ID: 954322112

View in Genome Browser
Species Human (GRCh38)
Location 3:49839372-49839394
Sequence AGAGGGAGCCACGAGGCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 493
Summary {0: 1, 1: 0, 2: 2, 3: 36, 4: 454}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954322112_954322119 15 Left 954322112 3:49839372-49839394 CCTTCTGCCTCGTGGCTCCCTCT 0: 1
1: 0
2: 2
3: 36
4: 454
Right 954322119 3:49839410-49839432 GCACGCACTCCTGGCACTAAGGG 0: 1
1: 0
2: 1
3: 4
4: 60
954322112_954322118 14 Left 954322112 3:49839372-49839394 CCTTCTGCCTCGTGGCTCCCTCT 0: 1
1: 0
2: 2
3: 36
4: 454
Right 954322118 3:49839409-49839431 AGCACGCACTCCTGGCACTAAGG 0: 1
1: 0
2: 0
3: 4
4: 77
954322112_954322117 6 Left 954322112 3:49839372-49839394 CCTTCTGCCTCGTGGCTCCCTCT 0: 1
1: 0
2: 2
3: 36
4: 454
Right 954322117 3:49839401-49839423 AGCTTTAAAGCACGCACTCCTGG 0: 1
1: 0
2: 1
3: 3
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954322112 Original CRISPR AGAGGGAGCCACGAGGCAGA AGG (reversed) Intronic
900599909 1:3498510-3498532 AGAGGCAGGCACGAGGGTGAGGG + Intronic
900779070 1:4605762-4605784 AGAAGGAGTCAGGAGGGAGATGG - Intergenic
900892395 1:5458738-5458760 AGAGGGACCCAGGAGGCAAGGGG + Intergenic
901259351 1:7860310-7860332 AGAAAGAGCCTCCAGGCAGATGG + Intergenic
901625498 1:10622306-10622328 AGAAGGAAACACAAGGCAGAAGG - Intronic
902595489 1:17506763-17506785 TGAGGTAGCCAAGAGGCACAGGG + Intergenic
902643081 1:17779188-17779210 AGAGGGGTCCAGGAGGGAGAGGG - Intronic
902643088 1:17779205-17779227 AGAGGGGTCCAGGAGGCAGAGGG - Intronic
902691040 1:18110243-18110265 AGAGGGAGATCCGAGGCAGCCGG + Intronic
902741378 1:18440956-18440978 AGGGTCAGCCAGGAGGCAGAAGG - Intergenic
902785022 1:18727742-18727764 AGAGGGAACCAGGAGTCAGGGGG + Intronic
902876320 1:19342955-19342977 AGGGAGACCCACGAGGCGGAAGG + Intronic
902881312 1:19373543-19373565 AGAGGGAGCCTCTGGGGAGACGG + Intronic
903594883 1:24486413-24486435 AGATGCAGCCACCAGGCAGGAGG + Intergenic
904463234 1:30692761-30692783 AGAGGAAGCAAGGAGGAAGAGGG + Intergenic
904602459 1:31681074-31681096 AGAGAGAGCCCAGAGTCAGAGGG + Intronic
906470820 1:46129104-46129126 AGAGGGAGGCAAGAGGAAGGAGG + Intronic
906635535 1:47407762-47407784 AGGTGGAGCCACCAGGGAGAGGG - Intergenic
910318691 1:85919368-85919390 AGATGGAGCCACAAGAAAGAGGG + Intronic
910336240 1:86134910-86134932 AGACAGATCCACGAGACAGAAGG - Intronic
910815880 1:91289859-91289881 AGAGGGAGACGAGAGGGAGAGGG + Intronic
911176307 1:94820957-94820979 AGAAGGAGCCCCTAGGCAAAGGG + Exonic
912122629 1:106491501-106491523 AGAGGGAAAGATGAGGCAGATGG + Intergenic
913078596 1:115361028-115361050 AGATGGGGCGACCAGGCAGAGGG + Intergenic
914019889 1:143856947-143856969 AGAGGGGGCCACGAGGCTCCGGG - Intergenic
914860477 1:151381782-151381804 TGAGGCAGGCAAGAGGCAGAAGG + Intergenic
915143441 1:153780594-153780616 AGAGACAGCTGCGAGGCAGAGGG - Intergenic
915445853 1:155974557-155974579 AGATGAAGACAGGAGGCAGAGGG + Intronic
915465816 1:156097313-156097335 AGAAGGAGCCACAAGGCATCCGG - Intronic
915510592 1:156384943-156384965 GAAGGGAGCCATGAGCCAGAAGG + Exonic
915861410 1:159449183-159449205 AGAGGGAGACAGTGGGCAGAGGG - Intergenic
917478765 1:175392109-175392131 AGAAGGAGACAAGAGGGAGAGGG + Intronic
917532123 1:175844788-175844810 AGAGGCAGACAGGAGTCAGAGGG - Intergenic
918253104 1:182722515-182722537 AGAAAGAGCCACCAGGCACAGGG - Intergenic
921183013 1:212646156-212646178 AGAGGGACCCAGAGGGCAGAAGG + Intergenic
922815654 1:228447006-228447028 AGAGGGCGCCAGGAGGCCGGTGG + Intergenic
923167161 1:231376836-231376858 AGAGAGAGCAATGTGGCAGAGGG + Intronic
923225870 1:231938315-231938337 AGGAGGAGCCATGAGGCAGAGGG + Intronic
923248188 1:232154216-232154238 AGATTCAGCCAGGAGGCAGAGGG - Intergenic
924165082 1:241272567-241272589 AGAGGGAGCCTGGATACAGATGG - Intronic
924224505 1:241909771-241909793 AGAGAGAGACAGGAGACAGATGG - Intergenic
924531892 1:244900524-244900546 AGAGGGAGTGGGGAGGCAGACGG + Intergenic
1062803473 10:397078-397100 AGAGATACCCACGTGGCAGATGG + Intronic
1062811576 10:470417-470439 AGAGAGAGGCACATGGCAGAGGG - Intronic
1063121811 10:3109877-3109899 AGAGAGACCCATGGGGCAGAGGG + Intronic
1063439595 10:6061995-6062017 AGAGGGAGTCCCCAGGTAGATGG - Intronic
1064296661 10:14084878-14084900 AGGGTCAGCCAGGAGGCAGAAGG - Intronic
1066060716 10:31721472-31721494 AGAGGGATCCTGGAGACAGAGGG - Intergenic
1066332303 10:34438021-34438043 AGAGGGAGTGAGGGGGCAGAGGG - Intronic
1067100086 10:43328815-43328837 AGAGGGAGACCAGAGGGAGAGGG - Intergenic
1067113623 10:43418338-43418360 AGAAGGGGTCACTAGGCAGAGGG - Intergenic
1067685336 10:48463497-48463519 GGAGGGAGGCAGGAGGCAGGCGG - Intronic
1067833139 10:49621715-49621737 AGAGGGAGCAGAGAGGGAGACGG - Intronic
1069733410 10:70634260-70634282 AGAGGGAGGAGTGAGGCAGAGGG + Intergenic
1070658238 10:78285884-78285906 AGAGGGAGGAAGGAGGAAGATGG - Intergenic
1070737172 10:78871104-78871126 ACAGGGAGCCAGGAGGCAAAAGG - Intergenic
1070814733 10:79315524-79315546 ACAGGGAGCCAGCAGGCAGGCGG + Exonic
1071353322 10:84768090-84768112 AGAGGGAGGCAAGATACAGAAGG + Intergenic
1071989708 10:91089447-91089469 AGGGGGAGCCAGGAGGTAGTGGG - Intergenic
1072230674 10:93411651-93411673 AGAGGCAGCCACAAGGGAAAAGG + Intronic
1072635716 10:97176565-97176587 AGCGGAAGGCAGGAGGCAGATGG - Intronic
1075095305 10:119467290-119467312 ATAGGGAGCCAGGGGGCAGCTGG + Intergenic
1075147303 10:119893026-119893048 AGAGGGTAGCTCGAGGCAGAAGG - Intronic
1077163280 11:1123218-1123240 AGAGAGAGAGAGGAGGCAGAGGG - Intergenic
1077163286 11:1123268-1123290 AGACAGAGACAAGAGGCAGAGGG - Intergenic
1077223628 11:1428165-1428187 AAAGGCAGCCACGACGCAGCAGG - Intronic
1078036652 11:7812709-7812731 AGACAGATCCACGAGACAGAAGG - Intergenic
1078560653 11:12368542-12368564 AGAGAGATCAACGAGACAGAAGG + Intergenic
1079099379 11:17531372-17531394 AGAGGAAGCCACCAGGCTGGAGG - Intronic
1079278177 11:19061264-19061286 AGAGGGAGAAACGTGACAGATGG - Intergenic
1080853313 11:36090423-36090445 AGAGGAACCCATGAGGCAGTAGG + Intronic
1081789695 11:45774248-45774270 AGAGGCAGCCCAGAGGCAGAAGG - Intergenic
1081847544 11:46251779-46251801 AGCTGGAGCCATGAAGCAGATGG - Intergenic
1081882463 11:46465256-46465278 CCAGGGAGTCAGGAGGCAGAAGG - Intronic
1081907691 11:46679901-46679923 AGAGGGAGGCAGGTGTCAGAGGG - Intronic
1081962815 11:47150795-47150817 CGAGGGAGGCAGGGGGCAGATGG + Intronic
1083864599 11:65446629-65446651 GAAGGGAGCCAGGAGACAGAGGG + Intergenic
1084343206 11:68523252-68523274 AGAGGAAGGCATGAGGCAGAGGG - Intronic
1084630965 11:70349201-70349223 TTAGGGAGCCACGAAGCAGCTGG - Intronic
1085175851 11:74487493-74487515 AGAGAGAGCCAAGAGGCAGTTGG - Intergenic
1087214576 11:95481795-95481817 AGAGGGAGACAAGAGGGAGAGGG - Intergenic
1087311375 11:96547597-96547619 AGACAGATCAACGAGGCAGAAGG + Intergenic
1087328006 11:96746849-96746871 TGGGGGAGCCAGAAGGCAGATGG - Intergenic
1087700330 11:101430156-101430178 GGTGAGAGCCAAGAGGCAGAAGG - Intergenic
1087788722 11:102384736-102384758 TGAGGGAGCCAGAAGGGAGATGG + Intergenic
1089152061 11:116371945-116371967 GGAGGGAGCAGAGAGGCAGAAGG - Intergenic
1089438472 11:118493185-118493207 AGAAGGAGTCAAGAGGAAGATGG + Exonic
1089812332 11:121142336-121142358 AGAGGGAGCTCAGAGGCAGGAGG - Intronic
1091578778 12:1766690-1766712 AAAGGGAGCAGGGAGGCAGAGGG - Intronic
1092751086 12:11719806-11719828 AGAGGAAGGAAGGAGGCAGAGGG - Intronic
1092979220 12:13777063-13777085 AGAGGGAGCCACTAGGTTAATGG - Intronic
1093655972 12:21694695-21694717 TGAGGGAGCCAGAAGGAAGATGG + Intronic
1094209242 12:27873328-27873350 AGAGGGAGACCGGAGGGAGACGG - Intergenic
1096546228 12:52341982-52342004 AGCAGGAGCCAGGATGCAGAGGG + Intergenic
1097182044 12:57177332-57177354 AGAGGGTGGGAGGAGGCAGATGG - Intronic
1097249690 12:57625710-57625732 AGCGGGAGCCAGGAGGCACTGGG + Exonic
1097591161 12:61576967-61576989 AGAGAGAGCTTCCAGGCAGAGGG + Intergenic
1097720637 12:63016629-63016651 AGAGGAAGCAACCAGGAAGAGGG + Intergenic
1099705257 12:86144067-86144089 AGAGGGAGCCACTAGGTGGCTGG + Intronic
1100103085 12:91133618-91133640 AGGTGGAGCCACAAGACAGAGGG + Intergenic
1100476323 12:94938968-94938990 AGAGAGAGCCACCAAGCAGCAGG + Intronic
1100788222 12:98101469-98101491 AGAGGGCACCATGAGTCAGAAGG + Intergenic
1102416632 12:112768370-112768392 AGAGGAAGCCAAGAGCCAGGTGG - Intronic
1103234695 12:119361189-119361211 AGAGGGAGACGAGAGGGAGAGGG + Intronic
1104450917 12:128867618-128867640 TGGGGGACCCCCGAGGCAGAGGG - Intronic
1104455792 12:128911240-128911262 AGAGGCAGCATCCAGGCAGAAGG - Intronic
1104670671 12:130677939-130677961 AGAGGGAGCCAGGTGGAGGAGGG - Intronic
1105304902 13:19161496-19161518 AGAGGGAGAGGTGAGGCAGAGGG + Intergenic
1105416243 13:20214381-20214403 AGAGTCAGTCAGGAGGCAGAGGG + Intergenic
1105426294 13:20297886-20297908 AGAGGGACTCAGGAGCCAGAGGG + Intergenic
1105594945 13:21828331-21828353 TGAGGGAGCCAAAAGGGAGATGG - Intergenic
1105826210 13:24125773-24125795 AAAAGGAACCAGGAGGCAGAAGG + Intronic
1105914555 13:24901011-24901033 AGAGAGAACAACGAGGCAGTGGG + Intronic
1106450826 13:29880507-29880529 AGGGGGAGCCAGGACGCACAGGG + Intergenic
1106684984 13:32049162-32049184 AGAGGGAGGGAAGAGGCTGAGGG + Intronic
1107360284 13:39610269-39610291 AGAGGGAACTGCGAGGCAGGTGG + Intergenic
1111156788 13:84338131-84338153 TGAGGGAGCCATAAGGGAGATGG + Intergenic
1111184859 13:84720422-84720444 ATGGGGAGCCAGGAGGGAGATGG - Intergenic
1113460618 13:110479596-110479618 AGTTGGAGCCCCGAGGCAGAGGG + Intronic
1114621815 14:24100702-24100724 AGTGGGAGCCAAGTGGCAGGAGG - Intronic
1115055914 14:29126168-29126190 AGAGCGGGCAAAGAGGCAGAAGG + Intergenic
1116950837 14:50877143-50877165 AGATGGACCCATGAGGCACAGGG - Intronic
1117204005 14:53422054-53422076 AGAGGAAGACAAGAAGCAGAAGG + Intergenic
1119139682 14:72255076-72255098 AGAGTGAGGCATGAGGCAGAGGG + Intronic
1119484243 14:74977836-74977858 AGAGGGAGGCCCCAGACAGAGGG - Intergenic
1122292752 14:100688348-100688370 GGAGGTAGCCAGGAAGCAGAGGG - Intergenic
1122386095 14:101349249-101349271 AGATGGCGGCAGGAGGCAGATGG - Intergenic
1122568716 14:102678211-102678233 AGAGGGAGACGAGAGGGAGAGGG + Intronic
1123155209 14:106218313-106218335 AGAGGAAGCCACAGGGCTGACGG + Intergenic
1124321866 15:28719089-28719111 AGAGCAAGCCACCGGGCAGAAGG - Intronic
1124522964 15:30420927-30420949 AGAGCAAGCCACTGGGCAGAAGG - Intergenic
1124535700 15:30545289-30545311 AGAGCAAGCCACCGGGCAGAAGG + Intergenic
1124762952 15:32462311-32462333 AGAGCAAGCCACCGGGCAGAAGG - Intergenic
1124775674 15:32586747-32586769 AGAGCAAGCCACCGGGCAGAAGG + Intergenic
1125205378 15:37148623-37148645 AAATGGAGGCAGGAGGCAGAAGG - Intergenic
1125361893 15:38873204-38873226 AGAGGGAGTCTGGAGGCAGTGGG - Intergenic
1125525466 15:40371382-40371404 AGAGGGAGGCACGGGGGAGATGG - Intergenic
1125710721 15:41783641-41783663 AGAGGGAGCCCCAAGCCAGATGG + Intronic
1126704845 15:51397421-51397443 AGAAGGAGGCAAGAGGTAGAAGG - Intronic
1127264274 15:57348951-57348973 GGAGGGTGCCGTGAGGCAGATGG - Intergenic
1127455162 15:59150335-59150357 ATAGGGAACCACATGGCAGAGGG + Intronic
1127725531 15:61745597-61745619 AGTGGGAGCCAGGAGGGAGAAGG - Intergenic
1129396118 15:75247984-75248006 GGAGGGAGCCAGGATGCAGCTGG + Intergenic
1130024884 15:80262289-80262311 GGAGGGAGCAAAGGGGCAGAGGG + Intergenic
1130267459 15:82420695-82420717 AGAGCAAGCCACGGGGCAGAAGG + Intergenic
1130504565 15:84526139-84526161 AGAGCAAGCCACGGGGCAGAAGG - Intergenic
1131086014 15:89576044-89576066 ACAGGGGGCCAGGAGGAAGACGG - Exonic
1132207148 15:99993944-99993966 AGAAGGAGCGAAGAGGCAGGGGG + Intronic
1132220430 15:100101113-100101135 AGAGGGAAGCAAGAGGGAGATGG - Intronic
1132654514 16:1036294-1036316 GGAGGGAGCGACGAGGAAGCTGG - Intergenic
1132699147 16:1214905-1214927 AGTGGGAGCCAGGGGGAAGAGGG + Intronic
1133210779 16:4262296-4262318 AGAGGGAGCCATGAAGGACAGGG + Intronic
1134109174 16:11503962-11503984 AAAGGCAGCCACCAGCCAGAGGG - Intronic
1134191081 16:12121669-12121691 AGATGCAGCCACAAGGCAGAGGG - Intronic
1134315216 16:13112773-13112795 AGTGGGAGCCATGAACCAGAGGG - Intronic
1136061177 16:27727524-27727546 AGAGGGAGCCCCGAGAGAGGAGG + Intronic
1136403543 16:30030869-30030891 GGAGGGAGCCACCAGGCAGGTGG + Exonic
1137407748 16:48203310-48203332 ACAGGGAGCCATAAGGCACAGGG + Intronic
1137456419 16:48621365-48621387 AGAGGAAGCCAAGAGCAAGAGGG + Intergenic
1137675905 16:50303838-50303860 AGAAGCAGCCAGGAGGAAGAGGG - Intronic
1138599468 16:58046243-58046265 AGAGGGAGGGAGGAGGCACAGGG - Exonic
1141503332 16:84459614-84459636 AGAGAGAGCATCCAGGCAGAGGG - Intronic
1142338919 16:89508244-89508266 TCAGGCAGCCACGAGGTAGACGG + Intronic
1142603193 17:1067256-1067278 AGAGGGAGCCATGAGCCAGAGGG + Intronic
1142713614 17:1736430-1736452 GGCGGGAGCCACGGGGCAGTGGG + Intronic
1142958167 17:3535210-3535232 GGAGGGAGGCAGGAGACAGAAGG - Intronic
1143635434 17:8161772-8161794 AGAAGGGCCCACGAGGCAGGGGG + Intronic
1143927203 17:10382422-10382444 AGAGGTAGGCAAGAGCCAGATGG + Intergenic
1143951844 17:10638748-10638770 AAAGGGAACCATGAGGCAGGTGG + Intronic
1144495899 17:15744578-15744600 AGAGGGTGTCAGGAGCCAGAGGG - Intronic
1144575953 17:16429665-16429687 AGTGGCTGCCACGAGCCAGAAGG + Intronic
1145266749 17:21383337-21383359 ACCAGGAGCCCCGAGGCAGAGGG - Intronic
1146299679 17:31678339-31678361 GGATGGACCCACGAGGCAAACGG + Intergenic
1148568430 17:48647348-48647370 AGAGGGAGGGGCGAGGCCGAAGG + Intergenic
1148697230 17:49567881-49567903 AGGAGGACCCACGAGGTAGAAGG - Intergenic
1149447405 17:56724316-56724338 GGAGGGTGCCTGGAGGCAGAGGG - Intergenic
1150005366 17:61465738-61465760 AGAGTGAGCAAGGGGGCAGAAGG - Intronic
1151319855 17:73346530-73346552 AGAAGGGGGCACCAGGCAGAGGG - Intronic
1151924707 17:77186457-77186479 AGCAGGTGCCAGGAGGCAGAAGG - Intronic
1151952488 17:77362922-77362944 TGAGGGGCCCACCAGGCAGAGGG + Intronic
1152434141 17:80264819-80264841 AGAGGGAGCCAAGAGGAATGGGG - Intronic
1152487760 17:80605824-80605846 AGAGGGAGCTCTGAGTCAGACGG + Intronic
1152618647 17:81349772-81349794 AGAGGGAGGAAAGAGCCAGAAGG + Intergenic
1152857757 17:82675891-82675913 AGAAGGACCCACGTAGCAGATGG - Intronic
1152879159 17:82805518-82805540 AGGGGCTGCCAGGAGGCAGAGGG + Intronic
1152897345 17:82920310-82920332 AGACCCAGCCACGTGGCAGAAGG - Intronic
1153263378 18:3245719-3245741 AGAGGGAGATGCCAGGCAGAGGG - Intergenic
1153505284 18:5790493-5790515 AGAGGGAGCCAGGAGGAATTGGG + Intergenic
1154219043 18:12436071-12436093 TGAGGGAGCCACTTGGCAGGGGG - Intergenic
1154219345 18:12438430-12438452 TGAGGGAGCCACTTGGCAGGGGG + Intergenic
1155229268 18:23757300-23757322 GATGGGAGCCACGAGGCAGCCGG - Intronic
1155615045 18:27712433-27712455 AGAGAGAGCCAGAAGGCAAAGGG + Intergenic
1156376757 18:36521640-36521662 AGAGAGACCCATGAGGCAGCTGG - Intronic
1157284862 18:46370766-46370788 AGAGGTTGACAGGAGGCAGAAGG + Intronic
1157827829 18:50828496-50828518 GGAGGGAGGCAGGAGGCAGGTGG + Intergenic
1158405125 18:57153802-57153824 TGTGGGAGCCACGAGGGAGGAGG - Intergenic
1158571221 18:58598378-58598400 TGATGGAGCCTGGAGGCAGACGG + Intronic
1158901989 18:61972578-61972600 AGAAGGAGGCAAGAGACAGAAGG + Intergenic
1159292420 18:66439870-66439892 TGATGGAGGCAGGAGGCAGATGG + Intergenic
1159836465 18:73342727-73342749 AGAGGGAGCGAGGAGGGAAAGGG + Intergenic
1160223778 18:76997000-76997022 AGTAGGAGCCCCGAGGCGGAAGG - Intronic
1160231699 18:77053969-77053991 GGAGGGGGCCAAGAGGAAGAAGG - Intronic
1161122144 19:2534587-2534609 GGAGGGGGCCATGAGGGAGATGG + Intronic
1161299909 19:3537607-3537629 TGAGGGAGCCAGGAGGCCGGGGG + Intronic
1161491831 19:4566606-4566628 ACAGGGAGCCACGGGGCTGGCGG + Intergenic
1161821701 19:6534016-6534038 ACAGGGAGCTAGGAGGGAGAGGG - Intronic
1161963774 19:7536462-7536484 AGAGGTATCCACGAGGGAGGAGG - Exonic
1163591055 19:18194310-18194332 AGAGGGAACCAGCGGGCAGAGGG + Intronic
1163690030 19:18733512-18733534 GGAGGGAGCAAGGAGGCAGCAGG + Intronic
1164081996 19:21866833-21866855 AGAGGGAGACCGGAGGGAGAGGG + Intergenic
1164102684 19:22071678-22071700 AGAAGGAGCCATGATGTAGAAGG - Intronic
1164155865 19:22596525-22596547 AGAGGGAGCCCAGAGGCAGCTGG - Intergenic
1164611700 19:29636796-29636818 AGAGGGAGGGATGTGGCAGAGGG - Intergenic
1164718663 19:30415158-30415180 AGAGGGAGACAGGGGGCAGGGGG - Intronic
1164898270 19:31896434-31896456 TGAGGCAGCCAAGAGGAAGAGGG + Intergenic
1164976443 19:32576191-32576213 AGGGGCAGTCACGAGGCAGAGGG - Intergenic
1165333124 19:35152387-35152409 AGAGGGAGCACTGAGGAAGACGG + Intronic
1165473540 19:36016840-36016862 AGAGGGATCCATAAGGCAGTTGG - Intronic
1165739473 19:38196750-38196772 GGGGGGAGCCAGGAGGCCGAGGG + Intronic
1165780879 19:38433697-38433719 AGAGGCACCCGCGAGGTAGATGG - Intronic
1165893488 19:39128336-39128358 AGAGAAAGCCAGGAGGCAGGTGG - Intronic
1165894982 19:39136146-39136168 CTAGGGGGCCACGAGGAAGAAGG - Intronic
1166067584 19:40369164-40369186 AGAGGGAGCCAGCAGGGAGTGGG - Intronic
1166557058 19:43707275-43707297 AGAGGGTGGGAGGAGGCAGAAGG - Intergenic
1166621610 19:44306272-44306294 AGGGGGAGCCAGAAGGGAGATGG + Intergenic
1168059348 19:53882557-53882579 AAAGGGGGCCCTGAGGCAGAAGG + Exonic
1168072509 19:53960792-53960814 TGAAGGAGCCACGGGGCAGCGGG + Intergenic
1168344774 19:55644786-55644808 AGAGGGAGCCAGGGGCCAGTGGG + Exonic
925899464 2:8498254-8498276 AGAGAGAGTCACGTGGCAGCAGG - Intergenic
925901697 2:8513721-8513743 AGCAGGAGCCACCAGGCAAAGGG + Intergenic
925973424 2:9124017-9124039 AGAGGAAGACACGAGGCTGGAGG - Intergenic
926625406 2:15085966-15085988 GGATGGAGGCAGGAGGCAGATGG + Intergenic
926769290 2:16353679-16353701 AGAGGGAACAAGGAGGCAGAAGG - Intergenic
928026087 2:27740059-27740081 AGAGGGAGAGACTGGGCAGACGG + Intergenic
929774608 2:44921159-44921181 ACAGGGGGCCAGGAGTCAGAGGG + Intergenic
930356211 2:50324147-50324169 AGAAGGAGACTAGAGGCAGAAGG + Intronic
931253111 2:60550723-60550745 AGATGGACCCAGGAGGGAGAGGG + Intronic
932094463 2:68835330-68835352 AGAGGGAAGCTGGAGGCAGAGGG + Intergenic
932121348 2:69103272-69103294 AGAGTGAGCCACTCGGTAGATGG - Intronic
932880994 2:75501903-75501925 AGAAGGAGCCATGATTCAGAAGG + Intronic
933398831 2:81765653-81765675 TGGGGGAGCCAGGAGGGAGATGG - Intergenic
933748923 2:85590806-85590828 AGAGAGAGACACCAGGCAGGAGG - Intronic
934220562 2:90078332-90078354 TGTGGGAGCCAGGAGGAAGATGG + Intergenic
934557933 2:95297238-95297260 GGAGGGAGCGAGGAGGCAGAGGG + Intergenic
934650922 2:96091062-96091084 AGAGGGGGACACCAGGAAGAGGG + Intergenic
934949937 2:98569391-98569413 AGGGGGCGCCACGCGTCAGAAGG + Intronic
935254987 2:101302109-101302131 AGAGGTATCTAAGAGGCAGATGG - Intronic
935332241 2:101985712-101985734 AGGGGCAGCCAGAAGGCAGATGG + Intergenic
936057025 2:109269077-109269099 CCATGGAGCCACGAGGCACAAGG + Intronic
936499084 2:113051533-113051555 AGAGGGTGCCACGGGGCTGAGGG + Intronic
937356516 2:121201322-121201344 ACAGGGAGCCTCCAGACAGATGG + Intergenic
938822130 2:134969370-134969392 AGAGGGAGACGAGAGGGAGAGGG + Intronic
938977702 2:136495311-136495333 AGAGGCAGCCACCAGCCAGATGG - Intergenic
940670901 2:156666587-156666609 AGGGTCAGCCACAAGGCAGAAGG - Intergenic
940830274 2:158457800-158457822 AGAGGGGCGCACTAGGCAGAGGG - Intronic
941748181 2:169109428-169109450 AGAGACAGCCAACAGGCAGAGGG + Intergenic
941846869 2:170142209-170142231 TGAGGGAGCCGCAATGCAGATGG + Intergenic
943866298 2:192928729-192928751 AGATGGATCAACGAGACAGAAGG - Intergenic
944119842 2:196229233-196229255 AGAGGGAGAAAAGAGGAAGAAGG - Intronic
944894060 2:204145991-204146013 AGAGGGAACCACTGGGGAGACGG - Intergenic
945795436 2:214357059-214357081 AGTGGGAGCCAGAAGACAGAAGG - Intronic
946107153 2:217381082-217381104 AGACGGAGCCAGGAGGGAGGAGG + Intronic
947592271 2:231392687-231392709 AGAGGGACCCCCAAAGCAGAAGG - Intergenic
948284104 2:236770604-236770626 AGAGGGATCCAAGGGGCAGGTGG + Intergenic
948562091 2:238861013-238861035 AGAGGAAGCCACCAGGGAGGAGG + Intronic
948586107 2:239020764-239020786 AGAGGGAGGCAGGAGGGGGACGG - Intergenic
1168840728 20:908454-908476 GGAGGGAGGCACTAGGAAGAAGG - Intronic
1169227382 20:3865143-3865165 AGAGCAAGGCAAGAGGCAGATGG - Intronic
1169449711 20:5701346-5701368 AGAGGGAGACCGGAGGGAGAGGG - Intergenic
1170848927 20:19986254-19986276 AGAGGGACCCACGATCCAGCTGG - Intronic
1171384211 20:24756762-24756784 TGGGGGAGCCACAAGGGAGACGG + Intergenic
1171388484 20:24786272-24786294 AAAGTGAGCCACGGGGCCGATGG + Intergenic
1171466164 20:25329290-25329312 AGAGGGAGCCATGAGAGAGTTGG - Intronic
1172621333 20:36320186-36320208 AGAGGGAGGCCCGGGGGAGAGGG - Intronic
1172778969 20:37424564-37424586 AGAGGGAGCCAGGAAGGAGAAGG + Intergenic
1173421628 20:42906373-42906395 TGAGGGAGCCATGAGGGAGATGG - Intronic
1173443223 20:43096050-43096072 AGAGGGAGAGAGGAGGCAGGTGG - Intronic
1173928450 20:46798505-46798527 AGAGAGAGGCAGGAGGCAGGAGG - Intergenic
1175661792 20:60819819-60819841 GGAGGGAGGCAGGAGGCAGGAGG - Intergenic
1175815649 20:61881932-61881954 AGAGGGAGACACAGGGGAGAAGG + Intronic
1175827459 20:61943862-61943884 AGGGGCGGCCACGGGGCAGACGG - Intergenic
1175827519 20:61944192-61944214 AGGGGCGGCCACGGGGCAGACGG - Intergenic
1176149309 20:63581279-63581301 AGAGGCGGCCACATGGCAGAGGG - Intergenic
1177197852 21:17921541-17921563 TGAAGGAGCCACTAGGAAGAAGG + Intronic
1177601295 21:23318254-23318276 TGAGGGAGCCAGAAGGGAGATGG + Intergenic
1178286277 21:31328052-31328074 AGAGGGAGCATCGAGGCAGAGGG - Intronic
1178463743 21:32827016-32827038 AAAGGGGGCCACTAGGCAAAAGG + Intergenic
1178708815 21:34896327-34896349 AGAGGGAGCAACCAAGGAGATGG + Intronic
1179169966 21:38965339-38965361 AGAGGAAGCCTCGAGGTAGCAGG - Intergenic
1179246558 21:39638491-39638513 TGGGGGAGCCAGGAGGGAGATGG - Intronic
1179266978 21:39812473-39812495 TGAGGGAAGCACCAGGCAGAAGG - Intergenic
1180037694 21:45258170-45258192 GGAGGGAGCCGTGAGGCAGGCGG + Intergenic
1180969819 22:19809357-19809379 TGAGGGAGCCAGAAGGGAGATGG - Intronic
1182711054 22:32323612-32323634 AGAGGGAGCCCAGGGGCTGAGGG + Intergenic
1183587775 22:38762841-38762863 AGGGGAGGCCATGAGGCAGAGGG - Intronic
1183831802 22:40422151-40422173 AGAGGCAGAGAGGAGGCAGAGGG + Intronic
1184038218 22:41928547-41928569 GGAGGGAGCCTGGGGGCAGAGGG + Intergenic
1184398586 22:44260486-44260508 AGAGGGAGCCCAGGGGCTGAGGG + Intronic
1185175331 22:49323112-49323134 AGAAGGAGCCCCAGGGCAGAGGG + Intergenic
949488948 3:4568716-4568738 AGAGGGAGCCAGGTGTCAGGCGG + Intronic
949804252 3:7936797-7936819 AGACAGAACAACGAGGCAGAAGG + Intergenic
950727446 3:14926059-14926081 AGAGGCAGCCACCTGGCAGGAGG - Exonic
950949336 3:16981137-16981159 AGAGGGAGACTCGGGGGAGAGGG + Intronic
951485083 3:23202447-23202469 AGGGCGAGCCAAAAGGCAGAAGG + Intergenic
951485419 3:23203695-23203717 ACAGGGAGAGAAGAGGCAGAAGG - Intronic
952003338 3:28810859-28810881 ATAGGGAGCCAGGAGGGGGATGG + Intergenic
952957540 3:38566308-38566330 AGTGGGAGCCAGTAGGCTGAAGG - Intronic
953193706 3:40712834-40712856 AGATGGATCCAGGAGGAAGAAGG + Intergenic
953829783 3:46286028-46286050 AGTGGAAGCCAAGATGCAGATGG - Intergenic
953885186 3:46711052-46711074 AATGGGAGCCAAGAGGCTGAGGG + Intergenic
954322112 3:49839372-49839394 AGAGGGAGCCACGAGGCAGAAGG - Intronic
954421200 3:50419950-50419972 AGAGGGTGCCACAGGGGAGAGGG + Intronic
954625979 3:52022136-52022158 CGAGGGAGAGACGAGACAGAGGG + Intergenic
954714531 3:52520551-52520573 TGAGGGAGGCCAGAGGCAGACGG + Intronic
955987711 3:64591810-64591832 AGAGAAAGCAACCAGGCAGAAGG + Intronic
957228746 3:77483327-77483349 ATAGGGAGCCAAGATACAGAAGG - Intronic
957942233 3:87019673-87019695 AGACAGATCCACGAGACAGAAGG + Intergenic
959269733 3:104192337-104192359 AGGGGGAGCCAGAAGGGAGATGG + Intergenic
959598081 3:108149321-108149343 AGCAGGAGCAAGGAGGCAGAGGG - Intergenic
960415797 3:117383403-117383425 TGAGGGAGCCAGAAGGGAGATGG - Intergenic
960787454 3:121389947-121389969 AGACAGATCCACGAGACAGAAGG - Intronic
961423965 3:126830448-126830470 AGAGGCACCCAGGAGGAAGATGG - Intronic
961457940 3:127033462-127033484 GGAGGCAGACAGGAGGCAGAGGG + Intronic
961463119 3:127065562-127065584 AGAGGGAGCCACGCTGAAGGAGG - Intergenic
961537851 3:127580759-127580781 AGAGGGAGACAAGGGCCAGAGGG - Intronic
961542331 3:127608538-127608560 GGAGGGAGCCAAGTTGCAGAGGG + Intronic
961639456 3:128355916-128355938 AGAGGGAGCCATGGGCCACAGGG + Intronic
961648128 3:128403488-128403510 GGAGGTAGACACCAGGCAGATGG + Intronic
961869769 3:129978867-129978889 AGAGGGAGGCAGGAGCAAGAAGG + Intergenic
962280640 3:134049241-134049263 AGAGGGAGCCAAGGGGTGGAGGG - Intronic
962413445 3:135161608-135161630 AGAGGCAGGCAGGGGGCAGATGG + Intronic
962441000 3:135416129-135416151 AGGGTGAGCCATGAAGCAGAAGG + Intergenic
962647120 3:137451318-137451340 AGAAGAAGACACGAGGCTGATGG - Intergenic
962848521 3:139290590-139290612 GGAGGGGGGCAGGAGGCAGAGGG - Intronic
962975491 3:140442444-140442466 AGTGTCAGCCAGGAGGCAGAAGG - Intronic
963341178 3:144035577-144035599 AGAGTGAGCCACCAGAGAGAGGG + Intronic
963757659 3:149252460-149252482 AGAGGAAGTCACAAGGCAGTAGG + Intergenic
964270263 3:154947727-154947749 AGACGGATCAACGAGACAGAAGG + Intergenic
965421017 3:168458353-168458375 AGAGGGAGGGAGGAGGAAGAAGG - Intergenic
965512081 3:169579513-169579535 AGAGGGAGCCCCTAGGCCAAGGG + Intronic
965687007 3:171314810-171314832 AGAAGGATTCAGGAGGCAGAAGG + Intronic
966484095 3:180448523-180448545 AGAGTGAGCGACGAAGAAGACGG + Intergenic
967339313 3:188378788-188378810 AGAGGGAGCGACGCAGAAGATGG - Intronic
967699172 3:192571488-192571510 AGAAGGTGCCACGGGGCGGACGG + Intronic
967909568 3:194530366-194530388 AGTGGTTGCCAGGAGGCAGAGGG - Intergenic
967942983 3:194780480-194780502 TGAGGGCCCCAAGAGGCAGAAGG - Intergenic
969324378 4:6432441-6432463 AGAGGGGGAAACGAGGCAGCAGG - Intronic
969600144 4:8171373-8171395 AGAGGGAGCCAGGAGGGAGGCGG - Intergenic
969722066 4:8897652-8897674 AGAGGGAGGAAGGAGGAAGAAGG - Intergenic
970705874 4:18801651-18801673 AGACAGAGCCACAAGGCAGGTGG + Intergenic
971010180 4:22425527-22425549 AGAGGGAGACATGCAGCAGAAGG + Intronic
972700953 4:41492420-41492442 AGAGGGAGCCCAGAGGGAGAAGG + Intronic
974061801 4:57042146-57042168 AGAGGGTGCCATGATACAGAAGG - Intronic
974974994 4:68880879-68880901 TGGGGGAGCCAGCAGGCAGACGG + Intergenic
975191372 4:71466873-71466895 AGAGGAAGCCAGAAGGCAAAGGG - Intronic
977105073 4:92872627-92872649 AGAGGAAGCCAAGAGGCTTAAGG + Intronic
980115751 4:128677673-128677695 AGATGGAGCCACAAGGTGGATGG + Intergenic
981317210 4:143351297-143351319 TGGGGGAGCCAGAAGGCAGATGG + Intronic
983067737 4:163230590-163230612 AGGGGGAGGCACGGGGGAGAGGG - Intergenic
983328326 4:166289407-166289429 AGAGAGAGCTATGAGGGAGATGG + Intergenic
983682032 4:170363941-170363963 AGAGTGAGCCACGCAGAAGACGG - Intergenic
985088644 4:186341584-186341606 AGAGGGAGCCTAGAGATAGAGGG + Intergenic
985239027 4:187909706-187909728 AGAGGGAGGCCCTAGTCAGAGGG + Intergenic
985351456 4:189067195-189067217 AGAGGGAGCAACGAGCTAAACGG - Intergenic
985494671 5:197908-197930 AGGGGGAGACACGGGGCAGCAGG - Exonic
986150856 5:5129498-5129520 AGAAGGTGCCACGTGGAAGATGG + Intergenic
986619148 5:9652507-9652529 AGGGGGAGCCACAAGACGGAAGG + Intronic
987337959 5:16913888-16913910 AGAGGGAGCCAAGAGGCACCAGG + Intronic
988857948 5:35247273-35247295 AGTGGGTGACAGGAGGCAGAGGG + Intergenic
992701149 5:79343082-79343104 AGAGGGATCCACTGGGAAGAGGG + Intergenic
992880519 5:81105021-81105043 AGAGGGAACCAAGAGGAAGGGGG - Intronic
994076682 5:95659736-95659758 AGAAGGAGGCAGGAGGCAGGAGG - Intronic
994083681 5:95735190-95735212 AGAGGGTGCAAGGGGGCAGAAGG - Intronic
995487533 5:112654264-112654286 AAAGGGAGCCAAGTGGGAGAGGG + Intergenic
997869453 5:137494382-137494404 AGAGGGAGCCTAGAGTCAGATGG + Intronic
998627836 5:143865545-143865567 TCTGGGAGCCACGAGGGAGAGGG + Intergenic
1000641350 5:163706158-163706180 AGAAGGAGACACTAGGCAGCTGG + Intergenic
1001270723 5:170309685-170309707 TGAGGGAGAGAGGAGGCAGATGG + Intergenic
1001329574 5:170752686-170752708 AGAGGGAGGCAGGAAGGAGAGGG - Intergenic
1001791282 5:174459716-174459738 AGAGCAAGGCACAAGGCAGAAGG - Intergenic
1003493824 6:6646580-6646602 TGAGGAAGCCACATGGCAGAGGG - Intronic
1003954575 6:11149857-11149879 ATAGTGAGCCACGAGGCACCAGG + Intergenic
1004305996 6:14502397-14502419 AGAGGGAGACAGGAGACTGAAGG - Intergenic
1005188209 6:23186631-23186653 AGATGGAGCCACAAGATAGAAGG + Intergenic
1006290392 6:33130950-33130972 ATAGGCAGCCAGGAGGTAGAGGG + Intergenic
1006404007 6:33833564-33833586 AGAGGGAGACGAGAGGGAGAGGG + Intergenic
1007593967 6:43040136-43040158 AGAGTGAGCAGCCAGGCAGAGGG - Exonic
1008965770 6:57311542-57311564 AGAGGGGGCGGCGGGGCAGAGGG + Intergenic
1010309485 6:74367506-74367528 AGAGGAAGAAAGGAGGCAGAAGG - Intergenic
1011688412 6:89843182-89843204 AGAGGGAGCCAGGAGACCAAAGG + Intronic
1012152329 6:95769887-95769909 GGATGGAGACACGAGGCAGTGGG - Intergenic
1013042910 6:106454107-106454129 AGAGGGAGACAACAGGCAGATGG - Intergenic
1013253733 6:108361377-108361399 GGAGGGAGCAATGAGTCAGAAGG + Intronic
1013356495 6:109350119-109350141 AGAATGAGGCACGAGGCAGGTGG + Intergenic
1014218992 6:118781142-118781164 AGTGGGAGCCTGGAGGAAGAGGG + Intergenic
1015200968 6:130580532-130580554 AGAGGGAGGGAGGGGGCAGAAGG - Intergenic
1015223443 6:130830388-130830410 AGAGTGAGTGAGGAGGCAGAAGG + Intronic
1015682820 6:135826425-135826447 GGAGGGAGCCAGGAAGCAGGCGG + Intergenic
1016335108 6:142996328-142996350 AGACAGATCCACGAGACAGAAGG + Intergenic
1018244011 6:161804478-161804500 AGAGGGAGTTCAGAGGCAGATGG - Intronic
1019092388 6:169550107-169550129 ACAGGGGGCCAGGAGGCACAAGG + Intronic
1019295697 7:272870-272892 TGAGGGAGGCACAGGGCAGAGGG - Intergenic
1019346170 7:531764-531786 CAGGGGAGCCACGAGGCGGAGGG + Intergenic
1020092323 7:5348663-5348685 GGAGGGAGGCAGGAGCCAGAGGG + Intronic
1020125979 7:5532673-5532695 AGAGGGAACCACAAGCCAGGAGG - Intronic
1021669138 7:23017186-23017208 ACAGGAAGCCACAAGGCAAAAGG - Intergenic
1022612578 7:31891679-31891701 AGAGGGAGACACGTGTAAGAAGG + Intronic
1023095707 7:36657571-36657593 AGAGGGGGACCCGAGGCAGAGGG + Intronic
1023373292 7:39532863-39532885 AGCAGGAACCAAGAGGCAGAGGG - Intergenic
1023498879 7:40827406-40827428 AGAGGGAGCAAAGAGGCTGCTGG + Intronic
1023888569 7:44377128-44377150 AGAGGGACCCAGGAGGGACAAGG - Intergenic
1023892315 7:44401927-44401949 AGATGCAGCCACCAGGCAGGAGG - Intronic
1025858521 7:65305340-65305362 AAAGGGACCCCTGAGGCAGAAGG + Intergenic
1026988994 7:74572643-74572665 AGAGGGAGGCAGGGGCCAGAGGG - Intronic
1027391671 7:77709971-77709993 AGACGGAGCCACTAGGTATATGG - Intronic
1029355438 7:100048412-100048434 AGATGGAGCCTCCAGGCAGCCGG - Intergenic
1031972833 7:128076413-128076435 AGAGGGACCCAGGAGGCGGCAGG - Intronic
1032513700 7:132491843-132491865 GGAAGGAGACAGGAGGCAGAGGG + Intronic
1033150853 7:138913925-138913947 AGAGGGAGACAGGAGGGAGGAGG + Intronic
1033288735 7:140063236-140063258 AGAGGGAGCCTCGAGGGCGGCGG + Exonic
1033418502 7:141185376-141185398 TGAGGGAGCCAGAAGGGAGATGG + Intronic
1034233774 7:149553435-149553457 AGAGGGAGACCAGAGGGAGAGGG - Intergenic
1034989161 7:155536686-155536708 AGGAGGAGCCACAAGACAGAAGG + Intergenic
1035682502 8:1498220-1498242 AGAGGAAGCCTCCAGGCAGCAGG + Intergenic
1036078324 8:5525160-5525182 AGAGGGAGCCAGCAGGTAGAAGG + Intergenic
1036601883 8:10268525-10268547 ATAGGGAGAGAAGAGGCAGATGG - Intronic
1036678504 8:10853641-10853663 AGAGGGAGCCAGCAGGAAGCAGG + Intergenic
1037168601 8:15861965-15861987 GGAGGGAGCTAAGAGGCAGAGGG - Intergenic
1037736108 8:21567588-21567610 TGTTGGAGCCACAAGGCAGAAGG - Intergenic
1038496204 8:28004947-28004969 AGAGGTGGTCAGGAGGCAGAGGG + Intergenic
1039931551 8:41995337-41995359 AGAGGGAGATTTGAGGCAGAGGG + Intronic
1040554644 8:48468058-48468080 AGAAGGAGCCAAGAGTCAGCTGG - Intergenic
1042027753 8:64442150-64442172 ACATGGAGCAATGAGGCAGAAGG + Intergenic
1042200635 8:66276833-66276855 AGAGTGAGCCTGGAGGAAGATGG + Intergenic
1042850958 8:73215844-73215866 AGAGGGAGCCACGTAGGACAAGG + Intergenic
1044475554 8:92621175-92621197 AGAGGGAGCAGAGAGTCAGAAGG + Intergenic
1044483107 8:92716104-92716126 GGAGGAAGCCAAGAGGAAGAAGG - Intergenic
1045063147 8:98425515-98425537 AGAGGCAGCCACATGGGAGAGGG - Intronic
1045357399 8:101402081-101402103 GGAGGGAGAAAGGAGGCAGAGGG - Intergenic
1046349727 8:112992232-112992254 AGAGGGAGGGACGAAGGAGAGGG - Intronic
1046855893 8:119031451-119031473 AGAGGAAGCCACCTGGCAGGTGG + Intronic
1047493133 8:125390465-125390487 TGAGGAAGCCAAGGGGCAGATGG - Intergenic
1051547733 9:18294929-18294951 AGAAGGAGCAAAGAGGAAGAGGG - Intergenic
1051671321 9:19513626-19513648 GGAGGGAGTGAGGAGGCAGAGGG + Exonic
1053095079 9:35319560-35319582 AGAGGGAGGAAGGAGGAAGATGG - Intronic
1053386474 9:37694636-37694658 AGGCTGAGACACGAGGCAGAAGG - Intronic
1053802252 9:41771820-41771842 AGAGGGAGCCAGGGTGCAAAAGG - Intergenic
1054143022 9:61543469-61543491 AGAGGGAGCCAGGGTGCAAAAGG + Intergenic
1054190485 9:61982806-61982828 AGAGGGAGCCAGGGTGCAAAAGG - Intergenic
1054461970 9:65470282-65470304 AGACGGAGGGACGAGGCAGGTGG + Intergenic
1054647833 9:67604611-67604633 AGAGGGAGCCAGGGTGCAAAAGG + Intergenic
1054809365 9:69422569-69422591 AGATGCAGCCAGCAGGCAGAGGG - Intergenic
1055722013 9:79185483-79185505 AGAGGAAACCAAGAGGTAGATGG + Intergenic
1056006119 9:82273157-82273179 AGACAGATCAACGAGGCAGAAGG + Intergenic
1056752086 9:89359259-89359281 GCAGGGAGCCACTTGGCAGAAGG + Exonic
1058049463 9:100392224-100392246 AGAGGGAGACTGGAGGGAGAGGG - Intergenic
1058672862 9:107375345-107375367 AAAGGGAGCAAGGAGGAAGAGGG + Intergenic
1059821948 9:117983374-117983396 AGAGGGAGGCACCAGACAGATGG + Intergenic
1059942194 9:119369285-119369307 CGAGAGAGCCGGGAGGCAGAGGG - Exonic
1060073354 9:120570057-120570079 AGAGGGAGCAAGGAGGCACCGGG + Intronic
1060556846 9:124512409-124512431 CCAGAGAGCCACCAGGCAGAGGG - Intergenic
1060989974 9:127843037-127843059 AGAGGAAGCTCCAAGGCAGATGG - Intronic
1061159402 9:128884570-128884592 AGAGGCAGCCCAGAGGAAGAAGG + Intronic
1061394007 9:130333421-130333443 AGAGGGGCCCAGGGGGCAGAGGG - Intronic
1061617708 9:131791283-131791305 AGAGGGAAGCATGGGGCAGAGGG - Intergenic
1061803686 9:133126785-133126807 AGAGGGAGGCAGCAGGCAGACGG + Intronic
1061804026 9:133128272-133128294 AGAGGGAGGCAGCAGGCAGACGG + Intronic
1061852209 9:133422871-133422893 AGAGGGAGACAGGAGGCAGGAGG - Intronic
1062009375 9:134258957-134258979 ACAGGGAGCCCCGAGGCATGGGG - Intergenic
1062040704 9:134403048-134403070 TGAGGGGGCCAGGAGGCAGCAGG + Intronic
1185708520 X:2282878-2282900 AGAGGGAGGGAGGAGGGAGAAGG + Intronic
1186753654 X:12647537-12647559 AGAGAGAGCCCCCAGGCAGGTGG + Intronic
1187128183 X:16474238-16474260 AGAGGGAGCCAGGTGGGATAAGG + Intergenic
1187768628 X:22670684-22670706 AGGAGGACCCACGAGGCACAAGG + Intergenic
1189096995 X:38151098-38151120 AGAGGGAGTTTCGAGGAAGAAGG + Intronic
1190301775 X:49061139-49061161 AGAAGGAGGCAGGAGGCAGGTGG + Intronic
1191250264 X:58256843-58256865 AAAAGCAGCGACGAGGCAGAAGG + Intergenic
1191251469 X:58262068-58262090 AAAAGCAGCCACGAGGCCGAGGG + Intergenic
1191251755 X:58263254-58263276 AAAAAGAGCAACGAGGCAGAGGG + Intergenic
1192434672 X:71135946-71135968 AGAGGGAGCGGGGAGGGAGAGGG - Intronic
1192886085 X:75336305-75336327 AGAGGGAGACGAGAGGGAGAGGG + Intergenic
1192886092 X:75336339-75336361 AGAGGGAGACGAGAGGGAGAGGG + Intergenic
1193123190 X:77845005-77845027 AGACAGATCCACGAGACAGAAGG - Intronic
1193898240 X:87141118-87141140 TGAGGGAGCCAGAAGGGAGATGG - Intergenic
1194104613 X:89753398-89753420 AGAGGGAGCCTCCAGGTAGCAGG + Intergenic
1195684676 X:107574876-107574898 AGAGGGAGCCATGGGGCTGTGGG - Intronic
1195702515 X:107716030-107716052 AGAGGAAGAGCCGAGGCAGATGG - Intronic
1195763125 X:108268599-108268621 AGAGGAAGCAAGGAGGCAGCTGG - Intronic
1196783611 X:119403667-119403689 AGAGGGAGGAACGAGGAAGTGGG + Intronic
1199143309 X:144335917-144335939 TGAGGGAGCCAGAAGGGAGATGG + Intergenic
1200060960 X:153483569-153483591 AGAGAGGGCCAGGAGGCAGGGGG + Intronic
1202365360 Y:24158452-24158474 AGAGCAAGCCATGGGGCAGAAGG + Intergenic
1202505421 Y:25511670-25511692 AGAGCAAGCCATGGGGCAGAAGG - Intergenic