ID: 954322119

View in Genome Browser
Species Human (GRCh38)
Location 3:49839410-49839432
Sequence GCACGCACTCCTGGCACTAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 60}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954322112_954322119 15 Left 954322112 3:49839372-49839394 CCTTCTGCCTCGTGGCTCCCTCT 0: 1
1: 0
2: 2
3: 36
4: 454
Right 954322119 3:49839410-49839432 GCACGCACTCCTGGCACTAAGGG 0: 1
1: 0
2: 1
3: 4
4: 60
954322115_954322119 -2 Left 954322115 3:49839389-49839411 CCCTCTGCTGGCAGCTTTAAAGC 0: 1
1: 0
2: 0
3: 10
4: 121
Right 954322119 3:49839410-49839432 GCACGCACTCCTGGCACTAAGGG 0: 1
1: 0
2: 1
3: 4
4: 60
954322111_954322119 20 Left 954322111 3:49839367-49839389 CCAATCCTTCTGCCTCGTGGCTC 0: 1
1: 0
2: 3
3: 14
4: 176
Right 954322119 3:49839410-49839432 GCACGCACTCCTGGCACTAAGGG 0: 1
1: 0
2: 1
3: 4
4: 60
954322114_954322119 8 Left 954322114 3:49839379-49839401 CCTCGTGGCTCCCTCTGCTGGCA 0: 1
1: 0
2: 5
3: 25
4: 251
Right 954322119 3:49839410-49839432 GCACGCACTCCTGGCACTAAGGG 0: 1
1: 0
2: 1
3: 4
4: 60
954322116_954322119 -3 Left 954322116 3:49839390-49839412 CCTCTGCTGGCAGCTTTAAAGCA 0: 1
1: 0
2: 1
3: 13
4: 171
Right 954322119 3:49839410-49839432 GCACGCACTCCTGGCACTAAGGG 0: 1
1: 0
2: 1
3: 4
4: 60

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954322119 Original CRISPR GCACGCACTCCTGGCACTAA GGG Intronic
901383363 1:8890113-8890135 GCACGGACTCCTGGCAAGAGAGG + Intergenic
916242592 1:162655088-162655110 CCAAGCACACCAGGCACTAAAGG - Intronic
917517474 1:175719928-175719950 GCAGGCACGCCTGCCACTACAGG - Intronic
923967270 1:239155890-239155912 GCACTCTCTCCTGGCAGTCAGGG - Intergenic
924954681 1:248914927-248914949 GCACACAGTCCTGACACTGAAGG - Intronic
1063423822 10:5935888-5935910 GCACTCACGCCTGGCACGCAGGG - Intronic
1071678988 10:87685428-87685450 GCCTGCAATCCTGGCACTTACGG + Intronic
1073641128 10:105253490-105253512 GCACGCTGTCCTGGAAGTAAAGG + Intronic
1087573118 11:99955821-99955843 GCCCGTACTCCTGGCACTTTAGG - Intronic
1094459768 12:30682967-30682989 GCAGCTACTACTGGCACTAAAGG - Intronic
1095982881 12:47982855-47982877 CCCGGCACTCCTGGCACTGATGG - Exonic
1099671007 12:85692658-85692680 TCACACACTTCTGGCACTAAGGG + Intergenic
1101502666 12:105318850-105318872 GCCCGCAATCCTGGCACTTTAGG + Intronic
1103841560 12:123869475-123869497 ACACTCACTCCTGGCTCCAAAGG + Intronic
1108585640 13:51867536-51867558 GCCCACTCTCCTGGCACCAAGGG - Intergenic
1112999149 13:105612087-105612109 GCATGCACTCCTGGATTTAAAGG + Intergenic
1116869755 14:50059963-50059985 CCATGCACTCCAGGCACTGAGGG + Intergenic
1123114501 14:105888488-105888510 GCACCCACTCCTGGGACTGAGGG - Intergenic
1130537698 15:84798806-84798828 GAACCCACTCCTGGCACTCCTGG - Exonic
1131901223 15:97089901-97089923 GCCCTCACTCCTGGCACCAGTGG + Intergenic
1132650176 16:1017659-1017681 TCACGCACTGCTGGCAGGAATGG - Intergenic
1135507673 16:23052853-23052875 GCACCCACCTCTGTCACTAAAGG + Intergenic
1138590377 16:57996323-57996345 GCTCGTACTCCTGGCACCAGCGG - Exonic
1143055540 17:4159261-4159283 GCATGCAATCCTGGCACTTTGGG - Intronic
1147012724 17:37464507-37464529 GCAGGAACTGCTGGCAGTAATGG - Intronic
1147334086 17:39716389-39716411 CCACGCACTCCTGGCCCCGAAGG - Exonic
1148805602 17:50262333-50262355 GCAGGCAATCCTGGCCCTCAGGG + Intergenic
1155686136 18:28553757-28553779 GCATGCCCTCCTGGCAATGATGG - Intergenic
1162545357 19:11325812-11325834 GCCTGTAATCCTGGCACTAAAGG + Intronic
1167669005 19:50839025-50839047 GCCCGCACTCCTGGGTCTGAGGG + Intergenic
925118073 2:1397385-1397407 GCAGGCACTCAGGGCACTCAGGG - Intronic
931396895 2:61895726-61895748 GCAGGCAGTACTGGCCCTAACGG - Intronic
932564415 2:72896537-72896559 GCACCGACTCCGGGCACAAAAGG + Intergenic
932993457 2:76817181-76817203 GCATGCACTCCTGGCACTCATGG - Intronic
935041897 2:99439113-99439135 GGACACACTCCTAGCTCTAATGG - Exonic
938078314 2:128353997-128354019 GCACACAATCCAGGCACTCATGG - Intergenic
941674428 2:168328692-168328714 GCAGGCACTGCTGGCATGAATGG + Intergenic
942336180 2:174888823-174888845 GCACTCACTCAAAGCACTAATGG + Intronic
943529162 2:189057327-189057349 GCAGGAACTCCTGGCCCCAAGGG - Exonic
949069356 2:242014144-242014166 GCAGACACTGCAGGCACTAAAGG - Intergenic
1179630061 21:42672255-42672277 GCACGCACCCCTGGAGCTGAGGG + Intronic
950549130 3:13655640-13655662 ACAGGCACTAATGGCACTAATGG - Intergenic
954322119 3:49839410-49839432 GCACGCACTCCTGGCACTAAGGG + Intronic
960616274 3:119598884-119598906 GCATGCTCTCCTTGCACTCATGG + Intronic
963943864 3:151123709-151123731 ACAGGCACTCCTAACACTAAAGG - Intronic
968448025 4:662272-662294 GCAGGCCCTCCTGGTACCAAGGG + Intronic
969423496 4:7110663-7110685 GCACTCATTCCAGGCACTAGCGG - Intergenic
977033890 4:91924871-91924893 GCCCACACTGCTGGCACCAAGGG - Intergenic
983436763 4:167725147-167725169 GCCCCCACTTCTGGCACTCAGGG + Intergenic
986211775 5:5680242-5680264 GAACTCACTCCTTGCACTATTGG + Intergenic
995014420 5:107293741-107293763 GCACGCATTCCTTGGATTAAAGG - Intergenic
1000773578 5:165388554-165388576 GCAGGCACACATGGCAGTAATGG - Intergenic
1002175757 5:177400243-177400265 GCGCGCGCTCCTGGTGCTAATGG - Exonic
1011704816 6:89990204-89990226 GCACCGACTCCTGTCTCTAAGGG - Intronic
1022517157 7:30983394-30983416 ACACTCACTGCTGACACTAATGG - Intronic
1023860078 7:44213292-44213314 GCACCCACTCCTGGTGCTCAAGG - Exonic
1031678547 7:124641647-124641669 TCACCCACTCCTGTCACTAAAGG - Intergenic
1036005514 8:4657439-4657461 TCACGCACTCTTGGCATTCATGG + Intronic
1037113531 8:15195576-15195598 GCACGGACTCTTGTCACCAAAGG - Intronic
1037750727 8:21680452-21680474 TCCTGCACTCCTGTCACTAATGG + Intergenic
1042351066 8:67778161-67778183 GGACGCATTTCTGGCACTAAGGG + Intergenic
1049894914 9:104145-104167 GCACGCACTCCCCGCATCAAGGG - Intergenic
1055128893 9:72752119-72752141 GCTCCCAATCCTTGCACTAAAGG + Intronic
1187294681 X:17987136-17987158 GCACTCACTTCTGGCACAGATGG + Intergenic
1192264934 X:69531512-69531534 ACAGGCCCTGCTGGCACTAAAGG - Exonic
1193352235 X:80477005-80477027 GCCAGCACTCCAGGCACTAGTGG - Intergenic