ID: 954322111

View in Genome Browser
Species Human (GRCh38)
Location 3:49839367-49839389
Sequence GAGCCACGAGGCAGAAGGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 3, 3: 14, 4: 176}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954322111_954322117 11 Left 954322111 3:49839367-49839389 CCAATCCTTCTGCCTCGTGGCTC 0: 1
1: 0
2: 3
3: 14
4: 176
Right 954322117 3:49839401-49839423 AGCTTTAAAGCACGCACTCCTGG 0: 1
1: 0
2: 1
3: 3
4: 67
954322111_954322118 19 Left 954322111 3:49839367-49839389 CCAATCCTTCTGCCTCGTGGCTC 0: 1
1: 0
2: 3
3: 14
4: 176
Right 954322118 3:49839409-49839431 AGCACGCACTCCTGGCACTAAGG 0: 1
1: 0
2: 0
3: 4
4: 77
954322111_954322119 20 Left 954322111 3:49839367-49839389 CCAATCCTTCTGCCTCGTGGCTC 0: 1
1: 0
2: 3
3: 14
4: 176
Right 954322119 3:49839410-49839432 GCACGCACTCCTGGCACTAAGGG 0: 1
1: 0
2: 1
3: 4
4: 60

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954322111 Original CRISPR GAGCCACGAGGCAGAAGGAT TGG (reversed) Intronic
900179441 1:1304837-1304859 AAGACAGGAGGCAGATGGATCGG + Intronic
902470593 1:16645609-16645631 CAGCCTCCAGCCAGAAGGATGGG + Intergenic
902751917 1:18521704-18521726 GAGCTTCGAGGGGGAAGGATGGG - Intergenic
906400584 1:45501383-45501405 GAGCCACTCAGCAGAAGGAATGG - Intronic
907391550 1:54161469-54161491 GGGCCAGGAGGCAGCAGGGTGGG + Intronic
909227235 1:73041507-73041529 GGGGCAAGAGGCAGGAGGATGGG - Intergenic
909314188 1:74195259-74195281 GAGCCATGAAGCACAAGGACTGG + Intronic
910366957 1:86476034-86476056 GAGCCATGAGGGAGGAGAATTGG + Intronic
911664663 1:100539350-100539372 GGGCCACGAGGCAGTGGGAGAGG - Exonic
912435033 1:109655923-109655945 CAGCCGAGAGGCAGAAGGCTGGG + Intergenic
912507083 1:110163742-110163764 GAGCCCCGGGGCAGAATGAGAGG - Intronic
913052061 1:115126131-115126153 GAGAGAAGAGGCAGAAGGAGAGG + Intergenic
913978094 1:143481486-143481508 GTGACAAGAAGCAGAAGGATCGG - Intergenic
914072498 1:144307115-144307137 GTGACAAGAAGCAGAAGGATCGG - Intergenic
914106656 1:144659241-144659263 GTGACAAGAAGCAGAAGGATCGG + Intergenic
914446141 1:147752161-147752183 CAGCTACTAGGCAGTAGGATTGG - Intergenic
915791112 1:158672433-158672455 GAGCCAGGAAGTAGAAGTATGGG + Intronic
917319144 1:173760455-173760477 GAGCCATGAGACAGAAGCACAGG + Intronic
920539019 1:206763400-206763422 GAAGCACAAGGCAGAAGGAAGGG - Intergenic
920972609 1:210755506-210755528 CAGCCATGAGGCAGAAGGACTGG + Intronic
921628703 1:217407307-217407329 AATCCACAAGGCAGAAGGAAGGG - Intergenic
922439595 1:225642437-225642459 GAGCGATGAGGCAGAGGGATGGG + Intronic
922873166 1:228919222-228919244 GGGCCAGAAGGCAGAAGGAAGGG - Intergenic
924570683 1:245235003-245235025 GCTCCACCAGGCAGGAGGATGGG - Intronic
1067535607 10:47107621-47107643 GACCCAGGATGCAGAAGCATTGG + Intergenic
1068688033 10:59889298-59889320 GAGGCAGGAGGAAGATGGATAGG + Intronic
1070737170 10:78871099-78871121 GAGCCAGGAGGCAAAAGGATGGG - Intergenic
1070946782 10:80398649-80398671 GAGCCAGGAGGCTGAGGGAAGGG + Intergenic
1073601736 10:104852694-104852716 GAGCCAGAAGGAAGAAAGATGGG - Intronic
1076564579 10:131389376-131389398 GAGCAAGGAGGCAGGAGGCTGGG + Intergenic
1077223626 11:1428160-1428182 CAGCCACGACGCAGCAGGCTGGG - Intronic
1077353052 11:2101586-2101608 GTGCCATGAGGCAGCAGGAAGGG - Intergenic
1078353762 11:10617871-10617893 GAGACACCAGGTAAAAGGATAGG - Intronic
1078577398 11:12513743-12513765 GTCCCAAGAGGCAGAATGATAGG - Intronic
1078719708 11:13873115-13873137 GCACCCCGAGGCAGAAGGAGAGG - Intergenic
1079547060 11:21645315-21645337 GAGCCAAGAGGAAGAATCATTGG + Intergenic
1079722584 11:23836958-23836980 GAGACACGAGGCAGAAGAGGAGG - Intergenic
1080305795 11:30833868-30833890 GAGCAAGTAGGCAGAGGGATGGG - Intronic
1080826383 11:35852454-35852476 GAGCTACAGGGCACAAGGATGGG + Intergenic
1083416176 11:62527207-62527229 GAGCCCCAAGGCAAAAGGAGAGG - Exonic
1084420427 11:69057958-69057980 GAGCCGGGAGGCAGAAGTCTTGG - Intronic
1084448525 11:69218399-69218421 GAGCCAGGAGCCAGGAGAATGGG + Intergenic
1088558713 11:111090363-111090385 GAGACAAGAGGCAGAAAGAGAGG - Intergenic
1089069702 11:115689880-115689902 GAGACATGAGGGAGAAGGAGGGG + Intergenic
1089347830 11:117802429-117802451 GAGCCAGGAGGCACCAGGCTAGG - Intronic
1091327457 11:134701746-134701768 GGGCCCCGAGGCAGCAGAATGGG + Intergenic
1091998298 12:5012782-5012804 GGGCCCAGAGGCAGAAGGAAGGG - Intergenic
1093194173 12:16110787-16110809 GAGCCTCTAGGCACAAGGCTTGG + Intergenic
1096520286 12:52181091-52181113 GATGCAAGAGGGAGAAGGATGGG - Intronic
1099147074 12:79059753-79059775 AAGCCCTGAGGCAGAGGGATGGG - Intronic
1099974303 12:89530285-89530307 GAGCCATTAGACAGAAAGATAGG - Intergenic
1100139557 12:91600404-91600426 GAGAGAGGAGGCAGAAGGAGAGG - Intergenic
1100505799 12:95218466-95218488 GAGCCCCGAGTCAGAAGAACTGG - Intronic
1101804152 12:108048774-108048796 GAGCCACGAGCCAGAAGGAAGGG + Intergenic
1101967897 12:109293422-109293444 GAGCCAGAAGGCAGAGTGATGGG - Intronic
1105914556 13:24901016-24901038 GAACAACGAGGCAGTGGGATAGG + Intronic
1107508655 13:41060512-41060534 GAGGCGGGAGGGAGAAGGATCGG + Intronic
1111184858 13:84720417-84720439 GAGCCAGGAGGGAGATGGAGTGG - Intergenic
1112756397 13:102639083-102639105 GTGCCACGAAGCAGAAAGAAGGG - Intronic
1117210947 14:53499011-53499033 GGGGCAAGAGACAGAAGGATGGG + Intergenic
1117656844 14:57964182-57964204 GAGCCATGAGGAAGAAAGAGAGG + Intronic
1117719978 14:58619679-58619701 GAGGCAGGAGGAAGAAGTATGGG - Intergenic
1119444618 14:74652821-74652843 GAGGCACCAGGCAGCAGGACTGG + Intergenic
1119749728 14:77068544-77068566 GAGAAATGAGGCAGAGGGATGGG + Intergenic
1125710722 15:41783646-41783668 GAGCCCCAAGCCAGATGGATTGG + Intronic
1127753237 15:62066852-62066874 CAGCCACGTGGCAGAGGGACAGG + Intergenic
1127913338 15:63436206-63436228 GAGACATAAGGCAGAAGGAGAGG - Intergenic
1129470805 15:75752358-75752380 GAGCCCAGAGCCAGGAGGATGGG + Intergenic
1133035646 16:3032679-3032701 GAGCCACCAGAAAGAAGGCTAGG + Intronic
1137794595 16:51204991-51205013 GAGCTACAATGCTGAAGGATTGG + Intergenic
1142242136 16:88952395-88952417 GTGCCCCGCGGGAGAAGGATTGG - Intronic
1142500079 17:327415-327437 GAGCAGGGAGGCAGAAGGAAGGG + Intronic
1142591495 17:1008085-1008107 GTCCCACGAGGCAGACGGAGAGG - Intronic
1143594148 17:7904316-7904338 GAGCCACGAAGCTGCAGGAGTGG + Intronic
1145017711 17:19410045-19410067 GAGCTAGGATGCAGAAGGGTTGG - Intergenic
1145266746 17:21383332-21383354 GAGCCCCGAGGCAGAGGGTCGGG - Intronic
1146156727 17:30530516-30530538 GAGCCAAAAGGCAGGAGGCTGGG - Intergenic
1146527292 17:33577826-33577848 GAGGCCCTAGGCAGAAGGGTAGG - Intronic
1147694474 17:42340912-42340934 GACCAACAAGGCAGAGGGATAGG - Intronic
1147802027 17:43098744-43098766 GAAGACCGAGGCAGAAGGATTGG - Intronic
1147980693 17:44272283-44272305 GAGCCAGGAGGCTGGAGGAGGGG + Intergenic
1147998300 17:44373632-44373654 GAGGCAAGAGGCCCAAGGATTGG - Intronic
1148534843 17:48430354-48430376 GAGCCCCACGGTAGAAGGATTGG + Intergenic
1151326832 17:73384922-73384944 GAGCAACGTGGCAGAGGGAGGGG - Intronic
1156521326 18:37724492-37724514 GAGCCCCAAGGCAGAAGGTACGG - Intergenic
1160223777 18:76996995-76997017 GAGCCCCGAGGCGGAAGGAGAGG - Intronic
1160564492 18:79778615-79778637 GAGCCCCGATGCAGAGGGAGAGG + Intergenic
1164644225 19:29845947-29845969 AAGCCAAGAGGCAGAAAGATCGG - Intergenic
1165649148 19:37470336-37470358 GAGCCAGGAGGAAGAAAGAATGG + Exonic
1167688574 19:50971322-50971344 GAGAGAGGAGGCAGAGGGATAGG - Intergenic
1168523122 19:57068509-57068531 GATCCACGCGTCAGCAGGATTGG + Intergenic
925169603 2:1743169-1743191 GAGCCGCGGGGCGGAGGGATGGG + Intronic
925901698 2:8513726-8513748 GAGCCACCAGGCAAAGGGAAAGG + Intergenic
926287485 2:11501277-11501299 GAGCTGAGAGGCAGAAGGGTGGG + Intergenic
926769288 2:16353674-16353696 GAACAAGGAGGCAGAAGGATGGG - Intergenic
930311494 2:49746239-49746261 GACCCAGGAGGGAGAAGGGTAGG + Intergenic
930635057 2:53795246-53795268 GAGCCAGGAGGCTGAGGTATAGG + Intronic
932875461 2:75446693-75446715 AAGGGAGGAGGCAGAAGGATAGG - Intergenic
933246746 2:79984750-79984772 GAGGTAGGAGGCAGAAGGATGGG - Intronic
934293091 2:91716683-91716705 GTGACAAGAAGCAGAAGGATCGG - Intergenic
934559136 2:95303288-95303310 GAGCCACGAGGCAAAATGTCCGG + Intronic
935186031 2:100733795-100733817 GAGCCACGTGAAAGAAGCATAGG - Intergenic
938100604 2:128495375-128495397 AAGCCACGAGGGAGAGGGAGGGG + Intergenic
938240822 2:129741251-129741273 GGGTCAGGAGGCAGAAGGAGGGG + Intergenic
938243746 2:129761941-129761963 GAATCACAAGGCAGAAGGAGGGG + Intergenic
938978482 2:136502902-136502924 AAGTCACAAGGCAGAAGGTTGGG - Intergenic
939246374 2:139629072-139629094 GAGCAACGAGGCAGGAAGACTGG - Intergenic
939981421 2:148786308-148786330 GAACCACGAACCAGAAAGATTGG + Exonic
942265586 2:174221589-174221611 GACACACGTGACAGAAGGATCGG - Intronic
942468235 2:176231369-176231391 GAGCCCCCAGGAAGAAGGACTGG - Intergenic
946068089 2:217007394-217007416 AAGCCACGAGCCAAAAGGAATGG - Intergenic
1169723388 20:8703011-8703033 GAGAGAGGAGGGAGAAGGATGGG + Intronic
1171219296 20:23380366-23380388 GAGCCAAGAGGCAAAAAGACAGG - Intronic
1172393096 20:34579755-34579777 GAGGCACAAAGAAGAAGGATGGG - Intronic
1172404713 20:34679384-34679406 GAGCCTCCAAGCAGAAGGAACGG + Intergenic
1173421627 20:42906368-42906390 GAGCCATGAGGGAGATGGAGTGG - Intronic
1175312549 20:58021670-58021692 CACCCACAAGGCAGAATGATAGG + Intergenic
1176033481 20:63025088-63025110 GGGCTCCGAAGCAGAAGGATGGG + Intergenic
1176040081 20:63060676-63060698 GAGCCCCGAGGCAGGAGGCTGGG - Intergenic
1179266975 21:39812468-39812490 GAAGCACCAGGCAGAAGGGTGGG - Intergenic
1179426628 21:41284570-41284592 TAGTCAGGAGGCCGAAGGATGGG - Intergenic
1180072066 21:45441535-45441557 GAGCCACCGGGCAGCAGGACTGG - Intronic
1181359931 22:22326795-22326817 GAGCCACGTGTCAGCAGGAGAGG - Intergenic
1181369955 22:22408224-22408246 GAGCCACGTGTCAGCAGGAGAGG - Intergenic
1181807450 22:25383644-25383666 GAGCCACAGGGCAGAGGGAGAGG + Intronic
1181968978 22:26675878-26675900 GTTCCCAGAGGCAGAAGGATTGG + Intergenic
1182246355 22:28960898-28960920 GAGCCACTAGGCAGAAGCCAAGG - Intronic
1182796594 22:32995526-32995548 GTGCCACGTGGAGGAAGGATGGG - Intronic
1183063770 22:35350219-35350241 GAGCCAGGAGGGAGAGGGCTTGG - Intergenic
1183345993 22:37308161-37308183 GAGCCACCAGGGAGGAGGATAGG - Intronic
1183361568 22:37385775-37385797 GAGCCATGGGTCAGGAGGATAGG - Intronic
1184431078 22:44441845-44441867 GAGGCACGAGGGAGGAAGATGGG - Intergenic
950264289 3:11562909-11562931 GAGCCCCAAGGCACAAGGAGGGG + Intronic
953568190 3:44051133-44051155 GAACCACAAGGCAGAAGTTTTGG - Intergenic
954218124 3:49135628-49135650 GGCCCAGGAGGCAGAAGAATGGG - Intergenic
954298839 3:49688645-49688667 CAGCCTCCAGCCAGAAGGATGGG - Exonic
954322111 3:49839367-49839389 GAGCCACGAGGCAGAAGGATTGG - Intronic
954679977 3:52339947-52339969 GGGACAGGAGGCAGAAGGAAAGG - Intronic
962298120 3:134212518-134212540 GAGCCACGAGGCAGCAGGTTGGG + Intronic
967708864 3:192682796-192682818 GAGCCATGGGTCAGAAGGAGAGG + Intronic
969228602 4:5814771-5814793 GAGCCACTGGGCAGAGGGCTGGG - Intronic
970372294 4:15420138-15420160 GAGTGAGGAGGAAGAAGGATGGG - Intronic
976426953 4:84915163-84915185 GAGCCAGGAGAGAGAAGAATGGG + Intronic
977467346 4:97399288-97399310 CAGCCAAGAGGAAGAAAGATAGG - Intronic
980179779 4:129389495-129389517 GAGACATAAGGCAGATGGATGGG + Intergenic
982265924 4:153538334-153538356 TAGTTACGAAGCAGAAGGATAGG + Intronic
985216749 4:187661372-187661394 GGCCAACGAAGCAGAAGGATGGG - Intergenic
985727031 5:1522045-1522067 GAGCCAGGAGGGAGTAGGAAAGG + Intronic
993705240 5:91162242-91162264 GAGCTAGGAGACAGAAAGATAGG + Intronic
995192602 5:109334198-109334220 GAGGCTTGAGGCAGGAGGATTGG - Intergenic
996127754 5:119745857-119745879 AAGCCACAAGGCAAAAGGTTTGG - Intergenic
997269869 5:132527499-132527521 GGGCCACGAGGCAGCAAGTTAGG + Intergenic
997666677 5:135635036-135635058 GGGCCACCGGGAAGAAGGATGGG - Intergenic
997749858 5:136333608-136333630 TGGCCTGGAGGCAGAAGGATAGG + Intronic
1003502224 6:6712155-6712177 GAGCCACACGGCAGGAGGCTGGG + Intergenic
1006595367 6:35189169-35189191 GAGCCACCAGGTAGGAGGATCGG + Intergenic
1006893615 6:37451471-37451493 GAGCATGGAGGCAGAAGGATGGG - Intronic
1010571046 6:77475038-77475060 GGCACACGAGGCAGATGGATGGG + Intergenic
1016117421 6:140303965-140303987 GAGACAGGAGGCAGGAGGCTGGG - Intergenic
1018539217 6:164860006-164860028 GAGGCTCGTGGCAGAAAGATAGG - Intergenic
1018765735 6:166931687-166931709 AAGGCACGAGGCAGAAGCAGTGG - Intronic
1018918579 6:168154702-168154724 CATGCACAAGGCAGAAGGATGGG + Intergenic
1019918404 7:4148045-4148067 GAGCCACGAGGATGGAGGATGGG - Intronic
1023650034 7:42359817-42359839 GAACCAGGAGGCAAAAGGAAGGG - Intergenic
1023892313 7:44401922-44401944 CAGCCACCAGGCAGGAGGTTGGG - Intronic
1029578330 7:101418962-101418984 GAGCCAGAAGGCTGAAGGAAGGG - Intronic
1032542905 7:132718531-132718553 GAGACAGAAGGGAGAAGGATGGG - Intronic
1033304024 7:140211139-140211161 GAGGACCGAGGCAGGAGGATCGG + Intergenic
1034518292 7:151599387-151599409 GATGCAGGGGGCAGAAGGATTGG - Intronic
1034644799 7:152635947-152635969 GAGACAGGAAGCAGAAGGGTGGG - Intergenic
1036129558 8:6096606-6096628 GAGCCAGGAGGCTGCAGCATGGG - Intergenic
1036645175 8:10608121-10608143 GACCCAGGAGGCAGAAGGGGAGG - Exonic
1037312853 8:17575031-17575053 GAGCAAGGTGGCAGAAGAATGGG + Intergenic
1037768839 8:21787467-21787489 GAGCCCCGAGCCAGATGGGTGGG - Intronic
1040761037 8:50843911-50843933 GAGCCAGGTGACAGAAGGAATGG - Intergenic
1041020242 8:53631659-53631681 GGGCCAGGAGGCAGAGGGAGAGG + Intergenic
1044349275 8:91144489-91144511 GAGCCACAAGGGAGAGGGAAAGG - Intronic
1044610843 8:94090669-94090691 GGGGCAGGAGACAGAAGGATAGG - Intergenic
1044611029 8:94092140-94092162 GGGGCAGGAGACAGAAGGATAGG + Intergenic
1046800612 8:118422697-118422719 GAGCCATGAGGCAGGATCATAGG + Intronic
1048148394 8:131868213-131868235 GGGCCACGAGGCACAAGGCCTGG - Intergenic
1051022414 9:12559874-12559896 GAACCCAGAGGCAGAAGGGTTGG + Intergenic
1058672863 9:107375350-107375372 GAGCAAGGAGGAAGAGGGATAGG + Intergenic
1059409828 9:114124870-114124892 GAGCCACCAGGAAGCAGGATCGG - Intergenic
1059432631 9:114259212-114259234 GAGGGACGAGGGAGAGGGATGGG + Intronic
1059652616 9:116329200-116329222 GTGCCAAGAGTAAGAAGGATGGG + Intronic
1061724120 9:132572206-132572228 GAGCCACGAGGCAGAGAGCAGGG - Intronic
1062714523 9:138000516-138000538 CAGGCAGGAGGCAGAAAGATAGG - Intronic
1186852542 X:13594516-13594538 GAGGCAAGAGACAGAAGGAAGGG + Intronic
1189271131 X:39752740-39752762 GTGACACAGGGCAGAAGGATGGG + Intergenic
1191250265 X:58256848-58256870 CAGCGACGAGGCAGAAGGCTAGG + Intergenic
1191251470 X:58262073-58262095 CAGCCACGAGGCCGAGGGCTAGG + Intergenic
1191251756 X:58263259-58263281 GAGCAACGAGGCAGAGGGCTAGG + Intergenic
1194104353 X:89750664-89750686 GAGCCATGAGGCAAAAGCACCGG - Intergenic