ID: 954322115

View in Genome Browser
Species Human (GRCh38)
Location 3:49839389-49839411
Sequence GCTTTAAAGCTGCCAGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 121}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954322115_954322118 -3 Left 954322115 3:49839389-49839411 CCCTCTGCTGGCAGCTTTAAAGC 0: 1
1: 0
2: 0
3: 10
4: 121
Right 954322118 3:49839409-49839431 AGCACGCACTCCTGGCACTAAGG 0: 1
1: 0
2: 0
3: 4
4: 77
954322115_954322121 14 Left 954322115 3:49839389-49839411 CCCTCTGCTGGCAGCTTTAAAGC 0: 1
1: 0
2: 0
3: 10
4: 121
Right 954322121 3:49839426-49839448 CTAAGGGAATTATTTTACAGTGG 0: 1
1: 0
2: 0
3: 20
4: 175
954322115_954322119 -2 Left 954322115 3:49839389-49839411 CCCTCTGCTGGCAGCTTTAAAGC 0: 1
1: 0
2: 0
3: 10
4: 121
Right 954322119 3:49839410-49839432 GCACGCACTCCTGGCACTAAGGG 0: 1
1: 0
2: 1
3: 4
4: 60

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954322115 Original CRISPR GCTTTAAAGCTGCCAGCAGA GGG (reversed) Intronic
907386037 1:54125837-54125859 GCTTGGAAGAAGCCAGCAGAGGG + Intergenic
907492351 1:54816196-54816218 GTTTTGGAGGTGCCAGCAGAGGG - Intronic
908011341 1:59780362-59780384 ACTGTAAAGCTTCCTGCAGATGG - Intergenic
908223538 1:62033411-62033433 GCTCTAGAGATGTCAGCAGAAGG + Intronic
909195454 1:72615977-72615999 GCTTTAAAGCTACTTGCAGTTGG + Intergenic
911568257 1:99490767-99490789 TCTTTGAAGTTGCCAGAAGAGGG - Intergenic
912370075 1:109167074-109167096 GCTTTAAAGCTGGAAGGAGCGGG + Intronic
913169873 1:116222199-116222221 GCTTCACAGGTGCCAGAAGAGGG - Intergenic
915059762 1:153171692-153171714 ACTTCACAGCTGCCAACAGATGG + Intergenic
915067072 1:153233531-153233553 GCTTAAAAGGGGCCAGGAGAGGG + Intergenic
915447776 1:155983926-155983948 GCTGTGGAGCTCCCAGCAGAGGG - Intronic
916198297 1:162245929-162245951 GCTTTAAAGGAGCTAGCAGTTGG - Intronic
916434535 1:164765462-164765484 GCCTTAAATCTGGCACCAGAAGG - Intronic
917036528 1:170752909-170752931 GCTTTCTAGCTGCCAGCCTAAGG - Intergenic
918078972 1:181191246-181191268 GCTTGAAACCTACCAACAGATGG - Intergenic
922060898 1:222090357-222090379 GCTTTCAAGCTGCAAGGATAAGG - Intergenic
923574769 1:235148434-235148456 TCTTGAAAGATTCCAGCAGAGGG - Exonic
1066448224 10:35503623-35503645 ACTTTAAAGCACTCAGCAGATGG - Intronic
1070129076 10:73644335-73644357 GCTCTGATTCTGCCAGCAGAGGG - Intergenic
1072564517 10:96606477-96606499 GATTTAAGAATGCCAGCAGAAGG - Intronic
1072889126 10:99306249-99306271 GCTTGAAAGCTGCCAAAAAATGG - Intergenic
1074221072 10:111438579-111438601 GCTTCAAAGTCACCAGCAGATGG - Intergenic
1077578622 11:3402930-3402952 TTTCTAAAGCTGCCAGCAGATGG - Intergenic
1078187026 11:9060771-9060793 GCTTTAAATTTGCCAGTAGGGGG - Intronic
1078328087 11:10396746-10396768 ACTTTGAAGCTGGCAGCAGTAGG - Intronic
1080754503 11:35183508-35183530 GCCTGAAAGCTGCTAGCAGGTGG + Intronic
1082308425 11:50613885-50613907 GGTTTAACTCTGCCAGCTGAAGG + Intergenic
1085259299 11:75195253-75195275 GCTTTCCAGCTGCTAGCAGAGGG + Intronic
1089304882 11:117520302-117520324 CCTTTAAAGCTGCCAGCACCCGG - Intronic
1089831793 11:121335532-121335554 GCTTTAGGGCTGCCTGCGGAAGG + Intergenic
1091617998 12:2064515-2064537 GCCTGAAAGCTGCCTTCAGAGGG + Intronic
1093025083 12:14238370-14238392 GCTTAAAAGCATCCAGGAGATGG + Intergenic
1093297220 12:17405437-17405459 TCCTGAAAGCTGCCAGGAGAGGG + Intergenic
1094174234 12:27524992-27525014 GATATAAAGCTGGCAGCTGAAGG - Intronic
1097057036 12:56256621-56256643 GCTTGAAAGTTGACAGCACAGGG - Intronic
1099737663 12:86590787-86590809 GCTTTACACCTGAAAGCAGATGG + Intronic
1100118262 12:91336137-91336159 GTTTTTAAGCTGACAACAGATGG + Intergenic
1100535701 12:95506677-95506699 GAATTAAAGCTGCCAACACAGGG - Intronic
1100645367 12:96523624-96523646 GCTTTTAAGCTGCCTGCATCTGG + Intronic
1102264445 12:111470969-111470991 GCTTTCAAGCTGACACCTGAAGG - Intronic
1102413023 12:112736650-112736672 GATTTAAAGCTGTCAGAATAGGG + Intronic
1104326356 12:127802422-127802444 CTTTTAAAGCTGTGAGCAGATGG + Intergenic
1106561238 13:30848095-30848117 GTCTCAAAGCTGCCAGCAAATGG + Intergenic
1106906103 13:34410770-34410792 GCTTTAAAGCTGGCTGCTGCAGG + Intergenic
1107910699 13:45102871-45102893 GCTTTAAAGAAGCCAGCTGAAGG - Intergenic
1108740216 13:53329996-53330018 TCTTAAAAGTTGCCAGCACAAGG - Intergenic
1111067899 13:83121757-83121779 GCATTAAAGCTGCCTACAAAAGG + Intergenic
1113219892 13:108087851-108087873 GATTTAAAGCATTCAGCAGAAGG - Intergenic
1119450555 14:74706155-74706177 GCATAAAAGCTGCCATGAGATGG - Intronic
1121102684 14:91260982-91261004 TCTTTAAAGCTGACAGTGGATGG - Intergenic
1121797809 14:96750039-96750061 GCTTTAAAGCTGAGAACAGGTGG - Intergenic
1124136808 15:27042472-27042494 CCTCTGAAGCTGGCAGCAGAGGG - Intronic
1127177058 15:56370627-56370649 TCTAAAAAGCTGACAGCAGATGG - Intronic
1131176748 15:90214029-90214051 GCTTTACACCTGGCAGCAAATGG - Intronic
1139351936 16:66342485-66342507 GCTGTGCAGCTGCCAGCAGGGGG + Intergenic
1141285977 16:82672436-82672458 GGACTAAAGCTGCCAGTAGAGGG - Intronic
1141838070 16:86555629-86555651 TCTTTAAAGCGGCAGGCAGATGG + Intergenic
1142050814 16:87956998-87957020 ACTCCTAAGCTGCCAGCAGATGG + Intronic
1143368210 17:6422194-6422216 GTTTTCAAGTTGCCAGCAGGTGG - Intronic
1146231183 17:31111490-31111512 GCTTAAAAGCAGCCAGAAGAGGG + Intronic
1146462064 17:33054221-33054243 GCTTAAAGGCTGGCAGGAGATGG - Intronic
1147897826 17:43762708-43762730 GCTTGTCAGCAGCCAGCAGAAGG - Intergenic
1148833473 17:50452085-50452107 ACCTTAAAGGTGCCAGCAGAGGG - Intronic
1150926733 17:69540176-69540198 GTTTTAAACCTGACAGCAGAGGG - Intronic
1151313079 17:73306049-73306071 CCTTTAATGATGCCAGAAGAAGG + Intronic
1152192376 17:78896650-78896672 GGTTGAAGGCAGCCAGCAGAAGG - Intronic
1154164566 18:12004928-12004950 GTTTTACAGCTGTCTGCAGAGGG - Intronic
1156299380 18:35822572-35822594 GCTTTAAAGATATAAGCAGAAGG - Intergenic
1156506057 18:37594794-37594816 TCTTTAAAACTGCCAGCATCTGG + Intergenic
1158683684 18:59593268-59593290 GATTTAAGGATGCCTGCAGATGG - Intronic
1160146899 18:76372350-76372372 TCTTTGGAGCTGCCAGCACATGG - Intronic
1161936516 19:7375784-7375806 GCTTTGAACCTGCCAGGAGGAGG + Exonic
925723637 2:6852274-6852296 TTTTTAAAACAGCCAGCAGAAGG - Intronic
925809293 2:7683212-7683234 GCTGTAAAGCTGCTAAGAGAGGG - Intergenic
927140432 2:20126560-20126582 GGTTGAAGCCTGCCAGCAGATGG - Intergenic
927317509 2:21702491-21702513 GCTTTAAAACTGTCAGTAGTTGG - Intergenic
930050353 2:47210910-47210932 GCCTCAAAGCAGCCTGCAGAGGG - Intergenic
930941017 2:57014301-57014323 GATTTAAAGCGGCCAGGGGATGG + Intergenic
934160040 2:89240789-89240811 GCTCTATAGCTGCCATCAAATGG + Intergenic
934207234 2:89941645-89941667 GCTCTATAGCTGCCATCAAATGG - Intergenic
945616219 2:212071175-212071197 GCTTTATATCTGCCAATAGATGG - Intronic
1170439535 20:16365046-16365068 AATTTTAAGATGCCAGCAGAGGG - Intronic
1170749397 20:19131877-19131899 GATGTAAAGCTGCCAGCATATGG - Intergenic
1171110043 20:22472522-22472544 CCTTTAATGCTGTCATCAGAGGG - Intergenic
1173617802 20:44414260-44414282 GCTCTAAAGCTGACAGAGGAGGG + Intronic
1174212467 20:48890753-48890775 TCTTCAAAGCTCCCTGCAGAGGG + Intergenic
1175790405 20:61736970-61736992 GCTCTACAGCTGCCAGGAGAAGG + Intronic
1178128553 21:29543829-29543851 GCTTTAAAGTTGCAAGAAAACGG - Intronic
1184993582 22:48186449-48186471 ACTTTAAAGTTTCCAGCGGAAGG + Intergenic
950965900 3:17145567-17145589 GGTTTAAAGTTGCCACCTGAAGG + Intergenic
951589193 3:24244882-24244904 GCTGTTAAGCTCCCAGAAGAGGG - Intronic
953265290 3:41381024-41381046 GATTTAAAGCTGGGGGCAGAGGG - Intronic
954322115 3:49839389-49839411 GCTTTAAAGCTGCCAGCAGAGGG - Intronic
954627120 3:52028658-52028680 GCTTGAATGCTGGCCGCAGATGG - Intergenic
965053241 3:163679531-163679553 GCTTTAAAGCTGTGAGCAGCTGG - Intergenic
965952361 3:174325801-174325823 GCACTAAAGCTGCCAGCTTATGG + Intergenic
967156465 3:186696860-186696882 GCTCTGGAGCTGCCATCAGATGG + Intergenic
968349618 3:198042827-198042849 TCTTTAAAGCTGTCAGCTCAAGG - Intronic
969466728 4:7361711-7361733 GCCTTACAGCTGCCTGCAGTGGG - Intronic
977727790 4:100317411-100317433 CCTGAAAAGCTGCCAACAGAGGG + Intergenic
978401978 4:108340931-108340953 GCTTGAGAGCTGCCAACAAATGG + Intergenic
980221367 4:129920330-129920352 GCTTTAAAGCTGCAAAGAAAAGG + Intergenic
981642606 4:146962594-146962616 TTTTTAAAGCCGACAGCAGAGGG - Intergenic
984699490 4:182809513-182809535 CCTTTAAGGCTGCCAGAAAAAGG - Intergenic
993666665 5:90706824-90706846 GATTTAAAGGTACCAGCAGGGGG - Intronic
995189808 5:109308407-109308429 GCTTTAAAGCTGGGAAGAGAAGG + Intergenic
995934371 5:117490592-117490614 GCATTAAATCTACCATCAGAGGG - Intergenic
997223417 5:132189850-132189872 TCTTTAAAGCAGCCAGGTGAAGG + Intergenic
998184677 5:139968994-139969016 GGTGGAAAGCTGCCGGCAGAGGG + Intronic
1000019909 5:157310012-157310034 CTTTTGAAGCTGGCAGCAGAGGG - Intronic
1004783171 6:18935470-18935492 GCTCTAATGGTGTCAGCAGACGG + Intergenic
1006391712 6:33762439-33762461 GCTTGAATGCTCCCAGCACAGGG + Intergenic
1008365289 6:50671997-50672019 CCTTTAAAGCAGGCAGAAGAGGG + Intergenic
1008686447 6:53930773-53930795 GCTTTAACACTGCCACCAGGGGG - Intronic
1013294688 6:108748120-108748142 GGTTTCAAGCAGCCAGCAGTTGG - Intergenic
1016325134 6:142892363-142892385 GCTTTATCCATGCCAGCAGAGGG - Intronic
1016771093 6:147851784-147851806 GCCTTAAATCTGGGAGCAGATGG + Intergenic
1016987939 6:149909146-149909168 CCTTGAAAGCAGCCAGGAGAGGG + Intergenic
1019924657 7:4184186-4184208 GCTCTGAAGCTTCCAGCCGAGGG - Intronic
1022228539 7:28389774-28389796 GCATTAAATAAGCCAGCAGAGGG - Intronic
1040428081 8:47309526-47309548 GCTTAAAAGATGCCAGGACAAGG + Intronic
1043117664 8:76279284-76279306 ATTATAAAACTGCCAGCAGATGG - Intergenic
1043626644 8:82269510-82269532 GCTCTGAAGCTAGCAGCAGAGGG + Intergenic
1048820131 8:138372831-138372853 GCTAGAAAGCTCCCAGCACAGGG - Intronic
1059249183 9:112872773-112872795 GCCTTCAAGATGGCAGCAGATGG + Exonic
1059638503 9:116193269-116193291 GGGCTATAGCTGCCAGCAGAGGG - Intronic
1061764251 9:132871450-132871472 CCATAAAAGCTGCCAGCTGAGGG + Intronic
1188496367 X:30787288-30787310 ACTTAAAAGCTGTCTGCAGATGG - Intergenic
1192157734 X:68758998-68759020 CCTCTACAGCTGTCAGCAGATGG - Intergenic
1194946119 X:100069856-100069878 GCTTCAAAGCTGGCTACAGAAGG - Intergenic
1195023377 X:100851247-100851269 GTTTTACCGCTCCCAGCAGAAGG - Exonic
1199338340 X:146645528-146645550 GCTTTGAAGATGCCAGAGGATGG + Intergenic