192952 GATGGAGATGAGGAACTTGTTGG + Intergenic
1112995856 13:105574685-105574707 GATGAAGATGAGGAACTTGTTGG + Intergenic
1113264806 13:108605982-108606004 GATGCAGATGAGGAACTTCTTGG + Intronic
1113284859 13:108835702-108835724 GATGGAGATGAGGAACTTGTTGG + Intronic
1114118618 14:19646562-19646584 GGGCATGATGAAGAACTGGTTGG - Intergenic
1114680553 14:24480602-24480624 GATGGAGATGAGGAACTTGTTGG - Intergenic
1114778810 14:25515671-25515693 GATGGAGATGAGGAACTTGTTGG - Intergenic
1114798012 14:25739250-25739272 GTGTCATGTGAGGAACTGGTGGG - Intergenic
1114812445 14:25916739-25916761 GATGAAGATGAGGAACTTGTTGG + Intergenic
1114917876 14:27289642-27289664 GATGGAGATGAGGAACTTGTTGG - Intergenic
1115085862 14:29513890-29513912 GATGGAGATGAGGAACTTGTTGG - Intergenic
1115090465 14:29568186-29568208 GAGTGAGATGAGAAACTTGTTGG - Intergenic
1115115807 14:29879772-29879794 GATGGAGATGAGGAACTTGTTGG + Intronic
1115132610 14:30072216-30072238 GATGGAGATGAGGAACTTGTTGG + Intronic
1115199204 14:30834994-30835016 GATGGAGATGAGGAACTTGTTGG - Intergenic
1115482437 14:33874639-33874661 GATGGAGATGAGGAACTTGTTGG - Intergenic
1115878698 14:37891272-37891294 GATGGAGATGAGGAACTTGTTGG + Intronic
1115891559 14:38035441-38035463 GAGGGAGATGAGGGAATGGTTGG + Intronic
1115968300 14:38916454-38916476 GATAGAGATGAGGAACTTGTTGG - Intergenic
1116127129 14:40801666-40801688 GATGGAGATGAGGAACTTGTTGG - Intergenic
1116164049 14:41311011-41311033 GATGGAGATGAGGAACTGTTGGG + Intergenic
1116235301 14:42272196-42272218 GATGGAGATGAGGAACTTGTTGG + Intergenic
1116281625 14:42915447-42915469 GATGGAGATGAGGAACTTGTTGG - Intergenic
1116389707 14:44377645-44377667 GATGGAGATGAGGAACTGGTTGG - Intergenic
1116429573 14:44830405-44830427 GAGCCAGATGAGAAAAGGGTTGG - Intergenic
1116590195 14:46761838-46761860 GATGGAGATGAGGAACTTGTTGG - Intergenic
1116625176 14:47254477-47254499 GATGAAGATGAGGAACTTGTTGG - Intronic
1116693977 14:48149390-48149412 GAGGGAGATGAGGAACTTATTGG + Intergenic
1116714231 14:48407615-48407637 GATGGAGATGAGGAACTTGTTGG - Intergenic
1116784042 14:49268291-49268313 GATGGAGATGAGGAACTCGTTGG + Intergenic
1116854103 14:49936903-49936925 GATGGAGATGAAGAACTGGTTGG + Intergenic
1117186154 14:53242864-53242886 GATGGAGATGAGGAACTTGTTGG + Intergenic
1117198599 14:53364891-53364913 GATGGAGATGAGGAACTTGTTGG - Intergenic
1117751762 14:58930788-58930810 GATGGAGATGAGGAACTTGTTGG - Intergenic
1118037471 14:61883476-61883498 GATGGAGATGAGGAACTTGTTGG - Intergenic
1118128793 14:62939062-62939084 GAGCCACATGGGGAACTCATGGG - Intronic
1118239518 14:64043047-64043069 GATGGAGATGAGGAACTTGTTGG + Intronic
1118402949 14:65396055-65396077 GATGGAGATGAGGAACTTGTGGG - Intergenic
1118431978 14:65728006-65728028 GATGGAGATGAGGAACTTGTTGG - Intronic
1118836052 14:69478686-69478708 GATGGAGATGAGGAACTTGTTGG - Intergenic
1118933356 14:70263615-70263637 GATGGAGATGAGGAACTTGTTGG + Intergenic
1119963033 14:78881464-78881486 GATGGAGATGAGGAACTTGTTGG + Intronic
1120091219 14:80334938-80334960 GATGGAGATGAGGAACTTGTTGG - Intronic
1120152629 14:81054599-81054621 GATGGAGATGAGGAACTTGTTGG + Intronic
1120270581 14:82309009-82309031 GATGCAGATGAGAAACTTGTTGG + Intergenic
1120392726 14:83929202-83929224 GACGGAGATGAGGAACTTGTTGG + Intergenic
1120457697 14:84753910-84753932 GATAGAGATGAGGAACTTGTTGG + Intergenic
1120570913 14:86115981-86116003 GATGGAGATGAGGAACTTGTTGG + Intergenic
1120582683 14:86272566-86272588 GATGCAGATGAGGGACTTGTTGG - Intergenic
1120621849 14:86774698-86774720 GATGAAGATGAGGAACTTGTTGG + Intergenic
1120799867 14:88675949-88675971 GATGGAGATGAGGAACTTGTTGG - Intronic
1121128701 14:91426260-91426282 GATGCAGATTAGGAACTTGTTGG + Intergenic
1121483918 14:94298983-94299005 TATCGAGATGAGGAACTTGTTGG - Intergenic
1121489691 14:94348966-94348988 GAGCCAGGGGAGGAAAGGGTGGG - Intergenic
1122490168 14:102109890-102109912 GATGGAGATGAGGAACTTGTTGG + Intronic
1122756404 14:103983924-103983946 GATGGAGATGAGGAACTTGTTGG + Intronic
1123628789 15:22246429-22246451 GATTGAGATGAGGAACTTGTTGG + Intergenic
1123795509 15:23766534-23766556 GATGGAGATGAGGAACTTGTTGG + Intergenic
1124217269 15:27817667-27817689 GCGCCAAATGAGGAGCTGGGAGG - Intronic
1124461537 15:29896714-29896736 GATGGAGATGAGGAACTTGTTGG + Intronic
1124556150 15:30727764-30727786 GATGAAGATGAGGAACTCGTTGG - Intronic
1124675120 15:31678006-31678028 GATGGAGATGAGGAACTTGTTGG + Intronic
1124695913 15:31864084-31864106 GATGGAGATGAGGAACTTGTTGG - Intronic
1125153540 15:36561407-36561429 GATGGAGATGAGGAACTTGTTGG + Intergenic
1125231591 15:37462995-37463017 GATGAAGATGAGGAACTTGTTGG - Intergenic
1125274057 15:37971806-37971828 GATGGAGATGAGGAACTTGTTGG - Intergenic
1125304302 15:38292206-38292228 GATGGAGATGAGGAACTTGTTGG - Intronic
1125472181 15:40015016-40015038 GATGGAGATGAGGAACTTGTTGG - Intronic
1126126263 15:45297205-45297227 GATAGAGATGAGGAACTCGTTGG + Intergenic
1126185167 15:45824388-45824410 GATGGAGATGAGGAACTTGTTGG - Intergenic
1126647918 15:50893745-50893767 GATAGAGATGAGGAACTTGTTGG + Intergenic
1126942173 15:53779280-53779302 GATGGAGATGAGGAACTTGTTGG - Intergenic
1127145081 15:56015301-56015323 GATGGAGATGAGGAACTTGTTGG - Intergenic
1127964213 15:63911903-63911925 AGGCCGGATGAGGACCTGGTGGG - Exonic
1128813900 15:70591736-70591758 GATGAAGATGAGGAACTTGTTGG + Intergenic
1129194488 15:73955904-73955926 GAGCCAGCAGAGGCACTGCTAGG + Intergenic
1129900549 15:79144909-79144931 GATGGAGATGAGGAACTTGTTGG - Intergenic
1130422115 15:83757928-83757950 GATAGAGATGAGGAACTTGTTGG - Intronic
1131155558 15:90073165-90073187 GAAGCAGATGTGGCACTGGTAGG - Exonic
1131338605 15:91573962-91573984 CTGCAAGATGAGGAACTGGTTGG + Intergenic
1131556400 15:93403677-93403699 GATGGAGATGAGGAACTTGTTGG + Intergenic
1131574468 15:93572658-93572680 GAGCCAGAGGAGAAACAGGGTGG - Intergenic
1131974849 15:97934185-97934207 GATGGAGATGAGGAACTTGTTGG - Intergenic
1132122718 15:99191944-99191966 GATGGAGATGAGGAACTTGTTGG + Intronic
1132150099 15:99453029-99453051 GAGCCACATGAGGAAGTGCTGGG - Intergenic
1132194184 15:99897849-99897871 GATAGAGATGAGGAACTTGTTGG - Intergenic
1132702181 16:1226622-1226644 GAGCCAACTGAGGAACCGGGAGG + Intergenic
1132706136 16:1244246-1244268 GAGCCAACTGAGGAACCGGGAGG - Intergenic
1134222039 16:12362571-12362593 GAGCATGAGGAGAAACTGGTGGG - Intronic
1134848663 16:17462314-17462336 CTGCCAGATGAGGAAGGGGTGGG - Intronic
1135244996 16:20847935-20847957 AAGCCAGAGGAGGAAGTGCTGGG + Intronic
1135636874 16:24085115-24085137 GAAACAGTTGAGGAACTGGAGGG + Intronic
1135919117 16:26632422-26632444 GATGGAGATGAGGAACTTGTTGG - Intergenic
1137265935 16:46869032-46869054 GATGGAGATGAGGAACTTGTTGG - Intergenic
1137382248 16:48010307-48010329 GAGCCATATGAAGAGTTGGTGGG + Intergenic
1137731773 16:50695016-50695038 GAGCCACATGAGTATCTGGGGGG + Intronic
1137818666 16:51422913-51422935 GATGGAGATGAGGAACTTGTTGG - Intergenic
1138805809 16:60087001-60087023 GAGAGAGATGAGGAACTTATTGG - Intergenic
1140639634 16:76957215-76957237 GAGCCAAATGTGCAACTTGTAGG + Intergenic
1140871790 16:79113382-79113404 ACGACAGATGAGGATCTGGTGGG - Intronic
1140882609 16:79212283-79212305 GAGCCAGCTTAGCAACTGCTGGG + Exonic
1140930650 16:79624730-79624752 GAGCCAGTGGAGGTGCTGGTGGG - Intergenic
1142281276 16:89149113-89149135 GAGGGAGATGAGGAACTTATTGG - Intronic
1142300581 16:89255609-89255631 GAACCAGATGACGAAGTGCTGGG - Intergenic
1142303222 16:89270850-89270872 GAGCCAGGAGATGAACTGGCGGG + Exonic
1142327519 16:89425812-89425834 GAGCCTGAGGAGGAACTAGAAGG + Intronic
1143210933 17:5186858-5186880 GATGGAGATGAGGAACTTGTCGG - Intronic
1144299403 17:13909571-13909593 GATGGAGATGAGGAACTTGTTGG + Intergenic
1146098274 17:29953906-29953928 GATGGAGATGAGGAACTTGTTGG + Intronic
1146626190 17:34437280-34437302 GAGCCACATGAGCAGGTGGTGGG + Intergenic
1147348689 17:39823198-39823220 GATGGAGATGAGGAACTGCTTGG + Intronic
1149101152 17:52908644-52908666 GATGGAGATGAGGAACTTGTTGG + Intergenic
1149110304 17:53020011-53020033 GATGGAGATGAGGAACTTGTTGG - Intergenic
1149135480 17:53358981-53359003 GAGGGAGATGAGGAACTTTTTGG + Intergenic
1149190130 17:54051067-54051089 GATAGAGATGAGGAACTTGTTGG - Intergenic
1149192598 17:54082189-54082211 GATGGAGATGAGGAACTTGTTGG - Intergenic
1149386424 17:56147101-56147123 GATGGAGATGAGGAACTTGTTGG - Intronic
1149902245 17:60491204-60491226 GATGGAGATGAGGAACTTGTTGG + Intronic
1150214576 17:63459565-63459587 GAGTGAGAAGAGGAACTGGCGGG + Intergenic
1150941551 17:69698968-69698990 GATGGAGATGAGGAACTTGTTGG - Intergenic
1151135745 17:71944481-71944503 GATGGAGATGAGGAACTTGTTGG + Intergenic
1151242816 17:72771465-72771487 GACCCAGAGGAGGAAATGGGGGG + Intronic
1151629549 17:75301237-75301259 GAGGCAGATGAGGATGTGGAAGG - Intergenic
1152148301 17:78582706-78582728 GAGACAGATGAGGAAAGGATTGG - Intergenic
1152361578 17:79835475-79835497 GAGGCAGCTGCGGACCTGGTGGG - Intronic
1152629043 17:81401606-81401628 CAGCCAGAAGAGGGGCTGGTGGG - Intronic
1152967538 18:130588-130610 GATGGAGATGAGGAACTTGTTGG - Intergenic
1153076365 18:1165941-1165963 GATGGAGATGAGGAACTTGTTGG - Intergenic
1153136826 18:1926924-1926946 GATGGAGATGAGGAACTTGTTGG + Intergenic
1153262800 18:3240857-3240879 GATGGAGATGAGGAACTTGTTGG + Intergenic
1153426957 18:4975524-4975546 GATGTAGATGAGGAACTTGTTGG - Intergenic
1153539165 18:6135651-6135673 GATGGAGATGAGGAACTTGTTGG - Intronic
1153845993 18:9050403-9050425 GATAGAGATGAGGAACTTGTTGG + Intergenic
1154049682 18:10942404-10942426 GATGTAGATGAGGAACTTGTTGG + Intronic
1154313240 18:13283529-13283551 GACAGAGATGAGGAACTTGTTGG - Intronic
1154404305 18:14074654-14074676 GATGGAGATGAGGAACTTGTTGG - Intronic
1154471796 18:14710458-14710480 GAAACTGATGAGCAACTGGTGGG - Intergenic
1154504495 18:15021703-15021725 GATGGAGATGAGGAACTTGTTGG - Intergenic
1154513669 18:15136811-15136833 GATAGAGATGAGGAACTTGTTGG - Intergenic
1154926445 18:20941461-20941483 GATGGAGATGAGGAACTTGTTGG + Intergenic
1155171446 18:23269727-23269749 GATGGAGATGAGGAACTTGTTGG + Intronic
1155286448 18:24293698-24293720 GAGCCAGAAAGGGAACTGGGAGG + Intronic
1155632220 18:27906829-27906851 GATGGAGATGAGGAACTTGTTGG - Intergenic
1155679584 18:28473526-28473548 GAGGGAGATGAGGAACTTGTTGG + Intergenic
1155988199 18:32253039-32253061 GATGGAGATGAGGAACTTGTTGG - Intronic
1156344360 18:36242314-36242336 GATAGAGATGAGGAACTTGTGGG - Intronic
1156784328 18:40892453-40892475 GACGGAGATGAGGAACTTGTTGG + Intergenic
1157377728 18:47181788-47181810 GATAAAGATGAGGAACTTGTTGG + Intergenic
1157408730 18:47446083-47446105 GATGGAGATGAGGAACTTGTTGG + Intergenic
1157941033 18:51929474-51929496 GATGGAGATGAGGAACTTGTTGG + Intergenic
1158166476 18:54546770-54546792 GATGGAGATGAGGAACTTGTTGG + Intergenic
1159083346 18:63760185-63760207 GATGGAGATGAGGAACTTGTTGG + Intronic
1159196372 18:65121851-65121873 GATGGAGATGAGGAACTTGTTGG + Intergenic
1159261380 18:66016886-66016908 GATGGAGATGAGGAACTTGTTGG - Intergenic
1159410780 18:68072484-68072506 GATGGAGATGAGGAACTTGTTGG + Intergenic
1159481388 18:68995053-68995075 GACGGAGATGAGGAACTTGTTGG + Intronic
1159640564 18:70858947-70858969 GAAGGAGATGAGGAAGTGGTTGG + Intergenic
1159650479 18:70971787-70971809 GATGGAGATGAGGAACTTGTTGG - Intergenic
1159717889 18:71848702-71848724 GATGGAGATGAGGAACTTGTTGG + Intergenic
1159718870 18:71859744-71859766 GATGGAGATGAGGAACTTGTGGG - Intergenic
1159731713 18:72035295-72035317 GATGGAGATGAGGAACTTGTTGG - Intergenic
1159838735 18:73372068-73372090 GATGGAGATGAGGAACTTGTTGG + Intergenic
1160096371 18:75877272-75877294 GATGGAGATGAGGAACTTGTTGG + Intergenic
1160320946 18:77894279-77894301 GTGAGAGATGAGGAACTGGGGGG + Intergenic
1161313516 19:3607480-3607502 GAGCCAGAGGAGGAACAGTCTGG + Intergenic
1161366380 19:3882026-3882048 CAGCCAGATGAGGAAGTGGGGGG - Intronic
1162404892 19:10467677-10467699 GAGGCAGAGGAGGAGGTGGTCGG - Exonic
1162596406 19:11632988-11633010 GATGGAGATGAGGAACTTGTTGG + Intergenic
1162606571 19:11713170-11713192 CAGCACGATGAGGAACCGGTAGG - Intergenic
1164050867 19:21585204-21585226 CAGCCAGGTGAGGGACTGGTTGG + Intergenic
1164286447 19:23821598-23821620 GAGCCAGATGCCGACCTGATCGG - Intronic
1164447322 19:28329186-28329208 GATGCAGATGAGGAACTTGTGGG + Intergenic
1164541542 19:29125120-29125142 GATGGAGATGAGGAACTTGTTGG - Intergenic
1164549695 19:29198927-29198949 GTGTCAGAAGAGGAACTGCTGGG + Intergenic
1164672822 19:30082593-30082615 GAGCCAGCAGAGGAGGTGGTAGG + Intergenic
1165248320 19:34510870-34510892 GATGGAGATGAGGAACTTGTTGG - Exonic
1165913750 19:39245395-39245417 GAGCCAGATGAGCAGCTGGAGGG + Intergenic
1165917211 19:39268229-39268251 GAGCCAGATGAGCAGCTGGAGGG - Intergenic
1165974854 19:39666722-39666744 GACGGAGATGAGGAACTTGTTGG - Intergenic
1167403393 19:49287982-49288004 GATGGAGATGAGGAACTTGTTGG + Intergenic
1167693197 19:50999950-50999972 GAGGGAGAGGAGGAGCTGGTTGG - Intronic
1168355543 19:55697526-55697548 TTGCCAAATGAGGAAATGGTGGG - Intronic
1168560047 19:57374783-57374805 GATGGAGATGAGGAACTTGTTGG - Intronic
925245519 2:2379193-2379215 GAGGAAGATGAGGAACTTGTTGG + Intergenic
925291860 2:2753209-2753231 GATAGAGATGAGGAACTTGTTGG + Intergenic
925560120 2:5182623-5182645 GATGAAGATGAGGAACTTGTTGG + Intergenic
925815658 2:7745791-7745813 GAGTAACATGAGGAATTGGTAGG - Intergenic
926043239 2:9691505-9691527 AAGCCAGGTGAGGCAATGGTGGG - Intergenic
926181967 2:10652638-10652660 GAGCCAGCTGAGAAACCGGATGG - Intronic
926431117 2:12786547-12786569 GATGGAGATGAGGAACTTGTTGG - Intergenic
926456593 2:13074681-13074703 GATGGAGATGAGGAACTTGTTGG - Intergenic
926468068 2:13215720-13215742 GATGGAGATGAGGAACTTGTTGG - Intergenic
926502540 2:13673838-13673860 GATGGAGATGAGGAACTTGTTGG - Intergenic
926647419 2:15304653-15304675 GACGGAGATGAGGAACTTGTTGG + Intronic
926734692 2:16064009-16064031 GACGGAGATGAGGAACTTGTTGG - Intergenic
926870148 2:17407355-17407377 GACGGAGATGAGGAACTTGTTGG + Intergenic
926947359 2:18202926-18202948 GATGGAGATGAGGAACTTGTTGG + Intronic
926952047 2:18253552-18253574 GATGGAGATGAGGAACTTGTTGG + Intronic
926986730 2:18632507-18632529 GATGAAGATGAGGAACTCGTTGG + Intergenic
927389735 2:22581949-22581971 GATGGAGATGAGGAACTTGTTGG + Intergenic
927401971 2:22721949-22721971 GATGGAGATGAGGAACTTGTTGG - Intergenic
927605530 2:24483317-24483339 GATGGAGATGAGGAACTTGTTGG + Intergenic
928267429 2:29823549-29823571 GATGGAGATGAGGAACTTGTTGG + Intronic
928377502 2:30787639-30787661 CTGCCAGGTGAAGAACTGGTAGG + Intronic
928397463 2:30954004-30954026 AACCCAGAAGAGGAAATGGTGGG + Intronic
928582909 2:32726503-32726525 GATGGAGATGAGGAACTTGTTGG - Intronic
928609841 2:32982177-32982199 GATAGAGATGAGGAACTTGTTGG + Intronic
928680219 2:33693680-33693702 GATGGAGATGAGGAACTTGTTGG - Intergenic
928808815 2:35197745-35197767 GATGGAGATGAGGAACTTGTTGG + Intergenic
928842892 2:35632411-35632433 GATGGAGATGAGGAACTGGTTGG - Intergenic
928853752 2:35780712-35780734 GATGGAGATGAGGAACTTGTTGG + Intergenic
929253494 2:39783432-39783454 GAGGCAGAAGTGGAACTGCTGGG + Intergenic
929612692 2:43283536-43283558 GATGCAGATGAGGAACTTATTGG + Intronic
929782749 2:44967811-44967833 CATACAGATGGGGAACTGGTGGG + Intergenic
930006700 2:46903574-46903596 GATGAAGATGAGGAACTTGTTGG + Exonic
930076066 2:47406656-47406678 GATGGAGATGAGGAACTTGTTGG + Intronic
930254821 2:49077850-49077872 GATGGAGATGAGGAACTTGTTGG - Intronic
930484759 2:51998280-51998302 GATGGAGATGAGGAACTTGTTGG + Intergenic
931734537 2:65181906-65181928 GATGGAGATGAGGAACTTGTTGG + Intergenic
931903324 2:66815510-66815532 GAAGCAGATGAGGAACTTATTGG + Intergenic
931983682 2:67721343-67721365 GATATAGATGAGGAACTTGTTGG + Intergenic
932068198 2:68589191-68589213 GAGCCAGTGTAGGAAGTGGTGGG - Intronic
932502644 2:72197425-72197447 GAGGCTGAAGAGGAAGTGGTGGG + Intronic
932625170 2:73291670-73291692 GAGGCAGATGCGGCACTGGAAGG + Exonic
932821720 2:74907060-74907082 GATGGAGATGAGGAACTTGTTGG - Intergenic
932847491 2:75150894-75150916 GATGGAGATGAGGAACTTGTTGG + Intronic
932960561 2:76408258-76408280 GATAGAGATGAGGAACTTGTTGG + Intergenic
933064255 2:77773689-77773711 GATGAAGATGAGGAACTTGTTGG - Intergenic
933181213 2:79229820-79229842 GAGAGAAATGAGGAACTTGTTGG + Intronic
933354225 2:81194548-81194570 GAGCCAGGAGATGAACTGGCTGG + Intergenic
933397969 2:81755474-81755496 GATGGAGATGAGGAACTTGTTGG - Intergenic
933454270 2:82501629-82501651 GATGGAGATGAGGAACTTGTTGG + Intergenic
933578181 2:84093444-84093466 GATGGAGATGAGGAACTTGTTGG - Intergenic
933790670 2:85881529-85881551 GATGGAGATGAGGAACTTGTTGG + Intronic
934112929 2:88759113-88759135 GATGGAGATGAGGAACTTGTTGG + Intergenic
934144072 2:89074696-89074718 GATGAAGATGAGGAACTTGTTGG + Intergenic
934225173 2:90125856-90125878 GATGAAGATGAGGAACTTGTTGG - Intergenic
934610677 2:95733013-95733035 GATGGAGATGAGGAACTTGTTGG - Intergenic
935323125 2:101907633-101907655 GATGGAGATGAGGAACTTGTTGG - Intergenic
935436890 2:103045106-103045128 GATGGAGATGATGAACTGGTTGG + Intergenic
935448793 2:103186652-103186674 GATGGAGATGAGGAACTTGTTGG + Intergenic
935497175 2:103795160-103795182 GATGGAGATGAGGAACTTGTTGG - Intergenic
935626063 2:105173187-105173209 GATGGAGATGAGGAACTTGTTGG - Intergenic
935948865 2:108311228-108311250 GATGGAGATGAGGAACTTGTTGG + Intergenic
936169291 2:110154599-110154621 GATGGAGATGAGGAACTTGTTGG + Intronic
936499634 2:113055832-113055854 GATGGAGATGAGGAACTTGTTGG - Intergenic
936792218 2:116163967-116163989 GATGGAGATGAGGAACTTGTTGG + Intergenic
936831901 2:116656663-116656685 GATGGAGATGAGGAACTTGTTGG - Intergenic
936890763 2:117367038-117367060 GATGGAGATGAGGAACTTGTTGG - Intergenic
936909498 2:117575655-117575677 GATGGAGATGAGGAACTTGTTGG - Intergenic
937547219 2:123036955-123036977 GATGGAGATGAGGAACTTGTTGG - Intergenic
937561082 2:123224428-123224450 GATGGAGATGAGGAACTTGTTGG - Intergenic
937640319 2:124204271-124204293 GATGAAGATGAGGAACTTGTTGG - Intronic
937762454 2:125622316-125622338 GAGGAAGATGAGGAACTTGTTGG + Intergenic
937935156 2:127238144-127238166 GATGGAGATGAGGAACTTGTTGG + Intergenic
938417348 2:131114730-131114752 GATGGAGATGAGGAACTAGTTGG - Intronic
938503682 2:131851907-131851929 GATGGAGATGAGGAACTTGTTGG - Intergenic
938513909 2:131981422-131981444 GATGGAGATGAGGAACTTGTTGG - Intergenic
938698074 2:133852655-133852677 GATGGAGATGAGGAACTTGTTGG + Intergenic
938868943 2:135453663-135453685 GATGGAGATGAGGAACTTGTTGG - Intronic
939079097 2:137638735-137638757 GATGGAGATGAGGAACTTGTTGG + Intronic
939137717 2:138316253-138316275 GATGGAGATGAGGAACTTGTTGG - Intergenic
939272528 2:139959319-139959341 GATGCAGATGAGGAACTTGTTGG + Intergenic
939498368 2:142950084-142950106 GATGGAGATGAGGAACTTGTTGG - Intronic
939605766 2:144253545-144253567 GATGGAGATGAGGAACTTGTTGG + Intronic
940143690 2:150523175-150523197 GATGGAGATGAGGAACTTGTTGG + Intronic
940386947 2:153085040-153085062 GACGGAGATGAGGAACTTGTGGG + Intergenic
940408703 2:153335442-153335464 GATGGAGATGAGGAACTTGTTGG + Intergenic
940444673 2:153764080-153764102 GATGAAGATGAGGAACTTGTTGG + Intergenic
940450451 2:153829014-153829036 GATGGAGATGAGGAACTTGTTGG - Intergenic
940547251 2:155103096-155103118 GATGGAGATGAGGAACTTGTTGG - Intergenic
940621651 2:156121040-156121062 GATGGAGATGAGGAACTTGTTGG + Intergenic
940728345 2:157361404-157361426 GATGGAGATGAGGAACTTGTTGG + Intergenic
941123647 2:161561029-161561051 GATGGAGATGAGGAACTTGTTGG + Intronic
941289892 2:163662173-163662195 GAAGGAGATGAGGAACTTGTTGG + Intronic
941536069 2:166723484-166723506 GATGGAGATGAGGAACTTGTTGG - Intergenic
941578654 2:167267945-167267967 GATGGAGATGAGGAACTTGTTGG + Intergenic
942054192 2:172167416-172167438 GATGGAGATGAGGAACTTGTTGG + Intergenic
942123853 2:172803930-172803952 GATGGAGATGAGGAACTTGTTGG - Intronic
942419895 2:175796825-175796847 GATGGAGATGAGGAACTTGTTGG + Intergenic
942517850 2:176772538-176772560 GATGGAGATGAGGAACTTGTTGG + Intergenic
942601259 2:177643343-177643365 GATGGAGATGAGGAACTTGTTGG + Intronic
942880800 2:180858318-180858340 GATGGAGATGAGGAACTTGTTGG - Intergenic
942904822 2:181167587-181167609 GATGGAGATGAGGAACTTGTTGG - Intergenic
943072291 2:183154574-183154596 GATGGAGATGAGGAACTTGTTGG - Intronic
943194059 2:184719700-184719722 GACAAAGATGAGGAACTTGTTGG - Intronic
943219694 2:185089624-185089646 GATGGAGATGAGGAACTTGTTGG + Intergenic
943223576 2:185140644-185140666 GATAAAGATGAGGAACTTGTTGG - Intergenic
943427447 2:187753444-187753466 GATGGAGATGAGGAACTTGTTGG - Intergenic
943478267 2:188385824-188385846 GACAGAGATGAGGAACTTGTTGG - Intronic
943511164 2:188829700-188829722 GATAGAGATGAGGAACTTGTTGG + Intergenic
943543366 2:189244480-189244502 GATGGAGATGAGGAACTTGTTGG - Intergenic
943565259 2:189509285-189509307 GATGGAGATGAGGAACTTGTTGG + Intergenic
943622850 2:190168768-190168790 GATGGAGATGAGGAACTTGTTGG - Intronic
943776662 2:191773762-191773784 GATGGAGATGAGGAACTTGTTGG + Intergenic
944010233 2:194965737-194965759 GATGGAGATGAGGAACTTGTTGG - Intergenic
944043972 2:195387883-195387905 GATGGAGATGAGGAACTTGTTGG + Intergenic
944101448 2:196031736-196031758 GATGGAGATGAGGAACTTGTTGG - Intronic
944250122 2:197573311-197573333 GATGGAGATGAGGAACTTGTTGG + Intronic
944304613 2:198165226-198165248 GATTCAGATGAGGTACAGGTGGG + Intronic
944467532 2:200018175-200018197 GATGGAGATGAGGAACTTGTTGG - Intergenic
944517895 2:200530644-200530666 GAGACAGAGGAGGAACAGGTAGG + Intronic
944808790 2:203308115-203308137 GATGGAGATGAGGAACTTGTTGG + Intergenic
944828090 2:203504934-203504956 GATGGAGATGAGGAACTTGTTGG - Intronic
944920942 2:204412541-204412563 GATGGAGATGAGGAACTTGTTGG + Intergenic
945330828 2:208537246-208537268 GATGGAGATGAGGAACTTGTTGG - Intronic
945433695 2:209795144-209795166 GATGGAGATGAGGAACTTGTAGG + Intronic
945495379 2:210501639-210501661 GATAGAGATGAGGAACTTGTTGG - Intronic
945713390 2:213329384-213329406 GATGGAGATGAGGAACTTGTTGG + Intronic
945767489 2:213998782-213998804 GATGGAGATGAGGAACTTGTTGG + Intronic
946108332 2:217391600-217391622 GATGGAGATGAGGAACTCGTTGG - Intronic
946123976 2:217543488-217543510 GATGGAGATGAGGAACTTGTTGG - Intronic
946562297 2:220926840-220926862 GATGGAGATGAGGAACTGGTTGG - Intergenic
946757472 2:222962285-222962307 GATGGAGATGAGGAACTTGTTGG + Intergenic
946844805 2:223849870-223849892 GATGGAGATGAGGAACTTGTTGG + Intergenic
947099893 2:226608693-226608715 GAGCAAGATTATGAAATGGTTGG - Intergenic
947276363 2:228396569-228396591 GATCAAGATGAGGAACTTGTTGG - Intergenic
947345683 2:229187064-229187086 GATGGAGATGAGGAACTTGTTGG - Intronic
947869771 2:233428127-233428149 GAGCCAGAGGAGGAGGAGGTGGG + Intronic
947886606 2:233577018-233577040 GATGGAGATGAGGAACTTGTTGG - Intergenic
947951725 2:234153410-234153432 GAGGGAGATGAGGAACTTGTTGG - Intergenic
948009038 2:234636128-234636150 GATGAAGATGAGGAACTTGTTGG + Intergenic
948016829 2:234697874-234697896 GATGGAGATGAGGAACTTGTTGG - Intergenic
948296722 2:236866110-236866132 GATGGAGATGAGGAACTTGTTGG - Intergenic
948686040 2:239670272-239670294 GAGCCGGATGTGGAACTGGGCGG + Intergenic
948889058 2:240897988-240898010 GATTCAGCTCAGGAACTGGTGGG - Intergenic
1168957150 20:1842087-1842109 GAGCCAGATGTGGAATTGCTGGG - Intergenic
1169750791 20:8991280-8991302 GAGCGAGATGAGGGAATGGCTGG + Intergenic
1170065348 20:12304298-12304320 GATGGAGATGAGGAACTTGTTGG - Intergenic
1170365025 20:15588736-15588758 GATGGAGATGAGGAACTTGTTGG - Intronic
1170474930 20:16705496-16705518 GATGGAGATGAGGAACTTGTTGG + Intergenic
1170710683 20:18787659-18787681 GAGGGAGATGAGGAACTTGTTGG - Intergenic
1170750430 20:19140149-19140171 GATGGAGATGAGGAACTTGTTGG - Intergenic
1171012599 20:21516717-21516739 GACCCAGAATAGGATCTGGTTGG + Intergenic
1171571400 20:26254963-26254985 GATGGAGATGAGGAACTTGTTGG + Intergenic
1172564383 20:35917567-35917589 AACCCAGATGAGGAACTTGATGG + Exonic
1173023448 20:39286804-39286826 GATGGAGATGAGGAACTTGTTGG + Intergenic
1173263799 20:41460020-41460042 GAAGGAGATGAGGAACTTGTTGG + Intronic
1173412674 20:42828190-42828212 GATGGAGATGAGGAACTTGTTGG + Intronic
1173671267 20:44800644-44800666 GAGACAAAGGAGGAACTGGAGGG + Intronic
1174066894 20:47872271-47872293 GGGCCTGATGATGAAATGGTGGG + Intergenic
1174157324 20:48524154-48524176 GGGCCTGATGATGAAATGGTGGG - Intergenic
1174743039 20:53034477-53034499 CAGGGAGATGACGAACTGGTGGG + Intronic
1176779873 21:13181473-13181495 GATGGAGATGAGGAACTTGTTGG + Intergenic
1176802695 21:13447455-13447477 GAAACTGATGAGCAACTGGTGGG + Intergenic
1177017849 21:15814560-15814582 GATGGAGATGAGGAACTTGTTGG + Intronic
1177046839 21:16181642-16181664 TCTCCAGATGAAGAACTGGTTGG - Intergenic
1177118230 21:17110697-17110719 GATGGAGATGAGGAACTTGTTGG - Intergenic
1177285251 21:19040957-19040979 GATGGAGATGAGGAACTTGTTGG - Intergenic
1177387829 21:20430070-20430092 GATGGAGATGAGGAACTTGTTGG + Intergenic
1177472059 21:21571825-21571847 GATGGAGATGAGGAACTTGTTGG + Intergenic
1177555471 21:22682342-22682364 GATGGAGATGAGGAACTTGTTGG - Intergenic
1177570356 21:22878200-22878222 GAGGGAGATGAGGAACTTGTTGG - Intergenic
1177632655 21:23747088-23747110 GATGAAGATGAGGAACTTGTTGG - Intergenic
1177653492 21:23986859-23986881 GATTGAGATGAGGAACTGGTTGG + Intergenic
1177656112 21:24019717-24019739 GATGGAGATGAGGAACTTGTTGG + Intergenic
1177684611 21:24419612-24419634 GACGGAGATGAGGAACTTGTTGG - Intergenic
1177742110 21:25167318-25167340 GATGGAGATGAGGAACTTGTCGG + Intergenic
1177952269 21:27552951-27552973 GATGGAGATGAGGAACTTGTTGG - Intergenic
1177977521 21:27870496-27870518 GATGGAGATGAGGAACTTGTTGG + Intergenic
1178127113 21:29527465-29527487 GAGGAAGATGAGGAACTTATTGG - Intronic
1178224569 21:30700331-30700353 GATGGAGATGAGGAACTTGTTGG - Intergenic
1179065051 21:38017191-38017213 GATGGAGATGAGGAACTTGTTGG + Intronic
1179235393 21:39541020-39541042 GATGGAGATGAGGAACTTGTTGG - Intergenic
1179272033 21:39859010-39859032 GATGGAGATGAGGAACTTGTTGG - Intergenic
1179331987 21:40412455-40412477 GATGGAGATGAGGAACTTGTTGG + Intronic
1179527837 21:41995338-41995360 GATGGAGATGAGGAACTTGTTGG + Intronic
1179623294 21:42632770-42632792 GAGGGAGATGAGGATCTGGATGG + Intergenic
1180251306 21:46591842-46591864 GATGGAGATGAGGAACTTGTTGG + Intergenic
1180573581 22:16751968-16751990 GATGGAGATGAGGAACTTGTTGG + Intergenic
1180788929 22:18563243-18563265 GAGCCATTTGAGGCACTGGGGGG - Intergenic
1180844655 22:18974585-18974607 GTGCCAGCTGAGGACATGGTGGG - Intergenic
1181056817 22:20264126-20264148 GTGCCAGCTGAGGACATGGTGGG + Intronic
1181232807 22:21432077-21432099 GAGCCATTTGAGGCACTGGGGGG + Intronic
1181245844 22:21502780-21502802 GAGCCATTTGAGGCACTGGGGGG - Intergenic
1181431427 22:22884088-22884110 AAGCCTGAGGAGGAACTGGCTGG - Intronic
1182481920 22:30614670-30614692 GAGCCAGCTTTGGAGCTGGTAGG + Intronic
1182815093 22:33155396-33155418 GATGGAGATGAGGAACTTGTTGG + Intergenic
1182913577 22:34007595-34007617 GATGGAGATGAGGAACTTGTTGG - Intergenic
1183151302 22:36039815-36039837 GATGGAGATGAGGAACTTGTTGG - Intergenic
1183319003 22:37153710-37153732 GAGCCAGGTGAGGAAGGGTTAGG + Intronic
1183545108 22:38451254-38451276 GAGCCAGATGAGCACCTGCCAGG - Intronic
1183847317 22:40552996-40553018 GATGGAGATGAGGAACTTGTTGG + Intronic
1184588515 22:45464303-45464325 GATAGAGATGAGGAACTTGTTGG - Intergenic
1184588717 22:45466156-45466178 GATAGAGATGAGGAACTTGTTGG - Intergenic
949464487 3:4330059-4330081 GATGGAGATGAGGAACTTGTTGG - Intronic
949623697 3:5845124-5845146 GACGGAGATGAGGAACTTGTTGG - Intergenic
949636039 3:5982291-5982313 GATGGAGATGAGGAACTTGTTGG - Intergenic
949641301 3:6038130-6038152 GATGGAGATGAGGAACTTGTTGG - Intergenic
949768537 3:7553224-7553246 GATAGAGATGAGGAACTTGTTGG - Intronic
949770440 3:7571513-7571535 GATGGAGATGAGGAACTTGTTGG - Intronic
950577836 3:13843596-13843618 GAGGCAGCTGAGGCTCTGGTTGG - Intronic
950589235 3:13924199-13924221 GATGGAGATGAGGAACTCGTTGG + Intergenic
950700785 3:14744323-14744345 GATGGAGATGAGGAACTTGTTGG - Intronic
950708158 3:14796574-14796596 TTGACAGATGAGGAACTGGAAGG + Intergenic
950853200 3:16082296-16082318 GATGAAGATGAGGAACTTGTTGG - Intergenic
950913134 3:16615793-16615815 GATGGAGATGAGGAACTTGTTGG + Intronic
951037580 3:17950982-17951004 GATAGAGATGAGGAACTTGTTGG + Intronic
951449448 3:22819815-22819837 GAGGGAGATGAGGAACTTATTGG - Intergenic
951452283 3:22852963-22852985 GATGAAGATGAGGAACTTGTTGG - Intergenic
952105624 3:30066192-30066214 GATGGAGATGAGGAACTTGTTGG - Intergenic
952170359 3:30799901-30799923 GATGGAGATGAGGAACTTGTTGG - Intronic
952185320 3:30961794-30961816 GATGGAGATGAGGAACTTGTTGG - Intergenic
952202870 3:31149380-31149402 GATGGAGATGAGGAACTAGTGGG - Intergenic
952504607 3:33996455-33996477 GATGGAGATGAGGAACTTGTTGG - Intergenic
952570048 3:34702794-34702816 GATGGAGATGAGGAACTTGTTGG - Intergenic
952831496 3:37568740-37568762 GAGGGAGATGAGGAATTTGTTGG - Intronic
953419163 3:42741367-42741389 GAGCAAGAGGAGGAATGGGTTGG - Intronic
953685705 3:45076931-45076953 GATGGAGATGAGGAACTTGTTGG + Intergenic
954320568 3:49829705-49829727 GAGCCAGATGAGGAACTGGTTGG - Exonic
954418328 3:50405209-50405231 GTGCCCGATGGGGCACTGGTTGG + Intronic
954446096 3:50547660-50547682 GAGCCAGACAGAGAACTGGTTGG + Intergenic
954575616 3:51674450-51674472 GAGCCCCATGTGGAACTTGTAGG - Exonic
954591473 3:51787301-51787323 GATGGAGATGAGGAACTTGTTGG + Intergenic
954759646 3:52864850-52864872 GATGGAGATGAGGAACTTGTTGG - Intronic
954949147 3:54453740-54453762 TAAGCAGTTGAGGAACTGGTGGG - Intronic
955490138 3:59473477-59473499 AAGCCAGGTGAGGAACAGGGAGG - Intergenic
955754870 3:62216794-62216816 GACCCAGATGGGGAATTGGAAGG - Intronic
956375500 3:68609375-68609397 GACGGAGATGAGGAACTTGTTGG - Intergenic
956503172 3:69909616-69909638 GATGGAGATGAGGAACTTGTTGG + Intronic
956546456 3:70408579-70408601 GATGGAGATGAGGAACTTGTTGG - Intergenic
956551120 3:70461015-70461037 GATGGAGATGAGGAACTTGTTGG + Intergenic
956558887 3:70551702-70551724 GATGGAGATGAGGAACTTGTTGG - Intergenic
956947156 3:74235638-74235660 GATGTAGATGAGGAACTTGTTGG - Intergenic
957300677 3:78388368-78388390 GATGGAGATGAGGAACTTGTTGG - Intergenic
957557598 3:81781380-81781402 GAGGGAGATGAGGAACTTGTTGG - Intergenic
957557609 3:81781444-81781466 GAGGGAGACGAGGAACTTGTTGG - Intergenic
957557621 3:81781508-81781530 GAGGGAGATGAGGAACTTGTTGG - Intergenic
957630612 3:82711849-82711871 GATGGAGATGAGGAACTTGTTGG - Intergenic
957676843 3:83378007-83378029 GATGAAGATGAGGAACTTGTTGG - Intergenic
957757450 3:84509263-84509285 GATGGAGATGAGGAACTAGTTGG + Intergenic
957762258 3:84573332-84573354 GATGGAGATGAGGAACTTGTTGG - Intergenic
957765816 3:84622382-84622404 GATGGAGATGAGGAACTTGTTGG - Intergenic
957857078 3:85893003-85893025 GAGGGAGATGAGAAACTTGTTGG + Intronic
957870393 3:86083806-86083828 GATAGAGATGAGGAACTTGTTGG - Intergenic
957873040 3:86112097-86112119 GATGGAGATGAGGAACTTGTTGG + Intergenic
957909429 3:86603086-86603108 GAAGGAGATGAGGAACTTGTTGG + Intergenic
958065698 3:88542704-88542726 GATGGAAATGAGGAACTGGTTGG + Intergenic
958065862 3:88544390-88544412 GATGGAAATGAGGAACTGGTTGG + Intergenic
958128309 3:89385922-89385944 GATGGAGATGAGGAACTTGTTGG + Intronic
958604285 3:96338351-96338373 GATGGAGATGAGGAACTTGTTGG + Intergenic
958647333 3:96889094-96889116 GATGCAAATGAGGAACTTGTTGG - Intronic
958684639 3:97377666-97377688 GATGGAGATGAGGAACTTGTTGG + Intronic
958831690 3:99098153-99098175 GATGGAGATGAGGAACTTGTTGG + Intergenic
958857222 3:99399473-99399495 GATGGAGATGAGGAACTTGTTGG - Intergenic
958956547 3:100470618-100470640 GATAGAGATGAGGAACTTGTTGG - Intergenic
959104524 3:102051104-102051126 GATGGAGATGAGGAACTTGTTGG + Intergenic
959160943 3:102724059-102724081 GATGGAGATGAGGAACTTGTTGG + Intergenic
959229622 3:103631718-103631740 GATGGAGATGAGGAACTTGTTGG + Intergenic
959342630 3:105149813-105149835 GATGGAGATGAGGAACTTGTTGG - Intergenic
959606209 3:108244492-108244514 GATGGAGATGAGGAACTCGTTGG + Intergenic
959754815 3:109884392-109884414 GATGGAGATGAGGAACTTGTTGG - Intergenic
959756588 3:109906633-109906655 GATGGAGATGAGGAACTTGTTGG - Intergenic
959893753 3:111584227-111584249 GATAGAGATGAGGAACTTGTTGG - Intronic
959894209 3:111588343-111588365 GATGGAGATGAGGAACTTGTTGG - Intronic
959973341 3:112431399-112431421 GATGGAGATGAGGAACTTGTTGG + Intergenic
960224847 3:115157339-115157361 GATGGAGATGAGGAACTTGTTGG + Intergenic
960496649 3:118383486-118383508 GATGGAGATGAGGAACTTGTTGG + Intergenic
961067883 3:123891592-123891614 GATGGAGATGAGGAACTTGTTGG - Intergenic
961141595 3:124560945-124560967 GAGCAAGAGAAGGAACTGCTAGG + Intronic
961342730 3:126239505-126239527 GATGGAGATGAGGAACTTGTTGG - Intergenic
962035077 3:131643133-131643155 GACGGAGATGAGGAACTTGTTGG + Intronic
962045685 3:131757321-131757343 GATGGAGATGAGGAACTTGTTGG + Intronic
962339580 3:134570509-134570531 GATGGAGATGAGGAACTTGTTGG - Intronic
962636560 3:137337946-137337968 GACGCAGATGAGGAACTTGTTGG + Intergenic
962672923 3:137727231-137727253 GATGGAGATGAGGAACTTGTTGG - Intergenic
962769868 3:138602270-138602292 GATGGAGATGAGGAACTTGTTGG + Intergenic
962946347 3:140174286-140174308 GATGGAGATGAGGAACTTGTTGG - Intronic
963011760 3:140776520-140776542 GATGGAGATGAGGAACTTGTTGG - Intergenic
963040170 3:141064671-141064693 GAGCCAGATGAGGAGATGGATGG - Intronic
963072913 3:141319665-141319687 GATGGAGATGAGGAACTTGTTGG - Intergenic
963297029 3:143557632-143557654 GTCTCAGATGAGGAACTTGTTGG + Intronic
963363308 3:144303877-144303899 GATGGAGATGAGGAACTTGTTGG - Intergenic
963379378 3:144508086-144508108 GATGGAGATGAGGAACTTGTTGG - Intergenic
963391237 3:144666182-144666204 GATGGAGATGAGGAACTTGTTGG - Intergenic
963394646 3:144716014-144716036 GATGGAGATGAGGAACTTGTTGG - Intergenic
963422171 3:145073978-145074000 GATGAAGATGAGGAACTTGTTGG - Intergenic
963441527 3:145345689-145345711 GATGGAGATGAGGAACTTGTTGG - Intergenic
963539015 3:146563052-146563074 GATGGAGATGAGGAACTTGTTGG - Intergenic
963878413 3:150501817-150501839 GATGGAGATGAGGAACTTGTTGG - Intergenic
964076780 3:152701410-152701432 GATGGAGATGAGGAACTTGTTGG - Intergenic
964090945 3:152874696-152874718 GATGGAGATGAGGAACTTGTTGG - Intergenic
964098689 3:152963308-152963330 GATGGAGATGAGGAACTTGTTGG - Intergenic
964275297 3:155003337-155003359 GATGGAGATGAGGAACTTGTTGG + Intergenic
964426644 3:156561172-156561194 GATAGAGATGAGGAACTTGTTGG + Intergenic
964562326 3:158011176-158011198 GATGGAGATGAGGAACTTGTTGG - Intergenic
964589101 3:158340917-158340939 GATGGAGATGAGGAACTTGTTGG + Intronic
964654475 3:159051508-159051530 GATGGAGATGAGGAACTTGTTGG + Intronic
964719463 3:159756896-159756918 GATGGAGATGAGGAACTTGTTGG - Intronic
964926335 3:161963054-161963076 GATGGAGATGAGGAACTTGTTGG + Intergenic
965045409 3:163571782-163571804 GATGGAGATGAGGAACTTGTTGG + Intergenic
965052153 3:163664383-163664405 GATGGAGATGAGGAACTTGTTGG - Intergenic
965108502 3:164388825-164388847 GATGAAGATGAGGAACTTGTTGG - Intergenic
965242508 3:166220798-166220820 GAGTCAGATGAGAAACTGGTTGG + Intergenic
965305625 3:167059905-167059927 GATGGAGATGAGGAACTTGTTGG - Intergenic
965446147 3:168776889-168776911 GATGGAGATGAGGAACTTGTTGG + Intergenic
965456547 3:168908396-168908418 GAGCCAGATGTGATGCTGGTAGG + Intergenic
965499928 3:169444857-169444879 GATGGAGATGAGGAACTTGTTGG + Intronic
965649409 3:170918508-170918530 GATGGAGATGAGGAACTTGTTGG + Intergenic
965662046 3:171052305-171052327 GATGGAGATGAGGAACTTGTTGG + Intergenic
966074486 3:175920031-175920053 GATGGAGATGAGGAACTTGTTGG - Intergenic
966299337 3:178461365-178461387 GTCACAGATGAGGAACTTGTTGG + Intronic
966320440 3:178695653-178695675 GATGGAGATGAGGAACTTGTTGG - Intronic
966325329 3:178746823-178746845 GATGGAGATGAGGAACTTGTTGG - Intronic
966586022 3:181625509-181625531 GAGCGAGATGAGGGTCTGGCTGG - Intergenic
966741896 3:183241919-183241941 GATAGAGATGAGGAACTTGTTGG + Intronic
967208535 3:187146096-187146118 GATGGAGATGAGGAACTTGTTGG - Intronic
967406114 3:189118177-189118199 GATGGAGATGAGGAACTTGTTGG + Intronic
967412591 3:189181569-189181591 GATGGAGATGAGGAACTTGTTGG - Intronic
967484050 3:190009450-190009472 GGGCCAGGTGGAGAACTGGTTGG - Intronic
967586171 3:191216742-191216764 GATGCAGATGAGGAAATTGTTGG - Intronic
967609065 3:191482640-191482662 GATGGAGATGAGGAACTTGTTGG + Intergenic
967614465 3:191547984-191548006 GATGGAGATGAGGAACTTGTTGG - Intergenic
967622646 3:191651536-191651558 GAGAGAGATGAGGAACTTATTGG - Intergenic
967689457 3:192457456-192457478 GATGGAGATGAGGAACTTGTTGG + Intronic
967717047 3:192774736-192774758 GATGGAGATGAGGAACTTGTTGG + Intergenic
967908226 3:194519519-194519541 GATGGAGATGAGGAACTTGTTGG + Intergenic
968175792 3:196548514-196548536 GATGAAGATGAGGAACTCGTTGG + Intergenic
968265494 3:197359867-197359889 GAAGGAGATGAGGAACTTGTTGG + Intergenic
968590541 4:1456994-1457016 GATGGAGATGAGGAACTTGTTGG - Intergenic
968767071 4:2478034-2478056 GATGGAGATGAGGAACTTGTTGG + Intronic
968892941 4:3381169-3381191 GACAGAGATGAGGAACTTGTTGG - Intronic
969105244 4:4802623-4802645 GAGACACAGGAGGATCTGGTGGG - Intergenic
969487102 4:7478423-7478445 GAGGCAGCTGAGGTACGGGTGGG - Intronic
969904596 4:10382405-10382427 GATGGAGATGAGGAACTTGTTGG + Intergenic
969993142 4:11284573-11284595 GAGGGAAATGAGGAACTTGTTGG - Intergenic
970057583 4:11993287-11993309 GATGAAGATGAGGAACTCGTTGG + Intergenic
970099439 4:12503721-12503743 GATGAAGATGAGGAACTGGTTGG - Intergenic
970139446 4:12965564-12965586 AAGCCTGATAAGGAAGTGGTTGG + Intergenic
970157317 4:13154110-13154132 GACGGAGATGAGGAACTTGTTGG - Intergenic
970344111 4:15136584-15136606 GATGCAGATGAGGAACTTGTTGG - Intergenic
970357328 4:15268946-15268968 GATGCAGATGAGAAACTTGTTGG + Intergenic
970382198 4:15519291-15519313 GATGGAGATGAGGAACTTGTTGG - Intronic
970577803 4:17444873-17444895 GATGAAGATGAGGAACTTGTTGG - Intergenic
970624492 4:17861892-17861914 GATGGAGATGAGGAACTTGTTGG - Intronic
970644079 4:18099188-18099210 GAGGCAGAGGAGGAGGTGGTAGG + Intergenic
970773785 4:19648252-19648274 GATGGAGATGAGGAACTTGTTGG - Intergenic
970801406 4:19977105-19977127 GATAGAGATGAGGAACTTGTTGG - Intergenic
970868240 4:20783096-20783118 GAAGGAGATGAGGAACTTGTTGG - Intronic
970976623 4:22049206-22049228 GATGGAGATGAGGAACTTGTTGG - Intergenic
970977289 4:22056615-22056637 GATGGAGATGAGGAACTTGTTGG + Intergenic
970999191 4:22303389-22303411 GATGGAGATGAGGAACTTGTTGG + Intergenic
971111504 4:23591244-23591266 GATGGAGATGAGGAACTTGTTGG + Intergenic
971119562 4:23688907-23688929 GAGGGAGATGAGGAACTTCTTGG + Intergenic
971185217 4:24369006-24369028 GAGCCAGATGGGGTGCTCGTGGG - Intergenic
971440297 4:26678192-26678214 GATGGAGATGAGGAACTTGTTGG + Intronic
971546211 4:27890573-27890595 GAAGGAGATGAGGAACTTGTTGG + Intergenic
971631391 4:28997962-28997984 GATGGAGATGAGGAACTTGTTGG + Intergenic
971681568 4:29707265-29707287 GATGGAGATGAGGAACTTGTTGG - Intergenic
971733460 4:30416313-30416335 GATGGAGATGAGGAACTTGTTGG + Intergenic
971744773 4:30565827-30565849 GATGGAGATGAGGAACTTGTTGG + Intergenic
971793734 4:31200251-31200273 GATAGAGATGAGGAACTTGTTGG - Intergenic
971845721 4:31915793-31915815 GACGGAGATGAGGAACTGATTGG + Intergenic
971939714 4:33199374-33199396 GATACAGATGAGGAACTTGTGGG + Intergenic
972002757 4:34059185-34059207 GATGGAGATGAGGAACTTGTTGG - Intergenic
972014372 4:34225539-34225561 GATGGAGATGAGGAACTTGTTGG + Intergenic
972017454 4:34264103-34264125 GATGGAGATGAGGAACTTGTTGG - Intergenic
972137281 4:35908010-35908032 GAGAGAGATGAGGAGCTTGTTGG + Intergenic
972467428 4:39370719-39370741 GATGGAGATGAGGAACTTGTTGG + Intergenic
972484842 4:39531310-39531332 GATGGAGATGAGGAACTTGTTGG - Intergenic
972485016 4:39532796-39532818 GATGGAGATGAGGAACTTGTTGG + Intergenic
972872048 4:43312455-43312477 GACAGAGATGAGGAACTTGTTGG + Intergenic
974012948 4:56624100-56624122 GATGGAGATGAGGAACTTGTTGG + Intergenic
974036996 4:56826126-56826148 GATGGAGATGAGGAACTTGTTGG + Intergenic
974206029 4:58704643-58704665 GATGGAGATGAGGAACTTGTTGG + Intergenic
974318020 4:60307054-60307076 GAGGGAGATGAGGAACTTGTTGG - Intergenic
974322429 4:60368812-60368834 GATGGAGATGAGGAACTTGTTGG + Intergenic
974480684 4:62438810-62438832 GATGGAGATGAGGAACTTGTTGG - Intergenic
974614805 4:64267218-64267240 GATGGAGATGAGGAACTTGTTGG - Intergenic
974725680 4:65795333-65795355 GATGGAGATGAGGAACTTGTTGG - Intergenic
974742326 4:66022441-66022463 GATGGAGATGAGGAACTTGTTGG - Intergenic
974812055 4:66957440-66957462 GATGGAGATGAGGAACTTGTTGG - Intergenic
974842046 4:67309969-67309991 GATGGAGATGAGGAACTTGTTGG + Intergenic
974846104 4:67352470-67352492 GATGGAGATGAGGAACTTGTTGG - Intergenic
975038218 4:69710824-69710846 GATGGAGATGAGGAACTTGTTGG - Intergenic
975239631 4:72042603-72042625 GATTGAGATGAGGAACTTGTTGG + Intronic
975279131 4:72540187-72540209 GATGGAGATGAGGAACTTGTTGG + Intronic
975302135 4:72802500-72802522 GATGAAGATGAGGAACTTGTTGG - Intergenic
975307279 4:72864800-72864822 GAGAGAGATGAGGAACTTCTTGG + Intergenic
975542983 4:75533303-75533325 GATGGAGATGAGGAACTTGTTGG - Intronic
975632175 4:76415095-76415117 GATGGAGATGAGGAACTTGTTGG + Intronic
975729944 4:77328000-77328022 GATGGAGATGAGGAACTTGTTGG - Intronic
975952263 4:79788402-79788424 GATGGAGATGAGGAACTTGTTGG + Intergenic
976259974 4:83136160-83136182 GATGGAGATGAGGAACTTGTTGG - Intronic
976286526 4:83376124-83376146 GATGGAGATGAGGAACTTGTTGG - Intergenic
976444720 4:85117421-85117443 GATGGAGATGAGGAACTTGTTGG + Intergenic
976581427 4:86740978-86741000 GATGGAGATGAGGAACTTGTTGG - Intronic
976635896 4:87286193-87286215 GATAGAGATGAGGAACTTGTTGG + Intergenic
976674684 4:87691365-87691387 GATGGAGATGAGGAACTTGTTGG + Intergenic
976715570 4:88119565-88119587 GATGGAGATGAGGAACTTGTTGG + Intronic
976952330 4:90849278-90849300 GATGGAGATGAGGAACTTGTTGG + Intronic
977014596 4:91677347-91677369 GATGGAGATGAGGAACTTGTTGG + Intergenic
977016113 4:91694644-91694666 GATGGAGATGAGGAACTTGTTGG + Intergenic
977198743 4:94090038-94090060 GATGGAGATGAGGAACTTGTTGG - Intergenic
977504031 4:97879082-97879104 GATGGAGATGAGGAACTTGTTGG - Intronic
977511965 4:97973213-97973235 GATGGAGATGAGGAACTTGTTGG + Intronic
977592388 4:98841548-98841570 GATGGAGATGAGGAACTTGTTGG + Intergenic
977704154 4:100052694-100052716 GATGGAGATGAGGAACTTGTTGG - Intergenic
977821143 4:101473537-101473559 GATGGAGATGAGGAACTCGTTGG + Intronic
977952922 4:102994362-102994384 GATGGAGATGAGGAACTTGTTGG - Intronic
977977660 4:103286145-103286167 GATGGAGATGAGGAACTTGTTGG + Intergenic
978034404 4:103975953-103975975 GATGGAGATGAGGAACTTGTTGG + Intergenic
978579622 4:110218917-110218939 GATGCAGATGAGGAGCTTGTTGG - Intergenic
978934227 4:114355578-114355600 GATGGAGATGAGGAACTTGTTGG - Intergenic
978938982 4:114414946-114414968 GATAGAGATGAGGAACTTGTTGG + Intergenic
979059912 4:116044328-116044350 GAGGGAGATGAGAAACTTGTTGG - Intergenic
979173010 4:117625594-117625616 GATGAAGATGAGGAACTTGTTGG + Intergenic
979426498 4:120573194-120573216 GATGGAGATGAGGAACTTGTTGG - Intergenic
979966806 4:127086048-127086070 GATGGAGATGAGGAACTTGTTGG + Intergenic
980266606 4:130524472-130524494 GAGGGAGATGAGGAACTTGTTGG + Intergenic
980282881 4:130742993-130743015 GAGGGAGATGAGAAACTTGTTGG + Intergenic
980310791 4:131126708-131126730 GATGGAGATGAGGAACTTGTTGG - Intergenic
980408303 4:132381918-132381940 GATGGAGATGAGGAACTTGTTGG - Intergenic
980513601 4:133824771-133824793 GATGGAGATGAGGAACTTGTTGG + Intergenic
980579547 4:134732027-134732049 GACGGAGATGAGGAACTTGTTGG + Intergenic
980727772 4:136787308-136787330 GACGGAGATGAGGAACTTGTTGG + Intergenic
981232121 4:142369013-142369035 GAGGAAGAAGAGGAACTGGGAGG + Intronic
981343256 4:143647102-143647124 GATGGAGATGAGGAACTTGTCGG + Intronic
981359557 4:143831016-143831038 GATGGAGATGAGGAACTCGTTGG + Intergenic
981368481 4:143930424-143930446 GATGGAGATGAGGAACTGATTGG - Intergenic
981370319 4:143952084-143952106 GAAAGAGATGAGGAACTCGTTGG + Intergenic
981407283 4:144386119-144386141 GATGGAGATGAGGAACTTGTTGG - Intergenic
981642959 4:146966648-146966670 GATGGAGATGAGGAACTTGTCGG + Intergenic
981757033 4:148151660-148151682 GAGGCAGATGAGAAATAGGTTGG - Intronic
981994269 4:150958805-150958827 GATGGAGATGAGGAACTTGTTGG - Intronic
982019565 4:151190025-151190047 GATGGAGATGAGGAACTTGTTGG + Intronic
982279062 4:153665477-153665499 GATGGAGATGAGGAACTTGTTGG + Intergenic
982301119 4:153880438-153880460 GAGGGAGATGAGGAGCTCGTTGG + Intergenic
982389992 4:154853402-154853424 GATGGAGATGAGGAACTTGTTGG - Intergenic
982560964 4:156927625-156927647 GATGGAGATGAGGAACTTGTTGG - Intronic
982904371 4:161049205-161049227 GATACAGATGAGGAACTTGTTGG - Intergenic
982948981 4:161664497-161664519 GATGGAGATGAGGAACTTGTTGG - Intronic
983048236 4:163012010-163012032 GATAGAGATGAGGAACTTGTTGG - Intergenic
983105562 4:163682082-163682104 GATGGAGATGAGGAACTTGTTGG + Intronic
983320556 4:166191222-166191244 GATGGAGATGAGGAACTTGTTGG + Intergenic
983322774 4:166214422-166214444 GATAGAGATGAGGAACTTGTTGG - Intergenic
983334696 4:166376388-166376410 CAGTCAGATGAGGAACAAGTGGG + Intergenic
983478177 4:168241491-168241513 GATGGAGATGAGGAACTTGTTGG + Intronic
983651582 4:170041436-170041458 GAGCCAGCTGAGGCAATGTTTGG + Intergenic
983723929 4:170894177-170894199 GATGGAGATGAGGAACTTGTTGG - Intergenic
983863205 4:172734052-172734074 GATGAAGATGAGGAACTTGTTGG + Intronic
984219546 4:176956064-176956086 GATGGAGATGAGGAACTTGTTGG - Intergenic
984232178 4:177112674-177112696 GAGTGAGATGAGGAACTTGTTGG - Intergenic
984327192 4:178269488-178269510 GATGGAGATGAGGAACTTGTTGG - Intergenic
984553382 4:181186095-181186117 GATGGAGATGAGGAACTTGTGGG - Intergenic
984865456 4:184276779-184276801 GATGGAGATGAGGAACTTGTTGG + Intergenic
985156126 4:186988670-186988692 GATGGAGATGAGGAACTTGTTGG - Intergenic
985371658 4:189291707-189291729 GATGGAGATGAGGAACTTGTTGG + Intergenic
985394227 4:189525102-189525124 GATGGAGATGAGGAACTTGTTGG + Intergenic
985807569 5:2058463-2058485 GATGGAGATGAGGAACTTGTTGG - Intergenic
985809091 5:2070037-2070059 GATGGAGATGAGGAACTTGTTGG + Intergenic
986081190 5:4395723-4395745 GATGCAGATTAGGAACTTGTTGG - Intergenic
986114013 5:4751255-4751277 GATGAAGATGAGGAACTTGTTGG - Intergenic
986138361 5:5005149-5005171 GAGGGAGATGAGGAACTTTTTGG + Intergenic
986680180 5:10225224-10225246 GATGGAGATGAGGAACTTGTTGG - Intergenic
986873551 5:12079554-12079576 GATGGAGATGAGGAACTTGTTGG - Intergenic
986948102 5:13048622-13048644 GATGAAGATGAGGAACTTGTTGG - Intergenic
987098019 5:14567057-14567079 GATGGAGATGAGGAACTTGTTGG - Intergenic
987254607 5:16137732-16137754 GAGGGAGATGAGGAACTTATTGG + Intronic
987433475 5:17864779-17864801 GATGGAGATGAGGAACTTGTTGG + Intergenic
987435163 5:17885112-17885134 GATGGAGATGAGGAACTTGTCGG + Intergenic
987461923 5:18222769-18222791 GATGGAGATGAGGAACTTGTTGG + Intergenic
987610589 5:20198365-20198387 GATGAAGATGAGGAACTTGTTGG + Intronic
987642433 5:20629439-20629461 GATGGAGATGAGGAACTTGTTGG - Intergenic
987659480 5:20854361-20854383 GACGAAGATGAGGAACTTGTTGG + Intergenic
987709114 5:21486620-21486642 GAGGGAGATGAGGAATTTGTTGG - Intergenic
987984818 5:25133425-25133447 GATGGAGATGAGGAACTTGTTGG + Intergenic
988009124 5:25461158-25461180 GATGGAGATGAGGAACTTGTTGG + Intergenic
988149886 5:27364071-27364093 GATGGAGATGAGGAACTTGTTGG + Intergenic
988162793 5:27543382-27543404 GATGGAGATGAGGAACTTGTTGG + Intergenic
988196359 5:28011086-28011108 AATGCAGATGAGGAACTTGTTGG + Intergenic
988204477 5:28116042-28116064 GATGGAGATGAGGAACTTGTTGG - Intergenic
988426938 5:31074934-31074956 GATAGAGATGAGGAACTTGTTGG - Intergenic
988649346 5:33131229-33131251 GATGGAGATGAGGAACTTGTTGG + Intergenic
988750498 5:34187533-34187555 GAGGGAGATGAGGAATTTGTTGG + Intergenic
988764169 5:34351286-34351308 GACGAAGATGAGGAACTTGTTGG - Intergenic
989144393 5:38234460-38234482 GATGGAGATGAGGAACTTGTTGG + Intergenic
989218378 5:38928022-38928044 GATGGAGATGAGGAACTTGTTGG - Intronic
989224483 5:39010627-39010649 GATGGAGATGAGGAACTTGTTGG + Intronic
989389099 5:40882044-40882066 GATGGAGATGAGGAACTTGTTGG + Intergenic
989399485 5:40993552-40993574 GATGGAGATGAGGAACTTGTTGG - Intergenic
989501957 5:42178008-42178030 GAGGAAGACGAGGAACTTGTCGG - Intergenic
989532477 5:42524293-42524315 GATGGAGATGAGGAACTTGTTGG + Intronic
989651688 5:43697321-43697343 GATGGAGATGAGGAACTTGTTGG - Intronic
989656854 5:43754009-43754031 GATGGAGATGAGGAACTTGTTGG - Intergenic
989677019 5:43984113-43984135 GATAGAGATGAGGAACTTGTTGG - Intergenic
989778192 5:45233780-45233802 GATGGAGATGAGGAACTTGTTGG - Intergenic
990077754 5:51872532-51872554 GATGGAGATGAGGAACTTGTTGG + Intergenic
990429064 5:55717035-55717057 GATGGAGATGAGGAACTTGTTGG + Intronic
990481576 5:56216305-56216327 GAGAGAGATGGGGGACTGGTTGG - Intronic
991010040 5:61872795-61872817 GATGAAGATGAGGAACTTGTTGG - Intergenic
991409306 5:66330947-66330969 GATGGAGATGAGGAACTTGTTGG + Intergenic
991700015 5:69308880-69308902 GATGGAGATGAGGAACTTGTTGG + Intronic
991738758 5:69650731-69650753 GAGGCAGATGAGGAATTTGTTGG + Intergenic
991759439 5:69905696-69905718 GAGGCAGATGAGGAATTTGTTGG - Intergenic
991787896 5:70212422-70212444 GAGGCAGATGAGGAATTTGTTGG + Intergenic
991790333 5:70230472-70230494 GAGGCAGATGAGGAATTTGTTGG + Intergenic
991815082 5:70505563-70505585 GAGGCAGATGAGGAATTTGTTGG + Intergenic
991818217 5:70526848-70526870 GAGGCAGATGAGGAATTTGTTGG + Intergenic
991838667 5:70780762-70780784 GAGGGAGATGAGGAATTTGTTGG - Intergenic
991880342 5:71212786-71212808 GAGGCAGATGAGGAATTTGTTGG + Intergenic
991882783 5:71230812-71230834 GAGGGAGATGAGGAATTTGTTGG + Intergenic
992215762 5:74523439-74523461 GATGGAGATGAGGAACTTGTTGG + Intergenic
992817994 5:80463931-80463953 GATGGAGATGAGGAACTTGTTGG - Intronic
992924375 5:81566805-81566827 GAGGGAGATGAGGAACTTGTTGG + Intronic
993208726 5:84920884-84920906 GATGGAGATGAGGAACTTGTTGG + Intergenic
993293724 5:86108485-86108507 GACGGAGATGAGGAACTTGTTGG + Intergenic
993309615 5:86313272-86313294 GATGGAGATGAGGAACTTGTTGG + Intergenic
993436317 5:87900072-87900094 GACCCAGATGAGGTATTTGTAGG + Intergenic
993442507 5:87973958-87973980 GATGGAGATGAGGAACTTGTTGG - Intergenic
993724064 5:91348465-91348487 GATGGAGATGAGGAACTTGTTGG - Intergenic
993753724 5:91701642-91701664 GATGCAGATAAGGAACTTGTTGG - Intergenic
993788135 5:92170493-92170515 GATGGAGATGAGGAACTTGTTGG - Intergenic
993801710 5:92350955-92350977 GATGAAGATGAGGAACTTGTTGG + Intergenic
993852011 5:93022224-93022246 GAGACAGATGAGGGGCTGGGGGG + Intergenic
993935004 5:93988308-93988330 GGACCAGATGAGGGACTTGTAGG - Intronic
993945827 5:94116107-94116129 GATGGAGATGAGGAACTTGTTGG + Intergenic
993985832 5:94595948-94595970 GATGGAGATGAGGAACTTGTTGG - Intronic
994524122 5:100882220-100882242 GATGGAGATGAGGAACTTGTTGG + Intronic
994608140 5:101997290-101997312 GAGGAAGATGAGGAACAAGTGGG + Intergenic
994615010 5:102093013-102093035 GATGGAGATGAGGAACTTGTTGG - Intergenic
995282460 5:110351590-110351612 AAGCCAGATGAGGACCTCCTGGG - Intronic
995299833 5:110566594-110566616 GATGAAGATGAGGAACTTGTTGG - Intronic
995608048 5:113879491-113879513 GATGGAGATGAGGAACTTGTTGG + Intergenic
995691040 5:114825975-114825997 GATGGAGATGAGGAACTTGTTGG - Intergenic
995724215 5:115167579-115167601 GATGGAGATGAGGAACTTGTCGG - Intronic
995828701 5:116330076-116330098 GATGGAGATGAGGAACTTGTTGG - Intronic
995856747 5:116600731-116600753 GAGCCACTGGAGGACCTGGTGGG + Intergenic
995988611 5:118209226-118209248 GATGAAGATGAGGAACTTGTTGG + Intergenic
996011344 5:118484281-118484303 GATGGAGATGAGGAACTTGTTGG - Intergenic
996149929 5:120022898-120022920 GATGGAGATGAGGAACTTGTTGG + Intergenic
996214401 5:120849446-120849468 GATAGAGATGAGGAACTTGTTGG - Intergenic
996250976 5:121331603-121331625 GATGGAGATGAGGAACTTGTTGG + Intergenic
996442180 5:123504058-123504080 GAGCCAGATGTGGCATTTGTAGG + Intergenic
996453788 5:123656935-123656957 GAGGGAGATGAGGAACTTATTGG - Intergenic
996460093 5:123732030-123732052 GAAGAAGATGAGGAACTTGTTGG + Intergenic
996560731 5:124826156-124826178 GAGGGAGAAGAGGAACTGATAGG + Intergenic
996897552 5:128503528-128503550 GATGGAGATGAGGAACTTGTTGG + Intronic
997052320 5:130397878-130397900 GATGGAGATGAGGAACTTGTTGG + Intergenic
997081623 5:130746407-130746429 GATGGAGATGAGGAACTTGTTGG + Intergenic
997086391 5:130805537-130805559 GATGGAGATGAGGAACTTGTTGG + Intergenic
997181503 5:131833323-131833345 GATGGAGATGAGGAACTTGTTGG - Intronic
997492149 5:134286277-134286299 GATAGAGATGAGGAACTTGTTGG - Intergenic
997678183 5:135730792-135730814 GATGGAGATGAGGAACTTGTTGG + Intergenic
997692778 5:135838094-135838116 GATGGAGATGAGGAACTTGTTGG + Intronic
998144451 5:139718798-139718820 GATGGAGATGAGGAACTCGTTGG + Intergenic
998322546 5:141246252-141246274 GACCAAGATGAGGATCTGGACGG - Exonic
998980438 5:147696797-147696819 GATGGAGATGAGGAACTTGTAGG + Intronic
999012222 5:148055585-148055607 GATGGAGATGAGGAACTTGTTGG + Intronic
999107937 5:149090410-149090432 GATGGAGATGAGGAACTTGTTGG + Intergenic
999473612 5:151878157-151878179 GATGGAGATGAGGAACTTGTTGG + Intronic
999540935 5:152572013-152572035 GATGGAGATGAGGAACTTGTTGG + Intergenic
999669457 5:153945804-153945826 GAGGGACATGAGGAACTTGTTGG - Intergenic
1000609546 5:163359333-163359355 GATGGAGATGAGGAACTTGTTGG + Intergenic
1001181747 5:169526839-169526861 GATGGAGATGAGGAACTTGTTGG - Intergenic
1001361446 5:171090239-171090261 GATGGAGATGAGGAACTTGTTGG + Intronic
1001943754 5:175760662-175760684 GATGCAGATGAGAAACTTGTTGG + Intergenic
1003227862 6:4222817-4222839 GATGGAGATGAGGAACTCGTTGG + Intergenic
1003401842 6:5796990-5797012 GATGGAGATGAGGAACTTGTTGG - Intergenic
1003720068 6:8692211-8692233 GATGGAGATGAGGAACTTGTTGG + Intergenic
1004168168 6:13275096-13275118 CAGCCATTTGAGGAACTGCTCGG + Intronic
1004592725 6:17069371-17069393 GATGGAGATGAGGAACTTGTTGG + Intergenic
1004830927 6:19475949-19475971 GATGGAGATGAGGAATTGGTTGG - Intergenic
1004834478 6:19515646-19515668 GATGGAGATGAGGAACTTGTTGG + Intergenic
1005329005 6:24731214-24731236 GATGGAGATGAGGAACTTGTTGG + Intergenic
1005499697 6:26419024-26419046 GATAGAGATGAGGAACTTGTTGG - Intergenic
1005548568 6:26893838-26893860 GAGGGAGATGAGGAATTTGTGGG + Intergenic
1005905082 6:30255451-30255473 GATGGAGATGAGGAACTTGTTGG - Intergenic
1006280270 6:33046943-33046965 GATGGAGATGAGGAACTTGTTGG + Intergenic
1006344067 6:33465837-33465859 GATGGAGATGAGGAACTTGTTGG + Intergenic
1006697049 6:35940155-35940177 GATGGAGATGAGGAACTTGTTGG + Intergenic
1007003144 6:38334027-38334049 GATGCAGATGAGGAACTTATTGG + Intronic
1007126348 6:39429000-39429022 GACCCAGAAGAGGAACTGCTGGG + Intronic
1007185833 6:39971635-39971657 GATGGAGATGAGGAACTTGTTGG + Intergenic
1007289831 6:40777340-40777362 GAGCCAGCTCAGAAGCTGGTCGG - Intergenic
1007735979 6:43982422-43982444 GAGCCAGAGTGGAAACTGGTTGG + Intergenic
1007784814 6:44273500-44273522 CACCCAGGTGAGGAGCTGGTGGG + Exonic
1007856707 6:44865157-44865179 GATGGAGATGAGGAACTTGTTGG - Intronic
1007990169 6:46246842-46246864 GGGCGAGATGAGAAACTGTTTGG + Exonic
1008064010 6:47028094-47028116 GAGCGAGATGAGAAACTGCTGGG + Intronic
1008244934 6:49160524-49160546 GATGAAGATGAGGAACTTGTTGG + Intergenic
1008337574 6:50325284-50325306 GATGGAGATGAGGAACTTGTTGG - Intergenic
1008681541 6:53877700-53877722 GTGGGAGATGAGGAACTTGTTGG - Intronic
1009019324 6:57934945-57934967 GAGGGAGATGAGGAATTTGTTGG + Intergenic
1009300215 6:62009176-62009198 GATGGAGATGAGGAACTTGTTGG + Intronic
1009396344 6:63204424-63204446 GATGGAGATGAGGAACTTGTTGG - Intergenic
1009480855 6:64156660-64156682 GATGGAGATGAGGAACTTGTTGG + Intronic
1009490597 6:64285414-64285436 GATGGAGATGAGGAACTTGTTGG - Intronic
1009532794 6:64842625-64842647 GATGGAGATGAGGAACTTGTTGG + Intronic
1009699667 6:67160274-67160296 GATGGAGATGAGGAACTTGTTGG + Intergenic
1009980562 6:70721383-70721405 GATGGAGATGAGGAACTTGTTGG - Intronic
1009982501 6:70742451-70742473 GATGGAGATGAGGAACTTGTTGG - Intronic
1010055050 6:71555650-71555672 GATGGAGATGAGGAACTTGTTGG + Intergenic
1010344905 6:74799979-74800001 GATGGAGATGAGGAACTTGTTGG + Intergenic
1010636177 6:78261347-78261369 GATGGAGATGAGGAACTTGTTGG - Intergenic
1010868122 6:81005747-81005769 GATGGAGATGAGGAACTTGTTGG + Intergenic
1010909624 6:81537199-81537221 GATGGAGATGAGGAACTTGTTGG - Intronic
1010981810 6:82377210-82377232 GATGGAGATGAGGAACTTGTTGG - Intergenic
1011041014 6:83030861-83030883 GATAGAGATGAGGAACTTGTTGG + Intronic
1011110541 6:83833053-83833075 GATGGAGATGAGGAACTTGTTGG + Intergenic
1011152651 6:84291006-84291028 GATGCAGATGAGGAACTTATTGG - Intergenic
1011170872 6:84503273-84503295 GATGGAGATGAGGAACTTGTTGG + Intergenic
1011237012 6:85228989-85229011 GATGGAGATGAGGAACTTGTTGG - Intergenic
1011553569 6:88551260-88551282 GAACCGGTTGAGGAGCTGGTGGG - Intergenic
1011784142 6:90825767-90825789 GATGGAGATGAGGAACTTGTTGG + Intergenic
1011845070 6:91552865-91552887 GATGGAGATGAGGAACTTGTTGG - Intergenic
1012019942 6:93905757-93905779 GATGGAGATGAGGAACTTGTTGG - Intergenic
1012074583 6:94668748-94668770 GAGGAAGATGAGGACCTTGTGGG + Intergenic
1012097260 6:94977915-94977937 GATGGAGATGAGGAACTTGTTGG - Intergenic
1012125917 6:95428030-95428052 GACGGAGATGAGGAACTTGTTGG + Intergenic
1012196081 6:96342671-96342693 GATGGAGATGAGGAACTTGTTGG - Intergenic
1012213835 6:96557528-96557550 GATGGAGATGAGGAACTTGTTGG - Intergenic
1012683145 6:102208987-102209009 GATGGAGATGAGGAACTTGTTGG + Intergenic
1012751315 6:103167464-103167486 GATGCAGATGAGGAACTTATTGG + Intergenic
1012823763 6:104123011-104123033 GATGGAGATGAGGAACTGATTGG + Intergenic
1013147073 6:107404193-107404215 GATGGAGATGAGGAACTTGTTGG - Intronic
1013148924 6:107425436-107425458 GATGGAGATGAGGAACTTGTTGG + Intronic
1013214656 6:108016251-108016273 GATGGAGATGAGGAACTTGTTGG - Intergenic
1013404515 6:109831114-109831136 GATGGAGATGAGGAACTTGTTGG + Intergenic
1013915804 6:115335728-115335750 GATGGAGATGAGGAACTTGTTGG + Intergenic
1014154109 6:118091848-118091870 GATGGAGATGAGGAACTTGTTGG + Intronic
1014327682 6:120019018-120019040 GATGGAGATGAGGAACTTGTTGG - Intergenic
1014406878 6:121063864-121063886 GATGGAGATGAGGAACTTGTTGG + Intergenic
1014576749 6:123082816-123082838 GACAGAGATGAGGAACTTGTTGG - Intergenic
1014581060 6:123137802-123137824 GATGGAGATGAGGAACTTGTTGG + Intergenic
1014649580 6:124018645-124018667 GATGGAGATGAGGAACTTGTTGG - Intronic
1014691599 6:124570001-124570023 GATGGAGATGAGGAACTAGTTGG + Intronic
1014714476 6:124848517-124848539 GATGGAGATGAGGAACTTGTTGG + Intergenic
1014883149 6:126747172-126747194 GATGGAGATGAGGAACTTGTTGG - Intergenic
1015013260 6:128376896-128376918 GATGGAGATGAGGAACTTGTTGG - Intronic
1015110795 6:129589415-129589437 GATGGAGATGAGGAACTTGTTGG - Intronic
1015130388 6:129802828-129802850 GATGGAGATGAGGAACTTGTTGG + Intergenic
1015494540 6:133866174-133866196 GACGGAGATGAGGAACTTGTTGG - Intergenic
1015523094 6:134151039-134151061 GATGGAGATGAGGAACTTGTTGG + Intergenic
1015674113 6:135725620-135725642 GATGGAGATGAGGAACTTGTTGG + Intergenic
1015677175 6:135762985-135763007 GATGGAGATGAGGAACTTGTTGG - Intergenic
1015853074 6:137594298-137594320 GATGGAGATGAGGAACTTGTTGG - Intergenic
1015901624 6:138074113-138074135 GAGGGAGATGAGAAACTTGTTGG + Intergenic
1016094045 6:140014408-140014430 GAGCCAGGGAAGGAACTGATTGG - Intergenic
1016106673 6:140171899-140171921 GATAGAGATGAGGAACTTGTTGG - Intergenic
1016108094 6:140187919-140187941 GATGGAGATGAGGAACTTGTTGG + Intergenic
1016124712 6:140385963-140385985 GAGGCCGATGAGGAACTTATTGG - Intergenic
1016230611 6:141799983-141800005 GATGGAGATGAGGAACTTGTTGG + Intergenic
1016253132 6:142071319-142071341 GATGGAGATGAGGAACTAGTTGG + Intronic
1016420105 6:143874216-143874238 GATGGAGATGAGGAACTTGTTGG - Intronic
1016424074 6:143915649-143915671 GATGGAGATGAGGAACTTGTTGG + Intronic
1016564968 6:145442074-145442096 GATGGAGATGAGGAACTTGTTGG - Intergenic
1016595335 6:145791599-145791621 GATGGAGATGAGGAACTTGTTGG - Intergenic
1016649678 6:146449127-146449149 GATGGAGATGAGGAACTTGTTGG - Intergenic
1017133446 6:151127998-151128020 GAAGGAGATGAGGAACTTGTTGG + Intergenic
1017378779 6:153802444-153802466 CAGCCAAATGAGGAGATGGTAGG - Intergenic
1017525477 6:155238237-155238259 GATGGAGATGAGGAACTTGTTGG - Intronic
1017938179 6:159025618-159025640 GAGGGAGATGAGGAACTTATTGG - Intergenic
1018031929 6:159848303-159848325 GATGGAGATGAGGAACTTGTTGG + Intergenic
1018477802 6:164160159-164160181 GATAGAGATGAGGAACTTGTTGG - Intergenic
1018510172 6:164516531-164516553 GATGGAGATGAGGAACTTGTTGG - Intergenic
1018510183 6:164516602-164516624 GATGGAGATGAGGAACTTGTTGG - Intergenic
1018585099 6:165349323-165349345 GATGTAGATGAGGAACTTGTTGG + Intronic
1018721483 6:166576481-166576503 GATGGAGATGAGGAACTTGTTGG + Intronic
1018748278 6:166779747-166779769 CAGGCAGAAGAGGAACTGGATGG + Intronic
1018922784 6:168187027-168187049 GAGAGAGATGAGGAACTTCTTGG - Intergenic
1019039280 6:169090222-169090244 GATGGAGATGAGGAACTTGTTGG + Intergenic
1019050845 6:169182363-169182385 GATGGAGATGAGGAACTTGTTGG - Intergenic
1019150503 6:170002408-170002430 GAGGGAAATGAGGAACTTGTTGG - Intergenic
1019155556 6:170036631-170036653 GATGGAGATGAGGAACTTGTTGG - Intergenic
1019159172 6:170057830-170057852 GAATCAGATGAGGACGTGGTCGG - Intergenic
1019205513 6:170358489-170358511 CAGCCAGATGAGGTACTAATAGG + Intronic
1019383409 7:740113-740135 AAGCCAGGTGAGGAAGCGGTGGG - Intronic
1020405654 7:7830911-7830933 TAGCCACATGAGGAAATGTTTGG - Intronic
1020584958 7:10054624-10054646 GATGGAGATGAGGAACTTGTTGG + Intergenic
1020607939 7:10361183-10361205 GATGGAGATGAGGAACTTGTTGG + Intergenic
1020712141 7:11620628-11620650 GAGACAGAGGAGGAAAGGGTAGG + Intronic
1020780828 7:12515706-12515728 GATGGAGATGAGGAACTTGTTGG + Intergenic
1020936522 7:14472751-14472773 GGTGGAGATGAGGAACTGGTTGG + Intronic
1020958712 7:14776054-14776076 GACGGAGATGAGGAACTGTTGGG + Intronic
1021753948 7:23833133-23833155 GATGGAGATGAGGAACTTGTTGG + Intergenic
1021882744 7:25110260-25110282 GATGGAGATGAGGAACTTGTTGG + Intergenic
1022244479 7:28545023-28545045 GAGGCAGATAAGGAATTGGAGGG + Intronic
1022596061 7:31714306-31714328 GATGGAGATGAGGAACTAGTTGG - Intergenic
1022678303 7:32521386-32521408 GATTGAGATGAGGAACTTGTTGG + Intronic
1022718594 7:32921966-32921988 GGTCCTGATGAGGAACTGGGAGG + Intergenic
1022817438 7:33927290-33927312 GAGACACCTGAGGACCTGGTGGG + Intronic
1022852836 7:34282791-34282813 GAGGGAGATGAGGAACTTCTTGG - Intergenic
1023406815 7:39842483-39842505 GATGGAGATGAGGAACTTGTTGG + Intergenic
1023650606 7:42365004-42365026 GATGGAGATGAGGAACTTGTTGG - Intergenic
1023786799 7:43716355-43716377 GATGGAGATGAGGAACTTGTTGG + Intronic
1023803908 7:43857828-43857850 GATGCAGATGAGGAACTTGTTGG + Intergenic
1024021506 7:45374797-45374819 GATGGAGATGAGGAACTTGTTGG - Intergenic
1024048481 7:45601298-45601320 GAGCCAGCTGAGAACCTGGCAGG - Intronic
1024138065 7:46430699-46430721 GATGGAGATGAGGAACTTGTTGG - Intergenic
1024413841 7:49079558-49079580 GATGGAGATGAGGAACTTGTTGG - Intergenic
1024438636 7:49388826-49388848 GATGGAGATGAGGAACTTGTTGG - Intergenic
1024670115 7:51586501-51586523 GAGTCAGGTGAGCAACTGGTTGG - Intergenic
1025038477 7:55618718-55618740 GATGGAGATGAGGAACTTGTTGG + Intergenic
1026278601 7:68902251-68902273 GATGGAGATGAGGAACTTGTTGG + Intergenic
1027279279 7:76594004-76594026 GATAGAGATGAGGAACTTGTTGG - Intergenic
1027458509 7:78423684-78423706 GATAGAGATGAGGAACTTGTTGG + Intronic
1027549472 7:79573355-79573377 GATATAGATGAGGAACTTGTTGG + Intergenic
1027785507 7:82574644-82574666 GACGGAGATGAGGAACTTGTGGG - Intergenic
1027798598 7:82723948-82723970 TTGCAAGGTGAGGAACTGGTTGG + Intergenic
1028032348 7:85932341-85932363 GATGGAGATGAGGAACTTGTTGG + Intergenic
1028048319 7:86151713-86151735 GATGGAGATGAGGAACTTGTTGG + Intergenic
1028084153 7:86616356-86616378 GATGGAGATGAGGAACTTGTTGG + Intergenic
1028098997 7:86797344-86797366 GATGGAGATGAGGAACTTGTTGG + Intronic
1028141087 7:87275255-87275277 GAGGGAGATGAGGAACTTATTGG - Intergenic
1028221306 7:88200390-88200412 GAGCCAAGTTAGGAACTGGCAGG + Intronic
1028291794 7:89074873-89074895 GATGGAGATGAGGAACTTGTTGG + Intronic
1029122704 7:98279402-98279424 GAGCCAGTAGAGGCTCTGGTAGG - Intronic
1030108571 7:106007615-106007637 GATGGAGATGAGGAACTTGTTGG - Intronic
1030127907 7:106171850-106171872 CAGACAGATGAGGCAGTGGTAGG + Intergenic
1030336631 7:108335382-108335404 CAGCCAGGTGAGGAATTGGAAGG - Intronic
1030510998 7:110481803-110481825 GATGGAGATGAGGAACTTGTTGG - Intergenic
1030527731 7:110673723-110673745 GATGGAGATGAGGAACTTGTTGG - Intronic
1030559176 7:111063790-111063812 GATAGAGATGAGGAACTTGTTGG - Intronic
1030752055 7:113240734-113240756 GAGGGAGATGAGGAACTTATTGG + Intergenic
1030784353 7:113641513-113641535 GATGGAGATGAGGAACTTGTTGG - Intergenic
1030786533 7:113670330-113670352 GATGGAGATGAGGAACTTGTTGG + Intergenic
1030904367 7:115163717-115163739 GATGGAGATGAGGAACTTGTTGG - Intergenic
1030966989 7:116005392-116005414 GAGGGAGATGAGGAACTTGTTGG + Intronic
1030986293 7:116245416-116245438 GATAGAGATGAGGAACTTGTTGG - Intronic
1031170819 7:118290332-118290354 GATGGAGATGAGGAACTTGTTGG + Intergenic
1031275305 7:119713337-119713359 GATGAAGATGAGGAACTTGTTGG - Intergenic
1031367847 7:120925139-120925161 GAGCAAGTTGAGGATCTGATGGG - Intergenic
1031396998 7:121285655-121285677 GAGGGAGATGAGGAACTTGTTGG - Intronic
1031473081 7:122190800-122190822 GATGGAGATGAGGAACTAGTTGG + Intergenic
1031576221 7:123418393-123418415 GACGGAGATGAGGAACTTGTTGG - Intergenic
1031716013 7:125109605-125109627 GATGGAGATGAGGAACTTGTTGG - Intergenic
1032318187 7:130860583-130860605 GATGGAGATGAGGAACTTGTTGG + Intergenic
1032665881 7:134035887-134035909 AAGTCAGCTGAGGAACTGCTAGG - Intronic
1033072770 7:138220047-138220069 GATGGAGATGAGGAACTTGTTGG + Intergenic
1033130833 7:138744219-138744241 AAAGCAGATGAGGAAATGGTTGG - Intronic
1033224894 7:139553723-139553745 GATGGAGATGAGGAACTCGTTGG + Intergenic
1033256098 7:139803248-139803270 GACGGAGATGAGGAACTTGTTGG + Intronic
1033517881 7:142128051-142128073 GATGGAGATGAGGAACTTGTTGG + Intronic
1033735074 7:144214280-144214302 GATGGAGATGAGGAACTTGTAGG + Intergenic
1033747981 7:144336689-144336711 GATGGAGATGAGGAACTTGTAGG - Intergenic
1033760078 7:144428160-144428182 GAAGGAGATGAGGAACTTGTTGG - Intergenic
1034742780 7:153494265-153494287 GATGGAGATGAGGAACTTGTTGG + Intergenic
1034751132 7:153569904-153569926 GATGGAGATGAGGAACTTGTTGG - Intergenic
1034751756 7:153575519-153575541 GATAGAGATGAGGAACTTGTTGG + Intergenic
1034966587 7:155395136-155395158 GAGCCAGAGGAGGCACAGGGAGG + Exonic
1035518427 8:256204-256226 GATGGAGATGAGGAACTTGTTGG - Intergenic
1035708657 8:1696129-1696151 GAGTCAGAGGAGGTTCTGGTGGG - Intronic
1037117747 8:15246762-15246784 GATGGAGATGAGGAACTTGTTGG + Intergenic
1037281606 8:17247459-17247481 AAACCACATGAGGAGCTGGTGGG - Intronic
1037903392 8:22701434-22701456 CACCCAGGTGAGGAACTGGATGG + Intergenic
1038138953 8:24821973-24821995 GATGGAGATGAGGAACTTGTTGG + Intergenic
1039071299 8:33651462-33651484 GACGGAGATGAGGAACTTGTTGG + Intergenic
1039082425 8:33745961-33745983 GATGGAGATGAGGAACTTGTTGG - Intergenic
1039121858 8:34156878-34156900 GATGGAGATGAGGAACTTGTTGG + Intergenic
1039681053 8:39736815-39736837 GATGGAGATGAGGAACTTGTTGG + Intergenic
1040741261 8:50579165-50579187 GATGGAGATGAGGAACTTGTTGG + Intronic
1040836043 8:51732340-51732362 GATGGAGATGAGGAACTTGTTGG - Intronic
1041222871 8:55669551-55669573 GATGGAGATGAGGAACTTGTTGG + Intergenic
1041339007 8:56822282-56822304 GATGGAGATGAGGAACTTGTTGG + Intergenic
1041372563 8:57178097-57178119 GAGCGAGATGGGGAATTGGCTGG + Intergenic
1041894384 8:62907088-62907110 GATAGAGATGAGGAACTTGTTGG + Intronic
1041977694 8:63818241-63818263 GATGGAGATGAGGAACTTGTTGG - Intergenic
1042058071 8:64787446-64787468 GATGGAGATGAGGAACTTGTTGG - Intronic
1042080685 8:65047598-65047620 GATAGAGATGAGGAACTTGTTGG - Intergenic
1042181151 8:66088771-66088793 GACGGAGATGAGGAACTTGTTGG - Intronic
1042412428 8:68480643-68480665 GATGGAGATGAGGAACTTGTTGG + Intronic
1042466486 8:69134373-69134395 GATGGAGATGAGGAACTTGTTGG - Intergenic
1042602441 8:70511992-70512014 GAGGGAAATGAGGAACTTGTTGG + Intergenic
1042787619 8:72566952-72566974 GAGAATGATCAGGAACTGGTTGG + Intronic
1042922983 8:73938713-73938735 GATGGAGATGAGGAACTTGTTGG + Intergenic
1042992277 8:74654961-74654983 GATGGAGATGAGGAACTTGTTGG + Intronic
1043062283 8:75519201-75519223 GATGGAGATGAGGAACTTGTTGG - Intronic
1043065800 8:75568563-75568585 GAAGGAGATGAGGAACTTGTTGG - Intergenic
1043241340 8:77938978-77939000 GATGGAGATGAGGAACTTGTTGG - Intergenic
1043308139 8:78822938-78822960 GATGAAGATGAGGAACTTGTTGG + Intergenic
1043345741 8:79296188-79296210 GATGGAGATGAGGAACTTGTTGG + Intergenic
1043493106 8:80769615-80769637 GATGGAGATGAGGAACTTGTTGG - Intronic
1043584331 8:81749840-81749862 GATGGAGATGAGGAACTTGTTGG + Intronic
1043704456 8:83330958-83330980 GATGGAGATGAGGAACTTGTTGG - Intergenic
1043714617 8:83466591-83466613 GATGGAGATGAGGAACTTGTTGG + Intergenic
1043805986 8:84672226-84672248 GATGGAGATGAGGAACTTGTTGG - Intronic
1043993054 8:86780057-86780079 GATGGAGATGAGGAACTTGTTGG + Intergenic
1044127099 8:88472158-88472180 GACGGAGATGAGGAACTTGTAGG - Intergenic
1044228308 8:89744490-89744512 GATGGAGATGAGGAACTTGTTGG - Intergenic
1044279636 8:90340418-90340440 GATGGAGATGAGGAACTTGTTGG + Intergenic
1044282698 8:90375262-90375284 GATGGAGATGAGGAACTTGTTGG - Intergenic
1044303853 8:90615937-90615959 GATGGAGATGAGGAACTTGTTGG + Intergenic
1044324918 8:90848244-90848266 GAGGGAGATGAGGAACTTGCTGG - Intronic
1044444423 8:92257811-92257833 GAGAAAGATGAGGAAATTGTGGG + Intergenic
1044538316 8:93382316-93382338 GATGGAGATGAGGAACTTGTTGG - Intergenic
1044877136 8:96680852-96680874 GATGGAGATGAGGAACTTGTTGG + Intronic
1044887523 8:96794873-96794895 GATGGAGATGAGGAACTTGTTGG - Intronic
1045139713 8:99267212-99267234 GATGGAGATGAGGAACTTGTTGG + Intronic
1045214263 8:100130812-100130834 GATGGAGATGAGGAACTTGTTGG - Intronic
1045292705 8:100847604-100847626 GAGCCAGCAGAGGAGCTAGTGGG + Intergenic
1045922482 8:107547595-107547617 GATGGAGATGAGGAACTTGTTGG - Intergenic
1045940198 8:107729372-107729394 GATGGAGATGAGGAACTTGTTGG - Intergenic
1046004206 8:108459099-108459121 GATGGAGATGAGGAACTTGTTGG - Intronic
1046107353 8:109682401-109682423 GATGGAGATGAGGAACTTGTTGG + Intronic
1046122779 8:109866337-109866359 GAGCCAGAAGAGGAACAAGGAGG - Intergenic
1046129182 8:109946104-109946126 GATGGAGATGAGGAACTTGTTGG + Intergenic
1046300249 8:112277386-112277408 GATGGAGATGAGGAACTTGTTGG - Intronic
1046305226 8:112357171-112357193 GACAGAGATGAGGAACTTGTTGG + Intronic
1046377672 8:113408181-113408203 GAACCACATGGGGAACTGTTAGG - Intronic
1046452069 8:114406288-114406310 GATCAAGATGAGGAACTTGGTGG - Intergenic
1046506833 8:115147338-115147360 GATGGAGATGAGGAACTTGTTGG - Intergenic
1046533139 8:115472889-115472911 GATGGAGATGAGGAACTTGTTGG - Intronic
1046656252 8:116898623-116898645 GATGGAGATGAGGAACTTGTTGG + Intergenic
1046832608 8:118762840-118762862 AATCCAGATGAGGAATTGGATGG + Intergenic
1046882026 8:119319852-119319874 GATGGAGATGAGGAACTTGTTGG - Intergenic
1046917330 8:119691557-119691579 GATGGAGATGAGGAACTCGTCGG + Intergenic
1047067776 8:121305640-121305662 GAGCAAGAAGGGGAACTGGTAGG + Intergenic
1047153851 8:122295177-122295199 GATGGAGATGAGGAACTTGTTGG - Intergenic
1047195677 8:122719077-122719099 GAGGGAGATAAGGAACTTGTTGG + Intergenic
1047318157 8:123753571-123753593 GAGCCAGATCAGGGAGTGGTGGG - Intergenic
1047545567 8:125813230-125813252 GATGGAGATGAGGAACTTGTTGG + Intergenic
1048107596 8:131428168-131428190 GATGAAGATGAGGAACTTGTTGG - Intergenic
1048419252 8:134261037-134261059 GATGGAGATGAGGAACTTGTTGG + Intergenic
1048504918 8:135012540-135012562 GATGCAGATGAGAAACTTGTTGG + Intergenic
1048660833 8:136599389-136599411 GATAGAGATGAGGAACTTGTTGG + Intergenic
1048675229 8:136770581-136770603 GATGGAGATGAGGAACTTGTTGG - Intergenic
1048699938 8:137077492-137077514 GATGAAGATGAGGAACTTGTTGG + Intergenic
1048915765 8:139181533-139181555 GATGGAGATGAGGAACTTGTTGG + Intergenic
1048923278 8:139249689-139249711 GATGGAGATGAGGAACTTGTTGG + Intergenic
1050288560 9:4129957-4129979 GATGGAGATGAGGAACTTGTTGG + Intronic
1050849224 9:10263463-10263485 GATGGAGATGAGGAACTTGTTGG + Intronic
1050905012 9:10993241-10993263 GATGAAGATGAGGAACTTGTTGG + Intergenic
1050940446 9:11451266-11451288 GATGGAGATGAGGAACTTGTTGG + Intergenic
1050945329 9:11510379-11510401 GATGGAGATGAGGAACTTGTTGG + Intergenic
1051015772 9:12474365-12474387 GATGGAGATGAGGAACTTGTTGG + Intergenic
1051309711 9:15757288-15757310 GATGGAGATGAGGAACTTGTAGG + Intronic
1051450756 9:17194520-17194542 GATGGAGATGAGGAACTTGTTGG - Intronic
1051619381 9:19035710-19035732 GATAGAGATGAGGAACTTGTTGG + Intronic
1051644251 9:19251795-19251817 GATGGAGATGAGGAACTTGTTGG - Intronic
1051771486 9:20584207-20584229 GATGGAGATGAGGAACTTGTTGG - Intronic
1051860907 9:21623771-21623793 GATGGAGATGAGGAACTTGTTGG - Intergenic
1051957374 9:22712625-22712647 GAGGGAGATGAGGAACTTGTTGG + Intergenic
1052019285 9:23507658-23507680 GATGGAGATGAGGAACTTGTTGG + Intergenic
1052351859 9:27466303-27466325 GATGGAGATGAGGAACTTGTTGG - Intronic
1052596055 9:30559734-30559756 GATGGAGATGAGGAACTTGTTGG - Intergenic
1052637357 9:31122118-31122140 GATGGAGATGAGGAACTTGTTGG - Intergenic
1052768028 9:32661214-32661236 GATGGAGATGAGGAACTTGTTGG - Intergenic
1053571867 9:39318254-39318276 GATGGAGATGAGGAACTTGTTGG + Intergenic
1053879323 9:42576018-42576040 GACGGAGATGAGGAACTTGTTGG - Intergenic
1053893336 9:42718340-42718362 GATGGAGATGAGGAACTTGTTGG + Intergenic
1054093421 9:60876965-60876987 GATGGAGATGAGGAACTTGTTGG + Intergenic
1054114904 9:61152885-61152907 GATGGAGATGAGGAACTTGTTGG + Intergenic
1054125278 9:61300757-61300779 GATGGAGATGAGGAACTTGTTGG - Intergenic
1054232366 9:62525679-62525701 GACGGAGATGAGGAACTTGTTGG + Intergenic
1054592852 9:67029649-67029671 GATGGAGATGAGGAACTTGTTGG - Intergenic
1055083576 9:72291349-72291371 GATGGAGATGAGGAACTTGTTGG - Intergenic
1055264039 9:74475291-74475313 GATGGAGATGAGGAACTTGTTGG + Intergenic
1055595818 9:77863385-77863407 GATGGAGATGAGGAACTTGTTGG - Intronic
1055713414 9:79089656-79089678 GATGGAGATGAGGAACTTGTTGG - Intergenic
1055714985 9:79108036-79108058 GATGGAGATGAGGAACTTGTTGG + Intergenic
1055858886 9:80724733-80724755 GATGGAGATGAGGAACTTGTTGG - Intergenic
1055976070 9:81956303-81956325 GATGGAGATGAGGAACTTGTTGG - Intergenic
1056069105 9:82967511-82967533 GAGCAGGATGAGGAGATGGTTGG - Intergenic
1056092134 9:83215940-83215962 GATACAGATAAGGAACTTGTTGG + Intergenic
1056133480 9:83608221-83608243 GATGGAGATGAGGAACTTGTTGG + Intergenic
1056283854 9:85068827-85068849 GATGGAGATGAGGAACTTGTTGG + Intergenic
1056595077 9:88001371-88001393 GATGGAGATGAGGAACTTGTTGG + Intergenic
1057312812 9:93952421-93952443 GGTCCATATGAGGAAATGGTGGG + Intronic
1057645013 9:96865803-96865825 GATGGAGATGAGGAACTTGTTGG + Intronic
1058004660 9:99902450-99902472 GATAGAGATGAGGAACTTGTTGG - Intergenic
1058101711 9:100924382-100924404 GAGGGAGATGAGGAACTTGTTGG + Intergenic
1058230253 9:102416650-102416672 GATAAAGATGAGGAACTTGTTGG + Intergenic
1058246008 9:102626131-102626153 GATGGAGATGAGGAACTTGTTGG - Intergenic
1058481652 9:105401985-105402007 TAGCCAGATGATGAAGGGGTGGG + Intronic
1058834586 9:108849665-108849687 GATGGAGATGAGGAACTTGTTGG - Intergenic
1059458627 9:114415480-114415502 GAGACAGCTGAGGAGCTGGTGGG - Intronic
1059482429 9:114601764-114601786 GATGGAGATGAGGAACTTGTTGG - Intergenic
1059565652 9:115380995-115381017 GATGGAGATGAGGAACTTGTTGG - Intronic
1059581811 9:115557100-115557122 GATAGAGATGAGGAACTTGTTGG - Intergenic
1059986202 9:119823046-119823068 GATGGAGATGAGGAACTTGTTGG + Intergenic
1060964309 9:127704011-127704033 GAGCCAGACTAGGAGCTGGGAGG + Intronic
1061750984 9:132776859-132776881 AAGCCGGATAAGGAAGTGGTTGG - Intronic
1062173341 9:135147586-135147608 GAGCCAGAGGAGGAGGAGGTCGG - Intergenic
1185608599 X:1380961-1380983 GTCCCAGATGATGAGCTGGTCGG + Intronic
1186704703 X:12128919-12128941 GATGGAGATGAGGAACTTGTTGG - Intergenic
1186797733 X:13062945-13062967 GATGGAGATGAGGAACTTGTTGG - Intergenic
1187214579 X:17264227-17264249 GATAGAGATGAGGAACTTGTTGG + Intergenic
1187628759 X:21144867-21144889 GATGCAGATGAGGAACTTATTGG - Intergenic
1187643491 X:21319934-21319956 GATGGAGATGAGGAACTTGTTGG - Intergenic
1187667479 X:21629157-21629179 GACGGAGATGAGGAACTTGTGGG - Intronic
1187796274 X:23007302-23007324 GATGGAGATGAGGAACTTGTTGG - Intergenic
1188047935 X:25449642-25449664 GATGGAGATGAGGAACTTGTTGG + Intergenic
1188134806 X:26482920-26482942 GATGGAGATGAGGAACTTGTTGG + Intergenic
1188155547 X:26737402-26737424 GATGAAGATGAGGAACTTGTTGG - Intergenic
1188162271 X:26818816-26818838 GAGGGAGATGAAGAACTTGTTGG + Intergenic
1188169833 X:26911166-26911188 GATGGAGATGAGGAACTTGTTGG + Intergenic
1188187397 X:27131412-27131434 GATGGAGATGAGGAACTTGTTGG - Intergenic
1188196319 X:27239807-27239829 GATCGAGATGAGGAACTTGTTGG + Intergenic
1188325614 X:28797584-28797606 GATGGAGATGAGGAACTTGTTGG - Intronic
1188449485 X:30294411-30294433 GATGGAGATGAGGAACTTGTTGG + Intergenic
1188513433 X:30960357-30960379 GAGGCAGATGAGGATCTGGGAGG + Intronic
1188662438 X:32776143-32776165 GATGGAGATGAGGAACTTGTTGG - Intronic
1188753909 X:33936736-33936758 GATAGAGATGAGGAACTTGTTGG - Intergenic
1188781727 X:34294398-34294420 GATGGAGATGAGGAACTTGTTGG + Intergenic
1188794296 X:34442673-34442695 GATGGAGATGAGGAACTTGTTGG - Intergenic
1188857093 X:35209773-35209795 GATAGAGATGAGGAACTTGTTGG - Intergenic
1188997521 X:36904304-36904326 GATGGAGATGAGGAACTTGTTGG + Intergenic
1189088132 X:38048229-38048251 GATGGAGATGAGGAACTTGTTGG - Intronic
1189377390 X:40476192-40476214 GAGGGAGAGGAGGAAATGGTGGG - Intergenic
1189390345 X:40570985-40571007 GAGACAGAAGCGGAGCTGGTGGG + Intergenic
1189788636 X:44582766-44582788 GATGGAGATGAGGAACTTGTTGG + Intergenic
1190513369 X:51196296-51196318 GATGGAGATGAGGAACTTGTTGG - Intergenic
1190531903 X:51386811-51386833 GATGGAGATGAGGAACTTGTTGG - Intergenic
1191020916 X:55859201-55859223 GATGCAGATGAGGAACTTGTTGG - Intergenic
1191116504 X:56858386-56858408 GATGGAGATGAGGAACTTGTAGG - Intergenic
1191188507 X:57639615-57639637 GATAGAGATGAGGAACTTGTTGG + Intergenic
1191746274 X:64491451-64491473 GATGGAGATGAGGAACTTGTTGG + Intergenic
1191784088 X:64898381-64898403 GATGGAGATGAGGAACTTGTTGG - Intergenic
1192162382 X:68798149-68798171 GATGGAGATGAGGAACTTGTTGG + Intergenic
1192278870 X:69662803-69662825 GATGGAGATGAGGAACTTGTTGG + Intronic
1192334889 X:70210245-70210267 GATGGAGATGAGGAACTTGTTGG + Intergenic
1192501430 X:71656085-71656107 GATGGAGATGAGGAACTTGTTGG - Intergenic
1192676655 X:73203534-73203556 GATGGAGATGAGGAACTTGTTGG - Intergenic
1193083279 X:77426192-77426214 GAACCAGCTGGGGAACTGCTAGG - Intergenic
1193183364 X:78484104-78484126 GATGGAGATGAGGAACTTGTTGG - Intergenic
1193226381 X:78989113-78989135 GATGGAGATGAGGAACTTGTTGG + Intergenic
1193246628 X:79237569-79237591 GATGGAGATGAGGAACTTGTTGG - Intergenic
1193501163 X:82276434-82276456 GAGTGAGATGAGGAACTTGTTGG - Intergenic
1193529931 X:82643819-82643841 GATGGAGATGAGGAACTTGTTGG - Intergenic
1193541924 X:82782596-82782618 GATGAAGATGAGGAACTTGTTGG - Intergenic
1193678297 X:84483941-84483963 GATGAAGATGAGGAACTTGTTGG - Intronic
1193707961 X:84845526-84845548 GATGGAGATGAGGAACTTGTTGG - Intergenic
1193796852 X:85887731-85887753 GACGGAGATGAGGAACTTGTTGG + Intronic
1193807862 X:86015668-86015690 GATGGAGATGAGGAACTTGTTGG + Intronic
1193813820 X:86082595-86082617 GATGGAGATGAGGAACTTGTTGG - Intergenic
1194042664 X:88961697-88961719 GATGGAGATGAGGAACTTGTTGG + Intergenic
1194073645 X:89360782-89360804 GAGCCAGGTGAGGGACTGTAGGG + Intergenic
1194082978 X:89490658-89490680 GATGGAGATGAGGAACTTGTTGG - Intergenic
1194092933 X:89600722-89600744 GATGGAGATGAGGAACTTGTTGG - Intergenic
1194215879 X:91129579-91129601 GATGGAGATGAGGAACTTGTTGG - Intergenic
1194216170 X:91132910-91132932 GATGGAGATGAGGAACTTGTTGG + Intergenic
1194256843 X:91645566-91645588 GATGAAGATGAGGAACTTGTTGG + Intergenic
1194274183 X:91858745-91858767 GATGGAGATGAGGAACTTGTTGG - Intronic
1194302425 X:92204482-92204504 GATGGAGATGAGGAACTTGTTGG - Intronic
1194339430 X:92691233-92691255 GATGGAGATGAGGAACTTGTTGG + Intergenic
1194339896 X:92694760-92694782 GAGCGAGATGGGAAACTTGTTGG - Intergenic
1194389539 X:93299479-93299501 GATGGAGATGAGGAACTTGTTGG + Intergenic
1194397619 X:93404686-93404708 GATGGAGATGAGGAACTTGTTGG - Intergenic
1194466985 X:94245605-94245627 GATGGAGATGAGGAACTTGTTGG + Intergenic
1194522402 X:94935347-94935369 GATGAAGATGAGGAACTTGTGGG + Intergenic
1194527092 X:94990152-94990174 GATGGAGATGAGGAACTTGTTGG - Intergenic
1194548603 X:95269459-95269481 GATAAAGATGAGGAACTTGTTGG - Intergenic
1194566339 X:95493787-95493809 GATGGAGATGAGGAACTTGTTGG + Intergenic
1194779759 X:98010342-98010364 GAGGGAGATGAGGAACTTCTTGG + Intergenic
1194829042 X:98597648-98597670 GATGAAGATGAGGAACTTGTTGG - Intergenic
1194841804 X:98752846-98752868 GATGGAGATGAGGAACTTGTTGG - Intergenic
1195195998 X:102498546-102498568 GATGGAGATGAGGAACTTGTTGG + Intergenic
1195522855 X:105850744-105850766 GATAGAGATGAGGAACTTGTTGG - Intronic
1195536225 X:106012228-106012250 GATGGAGATGAGGAACTTGTTGG + Intergenic
1195615686 X:106910030-106910052 GAGCCAGGGGAGGAGCTGGATGG - Intronic
1195821993 X:108955928-108955950 GATGGAGATGAGGAACTTGTTGG + Intergenic
1196012700 X:110905410-110905432 GATGGAGATGAGGAACTTGTTGG - Intergenic
1196136974 X:112220782-112220804 GATGGAGATGAGGAACTTGTTGG - Intergenic
1196169715 X:112574220-112574242 GATGGAGATGAGGAACTTGTTGG + Intergenic
1196173562 X:112616382-112616404 GATGGAGATGAGGAACTTGTTGG + Intergenic
1196391244 X:115209819-115209841 GATGGAGATGAGGAACTTGTTGG + Intronic
1196503257 X:116410643-116410665 GATGGAGATGAGGAACTTGTTGG + Intergenic
1196512906 X:116533098-116533120 GATGGAGATGAGGAACTTGTTGG - Intergenic
1196558723 X:117121672-117121694 GATGGAGATGAGGAACTTGTTGG - Intergenic
1197061390 X:122185356-122185378 GATGGAGATGAGGAACTTGTTGG - Intergenic
1197074827 X:122341654-122341676 GATGGAGATGAGGAACTTGTTGG - Intergenic
1197413142 X:126142679-126142701 GATGGAGATGAGGAACTTGTTGG - Intergenic
1197426555 X:126304459-126304481 GATGGAGATGAGGAACTTGTTGG + Intergenic
1197464191 X:126783526-126783548 GATGGAGATGAGGAACTTGTTGG + Intergenic
1197466126 X:126806527-126806549 GATGGAGATGAGGAACTTGTTGG + Intergenic
1197527099 X:127576942-127576964 GATGGAGATGAGGAACTTGTTGG - Intergenic
1197536107 X:127690949-127690971 GATGGAGATGAGGAACTTGTGGG + Intergenic
1197561317 X:128025304-128025326 GATGGAGATGAGGAACTTGTTGG - Intergenic
1197676448 X:129335638-129335660 GATGGAGATGAGGAACTTGTTGG + Intergenic
1197914479 X:131520440-131520462 GAGGGAGATAAGGAACTTGTTGG + Intergenic
1198274583 X:135088919-135088941 GATGGAGATGAGGAACTTGTTGG + Intergenic
1198707135 X:139461702-139461724 GATGGAGATGAGGAACTTGTTGG + Intergenic
1198734529 X:139771627-139771649 GACAGAGATGAGGAACTTGTTGG + Intronic
1198835123 X:140796360-140796382 GATAGAGATGAGGAACTTGTTGG - Intergenic
1198888270 X:141362823-141362845 GATGGAGATGAGGAACTTGTTGG - Intergenic
1198941918 X:141965491-141965513 GATGGAGATGAGGAACTTGTTGG + Intergenic
1198951770 X:142080210-142080232 GATGGAGATGAGGAACTTGTTGG - Intergenic
1198996284 X:142577763-142577785 GATAAAGATGAGGAACTTGTTGG + Intergenic
1199002957 X:142662317-142662339 GATGGAGATGAGGAACTTGTTGG + Intergenic
1199060631 X:143351503-143351525 GATGGAGATGAGGAACTTGTTGG - Intergenic
1199066587 X:143426024-143426046 GATGGAGATGAGGAACTTGTTGG + Intergenic
1199203934 X:145125117-145125139 GATGGAGATGAGGAACTTGTTGG - Intergenic
1199283836 X:146034490-146034512 GAGTCAGATGAGGAAGGGGAAGG + Intergenic
1199325365 X:146492710-146492732 GATGGAGATGAGGAACTTGTTGG + Intergenic
1199335999 X:146619806-146619828 GAGCCAGGAGATGAACTGGCGGG + Intergenic
1199362971 X:146944046-146944068 GATGGAGATGAGGAACTTGTTGG - Intergenic
1199458788 X:148059968-148059990 GATGGAGATGAGGAACTTGTTGG - Intergenic
1199462562 X:148100588-148100610 GATGGAGATGAGGAACTTGTTGG + Intergenic
1199476655 X:148253989-148254011 GATGGAGATGAGGAACTTGTTGG + Intergenic
1199569462 X:149252984-149253006 GATGGAGATGAGGAACTTGTTGG - Intergenic
1199868864 X:151878370-151878392 GATGGAGATGAGGAACTTGTTGG - Intergenic
1200008627 X:153104909-153104931 GATGGAGATGAGGAACTTGTTGG + Intergenic
1200039646 X:153355879-153355901 GAGGCAGACAAGGAACTGGCAGG + Intronic
1200039932 X:153357644-153357666 GATGGAGATGAGGAACTTGTTGG + Intronic
1200149133 X:153942910-153942932 GAGGCAGATGAGGAGCTGGCGGG - Exonic
1200233695 X:154458411-154458433 GAGCCAGCGGAGGGACAGGTAGG + Exonic
1200296336 X:154924408-154924430 GATAGAGATGAGGAACTTGTTGG + Intronic
1200381520 X:155842405-155842427 GATGGAGATGAGGAACTTGTTGG + Intergenic
1200435630 Y:3146531-3146553 GATGGAGATGAGGAACTTGTTGG - Intergenic
1200445571 Y:3256825-3256847 GATGGAGATGAGGAACTTGTTGG - Intergenic
1200575562 Y:4884831-4884853 GATGAAGATGAGGAACTTGTTGG + Intergenic
1200591419 Y:5080152-5080174 GATGGAGATGAGGAACTTGTTGG - Intronic
1200605677 Y:5261438-5261460 GATGAAGATGAGGAACTTGTTGG + Intronic
1200647815 Y:5808014-5808036 GATGGAGATGAGGAACTTGTTGG + Intergenic
1200648283 Y:5811543-5811565 GAGCGAGATGGGAAACTTGTTGG - Intergenic
1200729026 Y:6712349-6712371 GAGCCAGGTGAGGGACTGTAGGG + Intergenic
1201990063 Y:20014188-20014210 GATGGAGATGAGGAACTTGTTGG + Intergenic
1202091304 Y:21193778-21193800 GATGGAGATGAGGAACTTGTTGG + Intergenic
1202282937 Y:23209190-23209212 GATGGAGATGAGGAACTTGTTGG + Intergenic
1202434611 Y:24823575-24823597 GATGGAGATGAGGAACTTGTTGG + Intergenic