ID: 954322114

View in Genome Browser
Species Human (GRCh38)
Location 3:49839379-49839401
Sequence TGCCAGCAGAGGGAGCCACG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 282
Summary {0: 1, 1: 0, 2: 5, 3: 25, 4: 251}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954322114_954322121 24 Left 954322114 3:49839379-49839401 CCTCGTGGCTCCCTCTGCTGGCA 0: 1
1: 0
2: 5
3: 25
4: 251
Right 954322121 3:49839426-49839448 CTAAGGGAATTATTTTACAGTGG 0: 1
1: 0
2: 0
3: 20
4: 175
954322114_954322118 7 Left 954322114 3:49839379-49839401 CCTCGTGGCTCCCTCTGCTGGCA 0: 1
1: 0
2: 5
3: 25
4: 251
Right 954322118 3:49839409-49839431 AGCACGCACTCCTGGCACTAAGG 0: 1
1: 0
2: 0
3: 4
4: 77
954322114_954322119 8 Left 954322114 3:49839379-49839401 CCTCGTGGCTCCCTCTGCTGGCA 0: 1
1: 0
2: 5
3: 25
4: 251
Right 954322119 3:49839410-49839432 GCACGCACTCCTGGCACTAAGGG 0: 1
1: 0
2: 1
3: 4
4: 60
954322114_954322117 -1 Left 954322114 3:49839379-49839401 CCTCGTGGCTCCCTCTGCTGGCA 0: 1
1: 0
2: 5
3: 25
4: 251
Right 954322117 3:49839401-49839423 AGCTTTAAAGCACGCACTCCTGG 0: 1
1: 0
2: 1
3: 3
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954322114 Original CRISPR TGCCAGCAGAGGGAGCCACG AGG (reversed) Intronic
901632721 1:10655815-10655837 TGCCAGGAGACAGCGCCACGTGG + Intronic
901867813 1:12118788-12118810 TGCCAGCAGAGGGCGCTAGAGGG + Intronic
903776955 1:25799779-25799801 TGCCAGCAGAGGAGGACACGAGG + Intergenic
903849019 1:26295282-26295304 TGGCAGCAGATGGAGCCCAGTGG - Intronic
904919853 1:33998627-33998649 TGCCAGCTGAGGCTGCCACAGGG - Intronic
905001129 1:34671095-34671117 TGCCAACAGAGGGAGGAACCTGG - Intergenic
905245890 1:36613079-36613101 CCCCAGCAGAGGGAGCAGCGAGG + Intergenic
905868224 1:41387861-41387883 AGCCAGCAAAGGGAGCCGGGAGG - Intergenic
906133046 1:43472975-43472997 TTCCTGCAGAGTGAGCCATGTGG + Intergenic
906470818 1:46129097-46129119 TGCTAGAAGAGGGAGGCAAGAGG + Intronic
908420717 1:63956000-63956022 GGCCAGCAGAGCGAGTCACCAGG - Intronic
909497372 1:76293352-76293374 TGCCAGCATAGGGAGAGATGAGG - Intronic
912416216 1:109509694-109509716 TCCCAGCGGAGGGAGCGGCGTGG + Intronic
912518948 1:110232393-110232415 TGACAGCAGATGGAGCTACTTGG + Exonic
914239715 1:145845593-145845615 GGCCACCAGAGGGCGCCAGGCGG + Intergenic
914913721 1:151805587-151805609 TGACAGGGGAGGGAGCCAGGAGG + Exonic
916029574 1:160864038-160864060 TGCCAACAGAGGCAGCAGCGGGG + Intergenic
920838985 1:209538052-209538074 TGCCAGCAAAGGGGACCAGGAGG - Intergenic
922180656 1:223230538-223230560 TGGCAGCAGTGGGTGCCACTTGG + Intronic
922594630 1:226804285-226804307 TGCCAGCAGAGGGACAGACCTGG - Intergenic
923040638 1:230317676-230317698 TTCCACCTGAGGGAGCCAGGAGG + Intergenic
1063559717 10:7114652-7114674 AGCCAGCACAGGGTGCCACAGGG - Intergenic
1063811962 10:9721861-9721883 CATCAGCAGAGGGAGCCAGGTGG + Intergenic
1064600747 10:16990032-16990054 AACCAGCAGAGGGAGCCCCTGGG - Intronic
1066520386 10:36211828-36211850 TGCCAGCAGAGGCACCCGCAAGG - Intergenic
1067118284 10:43452474-43452496 TGCCAGTAGCTGGAACCACGGGG + Intronic
1068753641 10:60625162-60625184 TGCCAAGAGAGGGAGCCACAAGG + Intronic
1072223625 10:93348363-93348385 TTCCATGAGAGGGAGCCAGGGGG - Intronic
1073136833 10:101224872-101224894 TGCCCGCACCGGGAGCCGCGGGG + Intergenic
1073323347 10:102628724-102628746 CCCCAGCAGAGGGAGCGAAGAGG + Intronic
1075087088 10:119421038-119421060 TGCCAGCAGGGTGGGCCATGGGG - Intronic
1075626127 10:123965641-123965663 TGCCAGCGGAGGGTGCCCAGGGG - Intergenic
1076344487 10:129771172-129771194 TGTCAGCAGCTGGAGCCATGGGG - Intergenic
1076438664 10:130464028-130464050 TGCCAGCAGCAAGAGCCATGTGG + Intergenic
1076757476 10:132580011-132580033 TGCCAGCAGTGGGAGGAAGGTGG - Intronic
1077311697 11:1891660-1891682 GGCCAGCAGAGAGAGGCTCGGGG + Intronic
1077487326 11:2845130-2845152 TGCCGGCAGCAGGAGCCACGGGG + Intronic
1077753887 11:5004619-5004641 GGCCAGCAGAGGGTGCCGCAGGG - Intergenic
1083053401 11:59796765-59796787 TGCCAGCAGAGGGAAATATGGGG - Intronic
1083270422 11:61569503-61569525 GGGCAGCAGAGGGAGCCAGGAGG + Intronic
1084096635 11:66915658-66915680 TGCCCGCAGGGGGAGCTACCAGG + Intronic
1084717409 11:70882790-70882812 TGCGAGCACAGGAAGCCAAGCGG + Intronic
1085175852 11:74487500-74487522 GGCAAGCAGAGAGAGCCAAGAGG - Intergenic
1085501554 11:77029452-77029474 TGTCAGCAGAGAGAGCTACATGG + Intergenic
1088439152 11:109849240-109849262 TTCTAGCAGATGGAGCCACTCGG + Intergenic
1091383950 12:80283-80305 TGACAACAAAGGGAGCCCCGGGG - Intronic
1091403656 12:196070-196092 CTCCAGGGGAGGGAGCCACGGGG - Intronic
1092130963 12:6113018-6113040 TGCCAGCAGCAGCAGCCACCAGG + Intronic
1096254355 12:50053839-50053861 TGCCAGCAGAGAGAGGCAGGGGG - Intergenic
1102236785 12:111298716-111298738 TGCCAAGTGAGGGAGCCAGGAGG + Intronic
1103326031 12:120121356-120121378 TTCCATCAGAGGGAGACACCAGG - Intergenic
1103969479 12:124661044-124661066 TGTCTGCAGAAGGAGCCACGCGG + Intergenic
1104039754 12:125122111-125122133 TTCAGGCAGAGGGAACCACGAGG + Intronic
1104730364 12:131102419-131102441 TGCCAGCAGAAGGGGCCTTGTGG - Intronic
1104943570 12:132405899-132405921 GGACAGCAGAGGCAGCCTCGGGG + Intergenic
1104970899 12:132530264-132530286 TCCCAGCAGCCGGAGCCAGGTGG - Intronic
1105900028 13:24745876-24745898 GGCCTGCAGGGTGAGCCACGCGG + Intergenic
1106295903 13:28413315-28413337 AGCCAGCAGAAGGAGCCAGGAGG - Intronic
1107674457 13:42780173-42780195 TGCCAGCAGCAGCAGCCACATGG + Intergenic
1107859273 13:44645601-44645623 TGGCAGCAAAGGCAGCCATGAGG - Intergenic
1112199351 13:97260201-97260223 TCCCAGCAGAGGGAACAGCGAGG + Intronic
1112394755 13:99019488-99019510 TGTCATAAGAGGGAGCCACCTGG - Intronic
1113813848 13:113158579-113158601 TGCCGGCAGCAGGAGCCTCGGGG - Intergenic
1113931018 13:113968940-113968962 GGCCAGCAGAGGGAGCCAGGAGG - Intergenic
1118905092 14:70017953-70017975 TTCCAGCAGAGGGGACCATGTGG + Intronic
1120850177 14:89162761-89162783 TGCCACCAAGGGGAGCCAGGAGG - Exonic
1121411048 14:93748530-93748552 TGCCAGCAAAGGAAGGAACGGGG + Intronic
1121532921 14:94671151-94671173 GTCCAGCAGAGGGAGACAGGGGG + Intergenic
1123124764 14:105938284-105938306 GGCCAGCTGAGGAAGCCATGTGG + Intergenic
1124225167 15:27887437-27887459 TGCCAGCAAAGGTAACCATGGGG + Intronic
1124225241 15:27887870-27887892 TGCCAGCAAAGGTAACCATGGGG + Intronic
1125429251 15:39579855-39579877 TCACAGCAGAGGGAGCGAGGCGG + Intergenic
1127409373 15:58690637-58690659 TATCAGCAGAGAGAGCCAGGTGG + Intronic
1129343498 15:74901752-74901774 TACCAGCAGAGGGAGCTACAGGG - Exonic
1131992037 15:98102030-98102052 ATTCAGCAGATGGAGCCACGTGG + Intergenic
1132098631 15:99006984-99007006 ATTCAGCAGATGGAGCCACGTGG - Intronic
1132344606 15:101100782-101100804 TGCCAGCAGAGGGGGCAGCCTGG + Intergenic
1132573869 16:655994-656016 TGGCTGCACAGGGTGCCACGGGG + Intronic
1133189594 16:4123774-4123796 TACCAGCAGATGGTGACACGGGG - Intergenic
1133626014 16:7571473-7571495 TTATAGCAGAGGGAGCCCCGTGG + Intronic
1136142398 16:28295872-28295894 TGCCAGCATCGGGGGCCAGGAGG - Intronic
1136188230 16:28600679-28600701 TGCCAGCAAAGGGACCTGCGCGG + Intergenic
1136190702 16:28613673-28613695 TGCCAGCAAAGGGACCTGCGCGG + Intronic
1138370243 16:56520799-56520821 AGGCAGCAGAGTGAGCCCCGGGG - Intergenic
1138584520 16:57961197-57961219 TTCCAGCACAGGGAGCCCCCAGG - Intronic
1139323373 16:66133402-66133424 TGCCATCAGAGAGAGCAATGAGG - Intergenic
1140732956 16:77872663-77872685 TGGCAGCAGAGGGAACCAGAGGG - Intronic
1142670199 17:1484521-1484543 TGGCAGCAGAGGGATCACCGAGG + Intronic
1144890459 17:18491194-18491216 TCCCACCAGAGGGTGCCACACGG - Intronic
1145141758 17:20453124-20453146 TCCCACCAGAGGGTGCCACACGG + Intronic
1145224899 17:21119951-21119973 TCCCAGCAGCGGGAGGGACGGGG + Intergenic
1145794153 17:27645784-27645806 TCCCACCAGAGGGCGCCACACGG - Intronic
1145808955 17:27753325-27753347 TCCCACCAGAGGGCGCCACACGG - Intergenic
1147188309 17:38724814-38724836 TGCCAAGCGAGGGAGCCACTAGG - Exonic
1148213095 17:45819918-45819940 TGCCAGCAGAGGCAGCTCCCAGG + Intronic
1149418170 17:56482336-56482358 TGCCTGCAGAGGGACACGCGCGG - Exonic
1149648102 17:58255004-58255026 AGCCAGGAGTGGGAGCCAGGTGG - Intronic
1149648186 17:58255610-58255632 AGCCAGGAGTGGGAGCCAGGCGG + Intronic
1151797773 17:76357876-76357898 TCCCAGCTCAGGGAGCCACATGG - Intronic
1152434144 17:80264826-80264848 GGACAGGAGAGGGAGCCAAGAGG - Intronic
1152518765 17:80842875-80842897 AGGGAACAGAGGGAGCCACGCGG - Intronic
1154212814 18:12394607-12394629 TGCCAGCAGAGGGAGCCCCAAGG + Intergenic
1157596839 18:48869414-48869436 TGGCAGCTGTGGGAGCCCCGAGG - Intergenic
1160742807 19:695207-695229 TTCCAGCAGAGGCAGCCACGGGG + Intronic
1160970125 19:1764292-1764314 AGCCTCCAGATGGAGCCACGAGG + Intronic
1161272731 19:3398854-3398876 TGCCCGTGGAGGGAGCCGCGGGG - Intronic
1161297601 19:3527611-3527633 TGGCTGCAGAGGCGGCCACGTGG - Exonic
1161502293 19:4623000-4623022 GGGCAGCAGAGGGAGCGAGGCGG - Intergenic
1162069135 19:8143164-8143186 GGCCAGCAGAGACAGCCACCTGG - Intronic
1162301413 19:9847245-9847267 TGCCAGCAGAGGGGGCAAGACGG - Intronic
1163415374 19:17183315-17183337 TGCCAGCAGAGGGTTCCAGAAGG + Intronic
1164633314 19:29775613-29775635 CGCCAGCGAGGGGAGCCACGCGG + Intergenic
1165019223 19:32909370-32909392 TGCCTGCACAGGGAACCACCAGG + Intronic
1165154227 19:33777599-33777621 TGGCAGCAGAGGGGGACCCGGGG + Intergenic
1165421711 19:35725312-35725334 TGCCAGCAAAGGACTCCACGAGG + Exonic
1166720673 19:44994222-44994244 TGTCAGCACAGGCAGCCCCGGGG - Intergenic
1167037090 19:47000996-47001018 TACAAGCAGAGGGAGGCACCCGG - Exonic
1167518917 19:49940378-49940400 TGGCACCAAAGTGAGCCACGTGG + Intronic
1167621694 19:50564355-50564377 TGTGGGGAGAGGGAGCCACGGGG + Intronic
1168289563 19:55350933-55350955 TGCCCCCACAGGGAGACACGGGG - Intronic
925157526 2:1658838-1658860 TCTGAGCAGAGGGAGCCGCGGGG - Intronic
926038605 2:9654882-9654904 TGCATGCAGAGGGAGCCACTAGG + Intergenic
926101589 2:10122036-10122058 TCCCAGCAAAACGAGCCACGGGG + Intergenic
928261190 2:29768141-29768163 TGCAAGCAGAGCCAGCGACGTGG - Intronic
929118678 2:38465935-38465957 CTCCAGTAGAGGGAGCCAAGCGG - Intergenic
930753991 2:54957800-54957822 TGCCAGCCGAGGGGGTCACCTGG + Exonic
932539127 2:72633187-72633209 TGCCATCAGGTGGAGGCACGAGG + Intronic
932572315 2:72944507-72944529 TGCCAGCCCAGGGAGCCATCTGG + Exonic
933781296 2:85803381-85803403 TGTCAGAAGAGGGATCCACCAGG - Intergenic
934157081 2:89213324-89213346 TGTCAGCAGAGGGCGGCACCAGG + Intergenic
934488304 2:94738167-94738189 TGCCGGCGGAGGGAGCCCCGTGG - Intergenic
936029192 2:109058084-109058106 TGCTGGCAGTGGAAGCCACGAGG + Intergenic
936041648 2:109154489-109154511 AGCCAGCTGAGGAAGCCTCGAGG - Intronic
937275619 2:120682099-120682121 CCACAGCAGAGGAAGCCACGTGG + Intergenic
938227418 2:129627832-129627854 TGACAGCAAAGAGAGCCATGTGG - Intergenic
938675753 2:133632191-133632213 TGGCAGCAGATGCAGCCACATGG + Intergenic
941240030 2:163026238-163026260 TGCAAGCTGAGGGAGCCAGCCGG - Intergenic
942278576 2:174340472-174340494 GGCCTGCGGAGGGAGCCGCGCGG - Intergenic
943179328 2:184523981-184524003 TGCCCACAGTGGAAGCCACGTGG - Intergenic
945200419 2:207275543-207275565 GGCCAGCAAAGGGAGGCAGGTGG - Intergenic
945400715 2:209379218-209379240 TGACATCAGAGGGAGCCATTGGG - Intergenic
947532601 2:230922281-230922303 CCCAAGCAGAGGGAGCCAGGAGG - Intronic
947723266 2:232381734-232381756 GGCCAGCAGAGGAAGCAACGCGG - Exonic
947727610 2:232409811-232409833 TGCCAGCAGAGGAAGCAACGCGG - Exonic
947736725 2:232459085-232459107 GGCCAGCAGTGGCAGCGACGCGG - Exonic
948027644 2:234790724-234790746 GGTCTGCAGAGGGAGGCACGCGG + Intergenic
1171117122 20:22534612-22534634 GGCCGGCAGAGGAAGCCACCAGG + Intergenic
1171298878 20:24042064-24042086 TCTCAGCAGAGGAAGCCAAGAGG - Intergenic
1172205317 20:33159160-33159182 GGCCAGCAGCGGGAGAGACGTGG - Intergenic
1172383908 20:34519283-34519305 TGCCAACAGAAGTTGCCACGGGG - Intronic
1173873794 20:46357368-46357390 TGGCAGGAGAGGGAGCTGCGGGG + Intronic
1174300946 20:49581796-49581818 TGCCAGCAGAAGGAGACTCTGGG + Intergenic
1175143806 20:56881025-56881047 TGGCAGAAGGAGGAGCCACGAGG + Intergenic
1175278703 20:57788444-57788466 TCCAGGCAGAGGGAGCCACCGGG - Intergenic
1175933413 20:62503984-62504006 TGCCAGCAGTGAGTGTCACGTGG - Intergenic
1176310165 21:5145165-5145187 TGCCTGTGGAGGGAGCCAGGCGG - Intronic
1176969786 21:15252333-15252355 TGCATGCAGAGGGAGCAGCGTGG + Intergenic
1179064815 21:38015114-38015136 TGCCAACAGAGGGAGGCCCCAGG + Intronic
1179431075 21:41321690-41321712 CTTCAGCAGAGGGAGCCATGGGG - Intronic
1179846891 21:44116871-44116893 TGCCTGTGGAGGGAGCCAGGCGG + Intronic
1180036908 21:45254770-45254792 TGAAAGCAGAGGGAGCCTGGGGG + Intergenic
1181327487 22:22061037-22061059 TCTCTGCAGAGGAAGCCACGCGG - Intergenic
1181979126 22:26753501-26753523 TGCCAGCACAGGGAGAGATGAGG - Intergenic
1182103661 22:27674114-27674136 TGACAGCAGCGGGAGCCCCGGGG + Intergenic
1182512401 22:30828592-30828614 TCCCAGCAGAGGGCCCGACGTGG + Intronic
1183309011 22:37099230-37099252 TTCCAGCAGAGGGAGCAGCATGG + Intronic
1183893655 22:40950960-40950982 CGCCAGCACCGGGAGCCGCGCGG + Intergenic
1185183065 22:49374076-49374098 TGCAGGCAGAGGGAGCGACCAGG + Intergenic
950113300 3:10434411-10434433 TGAGAGCAGTGGGAGCCACAGGG + Intronic
950682248 3:14593385-14593407 TGCCGGAAGCGGGAGCCATGAGG - Intergenic
950683810 3:14602677-14602699 AGCCAGCAGTGGGGCCCACGGGG - Intergenic
950885319 3:16357546-16357568 TAGCTGCAGAGGGAGCCACAGGG + Intronic
952184848 3:30957409-30957431 TGCCAGCATAGGCAGCCTTGGGG - Intergenic
953770822 3:45777637-45777659 TGCAGGGAGAGGGAGGCACGTGG + Intronic
953864863 3:46575454-46575476 TGACTGCAGAGGAAGCCAAGTGG - Intronic
954322114 3:49839379-49839401 TGCCAGCAGAGGGAGCCACGAGG - Intronic
956053500 3:65274734-65274756 ATCCAGCAGAGTGAGCCACGAGG - Intergenic
958136802 3:89504435-89504457 TGACAGCCGAGGAAGCCTCGGGG + Intergenic
959189765 3:103096878-103096900 TGCCAGAGGAGGTAGCCACAGGG - Intergenic
961336257 3:126181294-126181316 TTCCAGGAGAAGGAGCCACCTGG - Intronic
961601821 3:128068262-128068284 TTCCTCCAGAGGGAGCCACTGGG + Intronic
961755843 3:129126976-129126998 AGCAAGCAGAGGGATCCAGGGGG - Intronic
962678673 3:137776329-137776351 TGCAATAAGAGGGAGCCACATGG + Intergenic
962986945 3:140544767-140544789 TCCCAGGAGAGGGAGACACATGG + Intronic
963070847 3:141304093-141304115 TTACAGCAGAGGTAGCCAAGGGG - Intergenic
963878598 3:150503517-150503539 GACCAGCTGAGGGAGCCACCTGG + Intergenic
964414614 3:156434074-156434096 GGCCTGGAGAGGGAGCCATGTGG + Intronic
966955118 3:184868736-184868758 TGCTAGTATAGAGAGCCACGGGG - Intronic
967671295 3:192238453-192238475 TGCCAGCAGGGGGAGACAATGGG + Intronic
968492777 4:899345-899367 TGCCAGCACAGGGCTCCAAGAGG + Intronic
968610889 4:1556532-1556554 AGCCTTCAGAGGGAGCCATGGGG + Intergenic
968664757 4:1815043-1815065 TGCATGCACCGGGAGCCACGAGG + Intronic
969728728 4:8940747-8940769 TCCCAGCTGATGGGGCCACGTGG - Intergenic
970524412 4:16916911-16916933 TGCCACTAGAGGGAGACAGGAGG - Intergenic
976441126 4:85076007-85076029 TGACAGCTCAGGGAGCCAGGTGG + Intergenic
985558432 5:569487-569509 TGCCATCAGAGAGGGCCCCGGGG - Intergenic
985718714 5:1477215-1477237 TGCCATCAGAGGGAAACAAGGGG + Intronic
985881303 5:2640919-2640941 TTCCTGTAGAAGGAGCCACGTGG - Intergenic
986192390 5:5509514-5509536 TGGCTGCAGCTGGAGCCACGTGG - Intergenic
987936971 5:24479430-24479452 TGACATTAGAGGGAGCCAGGAGG + Intergenic
988236820 5:28556838-28556860 TCCCAGCAGAGGTGGCCACAGGG - Intergenic
997718280 5:136058193-136058215 TGCCAGAGGATGGAGCCACTGGG - Intronic
997921575 5:137984709-137984731 TGTCAGCAGAGGTAGCTAGGTGG - Intronic
999280217 5:150360342-150360364 TGGAAGCAGAGGGAACCAGGTGG - Intronic
999400791 5:151262797-151262819 TGGCAGCAGAGGGAGCATGGCGG - Intronic
1001661284 5:173395442-173395464 TGCCAGCAGAGGGCTGGACGAGG + Intergenic
1002579498 5:180199080-180199102 TGCCAGCAGGGGGTGGCAGGTGG - Intronic
1003146044 6:3511596-3511618 AACCAGGAGAGGGAGCCAAGGGG - Intergenic
1003491518 6:6626705-6626727 TGGCAGCAGAAAGAGCCAAGAGG + Intronic
1004036909 6:11932994-11933016 TGCAAGCTGAGGGAGCCAGCCGG - Intergenic
1006134830 6:31888934-31888956 TGCCGGGACAGGGAGCCACTAGG - Intronic
1006523116 6:34583547-34583569 TGCCAGCAGAGGTCACCATGAGG - Intergenic
1006524201 6:34589820-34589842 GGCCAGCAGAGGAAGCCTTGAGG - Exonic
1006610343 6:35290900-35290922 GGCCAGCAGAAGGAGCCTGGAGG + Intronic
1006887113 6:37391130-37391152 TGCCTTCAGAGGCAGCCATGGGG - Exonic
1007256300 6:40531602-40531624 TGCTAGCAGAGGGAGGGAGGGGG - Intronic
1007780850 6:44253680-44253702 CACCAGCAGGGGGAGCCAGGTGG - Exonic
1009870760 6:69450174-69450196 TGCCAGCAGTGGAAGCCACTTGG - Intergenic
1011694469 6:89899565-89899587 TAACAACAGAGGGAGCCAGGTGG + Intergenic
1013273012 6:108560183-108560205 TGGCAGCAGCGGGAGCAAGGAGG + Intronic
1017825545 6:158079150-158079172 AGGCAGCAGAGGGAGCACCGTGG + Intronic
1018181337 6:161226130-161226152 TCCCAGCAGAGGTAGCCAGTAGG + Intronic
1018199866 6:161384701-161384723 TTCCAGCAGAGGGTGCCACATGG - Intronic
1019048785 6:169167772-169167794 TGTCAGCAGATGAGGCCACGGGG + Intergenic
1024557685 7:50617504-50617526 TTCCAGTGGAGGGAGCCACCAGG - Intronic
1027202429 7:76072344-76072366 GGCCTGCAGAGGCTGCCACGAGG + Intergenic
1027270587 7:76516446-76516468 TGCCAGCGGAGGGAGCCCGGTGG + Intronic
1028907347 7:96169689-96169711 ACCCAGCAGAGGGTGCCATGAGG + Intronic
1032975525 7:137218388-137218410 TTCAAGCAGAGAGAGCCATGAGG - Intergenic
1033432278 7:141300161-141300183 AGCCATCAGGAGGAGCCACGTGG + Intronic
1033657521 7:143383193-143383215 TGCCAGCAGAAAGAGCTTCGGGG - Exonic
1034150865 7:148914565-148914587 TGGCACCAGAGGGGGCCACATGG - Intergenic
1034420246 7:150986779-150986801 TGGCAGGAGAGGGAGACAGGAGG + Intergenic
1034433370 7:151051751-151051773 TGCCAGCAGTGGGCACCAGGCGG + Intronic
1036085183 8:5605932-5605954 GACCAGCAGAGTGAGCCACACGG + Intergenic
1036907740 8:12721118-12721140 TGCCTGCAGTGGAAGCCACGTGG + Intergenic
1038223171 8:25630120-25630142 TGCCAGCAGGGGAAACCACATGG + Intergenic
1040050804 8:43011994-43012016 TGCCAGCAGAGGAAGAAATGGGG + Intronic
1040599862 8:48872420-48872442 TGCCTGCAGGGGCACCCACGAGG + Intergenic
1042316794 8:67434654-67434676 TGCCAAGCGAGGGAGCCACTAGG - Intronic
1042633371 8:70844927-70844949 TGCCAGCAGTGGTAGCCATAGGG - Intergenic
1043419609 8:80085201-80085223 TGCCAGCAGAGGGAGCCCAAGGG + Intronic
1047252664 8:123192478-123192500 TGCCAGGAGAGGGAAGTACGGGG - Intronic
1048576214 8:135692045-135692067 TGCCAGGGTGGGGAGCCACGTGG - Intergenic
1048623260 8:136158175-136158197 TGCAGGCAGAGGGAACTACGAGG - Intergenic
1048996122 8:139794638-139794660 TGCCAGGAACGGGAGCCAAGAGG - Intronic
1049560358 8:143307174-143307196 GGGCAGCAGAGGGTCCCACGTGG + Intronic
1049560400 8:143307348-143307370 GGGCAGCAGAGGGTCCCACGTGG + Intronic
1049560599 8:143308141-143308163 GGGCAGCAGAGGGTCCCACGTGG + Intronic
1051331891 9:16032153-16032175 TGGCAGGAGAGGAAGCCAAGTGG + Intronic
1051663898 9:19450430-19450452 TGCCTGCAGAGGGAGACAAGAGG - Exonic
1053669484 9:40346197-40346219 TGCCGGCGGAGGGAGCCCCGTGG + Intergenic
1053919280 9:42972439-42972461 TGCCGGCGGAGGGAGCCCCGTGG + Intergenic
1054380616 9:64486217-64486239 TGCCGGCGGAGGGAGCCCCGTGG + Intergenic
1054515130 9:66030094-66030116 TGCCGGCGGAGGGAGCCCCGTGG - Intergenic
1055623497 9:78149934-78149956 TGCCAGGAGTGGGAGCAAGGAGG + Intergenic
1057841395 9:98488069-98488091 TGCCAGCTGAGGGATGCAGGTGG + Intronic
1057958369 9:99430873-99430895 TGCCAGCAATGGGAGCCAGTAGG - Intergenic
1058869955 9:109192923-109192945 GGCCAGGAGAGGGAGCCCTGTGG + Intronic
1058954684 9:109934655-109934677 TGCCAGCAAAGTCAGCCATGTGG - Intronic
1061883220 9:133578308-133578330 TGGTGGCAGAGGGAGGCACGGGG - Intergenic
1062011137 9:134267489-134267511 AGCCAGAAGAGGGAGCCAGCAGG + Intergenic
1062018393 9:134303893-134303915 TTCCAGCTGAAGGAGCCACATGG - Intergenic
1062120931 9:134833735-134833757 TGTGAGCAGCTGGAGCCACGGGG - Intronic
1062136290 9:134930113-134930135 TTCCAGCAAAGGGAGCCACCTGG + Intergenic
1062389214 9:136327423-136327445 CCCCCGCAGAGGGAGGCACGCGG + Intergenic
1062538080 9:137029532-137029554 GGCCACCAGAGGGAGCTACAAGG + Intronic
1185999317 X:4990012-4990034 AGCCAGCAAAGGCAGCCACAAGG - Intergenic
1187128181 X:16474231-16474253 CATCAGCAGAGGGAGCCAGGTGG + Intergenic
1188472883 X:30560019-30560041 TGCCAGCAGAGAGACCTACTTGG - Exonic
1189166605 X:38867098-38867120 TGGCAGCCGAGGGTGCCAGGTGG + Intergenic
1189526074 X:41823333-41823355 TGCCAGAAGAGAGAGCTAAGAGG - Intronic
1189847663 X:45151477-45151499 AGCCAGCAGAGACAGCCACGTGG + Exonic
1190311524 X:49120241-49120263 TGACAGCAGAGGGAGCCATGAGG + Intronic
1191215432 X:57928285-57928307 AGGCAGCAGAGGGAGCCTGGAGG + Intergenic
1192369085 X:70498642-70498664 TGGCAGCAGAGGGAGGGACCTGG + Intronic
1195200627 X:102547098-102547120 TGCCAGCAAGGAGAGCCAGGAGG - Intergenic
1195694962 X:107660157-107660179 TACCAGCTGAGGGAGCAAAGAGG - Intergenic
1199005833 X:142694461-142694483 TCCCAGCAGTGGTAGCCACAGGG + Intergenic
1200088337 X:153622605-153622627 TGCCAGCTGATGGATCCACAGGG + Intergenic
1202381051 Y:24276763-24276785 GGCCTGCAGAGGCAGCCAGGAGG - Intergenic
1202489734 Y:25393363-25393385 GGCCTGCAGAGGCAGCCAGGAGG + Intergenic