ID: 954322500

View in Genome Browser
Species Human (GRCh38)
Location 3:49841690-49841712
Sequence GGGTTCAAACAAAGGCAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 288
Summary {0: 1, 1: 0, 2: 4, 3: 29, 4: 254}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954322493_954322500 23 Left 954322493 3:49841644-49841666 CCAAGAAACTGGCAGCAGGCCAC 0: 1
1: 0
2: 2
3: 24
4: 186
Right 954322500 3:49841690-49841712 GGGTTCAAACAAAGGCAGCATGG 0: 1
1: 0
2: 4
3: 29
4: 254
954322496_954322500 4 Left 954322496 3:49841663-49841685 CCACATAGTTGCTGAAAGGTGGA 0: 1
1: 0
2: 0
3: 64
4: 161
Right 954322500 3:49841690-49841712 GGGTTCAAACAAAGGCAGCATGG 0: 1
1: 0
2: 4
3: 29
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954322500 Original CRISPR GGGTTCAAACAAAGGCAGCA TGG Intronic
900735486 1:4297127-4297149 GGAATCAAACAAAGCCAGGAGGG + Intergenic
901118906 1:6874289-6874311 GGATTCGAACCAAGGCAGCCTGG - Intronic
901245476 1:7727016-7727038 TGCTTCAAACAAAGACAACAGGG - Intronic
903630654 1:24767205-24767227 GGATTCAAACACAGGCCACATGG - Intronic
903686306 1:25134868-25134890 GGATTCAAACACAGGCAGTTTGG + Intergenic
904894022 1:33800642-33800664 GGGCTCAAACCAGGGAAGCATGG + Intronic
907676814 1:56525614-56525636 GAGTTAAGACAAAGGCAGCAGGG - Intronic
909022776 1:70450554-70450576 GGATTCAAATTCAGGCAGCATGG - Intergenic
909519471 1:76550590-76550612 GGATTCAAACTCAAGCAGCATGG - Intronic
909996692 1:82289079-82289101 GGGTTCCAACAGTGGCACCATGG + Intergenic
910955133 1:92695018-92695040 GGATTCAAACATAGGCAGTTTGG - Intronic
911446815 1:98004839-98004861 GGGATCACACAAAAGCAGAAAGG - Intergenic
912239926 1:107895560-107895582 GGATTCAAACTGAGGCAGCCTGG + Intronic
913657366 1:120974182-120974204 GGGATTAAACCAAGGCAGCCTGG - Intergenic
914521922 1:148425462-148425484 GGGATGAAACCAAGGCAGCCTGG - Intergenic
914647342 1:149665917-149665939 GGGATTAAACCAAGGCAGCCTGG - Intergenic
915282367 1:154831281-154831303 GGCTCCATACAAAGGCAGAATGG + Intronic
915511933 1:156391271-156391293 GGGTGGAGACAAAGGCACCACGG + Intergenic
915808894 1:158885916-158885938 GGAGTTAAACAAAGGCAGTAAGG - Intergenic
915842637 1:159227897-159227919 GGATGCAAGCAAAGGAAGCAGGG - Intergenic
917239069 1:172927906-172927928 GGCTTCAAACCTAGGCAGCTTGG + Intergenic
917950068 1:180023002-180023024 GGATTTAAACAAAGGCAGTCTGG - Intronic
918269662 1:182885742-182885764 AGGTTCAAACCCAGGCAACATGG + Intronic
918291239 1:183110136-183110158 GGTTTCAAACCCAGGCAGCCTGG + Intronic
918335950 1:183513334-183513356 GGGAGAAAAGAAAGGCAGCAAGG - Intronic
922797459 1:228347553-228347575 GGGTTCAAACACAGACACCTGGG - Intronic
923536785 1:234858586-234858608 GGGATCAGTCAAAGGCAGAATGG - Intergenic
924687697 1:246312217-246312239 GATTTCATACAAAGGCAGTAGGG + Intronic
1065182345 10:23139251-23139273 GGATGCAAGCAAAGGAAGCAGGG - Intergenic
1065186049 10:23172344-23172366 GGCTTCAAAAGAAGGAAGCAAGG - Intergenic
1068568502 10:58602860-58602882 ACATGCAAACAAAGGCAGCAAGG - Intronic
1070365391 10:75732141-75732163 TGGTTCAACCAAATGCATCAGGG + Intronic
1070648601 10:78219059-78219081 AGGCAGAAACAAAGGCAGCAAGG - Intergenic
1072902924 10:99425549-99425571 GAATTCACACAATGGCAGCAGGG + Intronic
1073118997 10:101110053-101110075 GGATTCAAACCCAGGCAGCATGG - Intronic
1073445025 10:103575422-103575444 GGCTTCAGACAAAGGGGGCAGGG - Intronic
1074875014 10:117606921-117606943 GGGTTTAAACAATGTCACCAGGG + Intergenic
1075281188 10:121139814-121139836 GGATTCAAACCTAGGCAACATGG - Intergenic
1075934895 10:126331950-126331972 GGGTGCAACCACTGGCAGCATGG + Intronic
1076661332 10:132057732-132057754 GGGCTGAAACGAAGGCAGCTGGG + Intergenic
1077349451 11:2085734-2085756 GGGTTCAGACAATGACAGGATGG + Intergenic
1077653708 11:3998269-3998291 GGATTCAAACCCAGGCAGCCAGG + Intronic
1077905749 11:6531949-6531971 GGATTCAGACTCAGGCAGCATGG - Intronic
1078099478 11:8321305-8321327 GGGGTCAGACAAAGGCAGAGTGG + Intergenic
1078484284 11:11707267-11707289 GGATTCATACAAAGGCAGCATGG + Intergenic
1079399259 11:20092615-20092637 TGGATCAAACAAACTCAGCATGG - Intronic
1079490321 11:20981903-20981925 GGGCTCAAACAATGTCACCAAGG + Intronic
1079528300 11:21417035-21417057 GGACACAAACCAAGGCAGCATGG + Intronic
1079693344 11:23447250-23447272 GGGTGCAAATAAAGGCATCTAGG + Intergenic
1083261841 11:61527428-61527450 GGATTCAAACCCAGGCAGCCTGG + Intronic
1084215364 11:67644555-67644577 GGGTTCCAGGGAAGGCAGCAGGG + Intronic
1085352838 11:75811227-75811249 TGGCTGAAACAAAGGCTGCATGG - Intergenic
1085419069 11:76340007-76340029 GGGTTCAAATCAAGGCAGTTAGG + Intergenic
1085737462 11:79051362-79051384 GGGTTCCAACCCAGGCAGCCTGG + Intronic
1085897261 11:80654926-80654948 GGATTCAAACAAAGGCTGTCTGG + Intergenic
1085928583 11:81053673-81053695 GGATTCAAACAGCAGCAGCATGG - Intergenic
1088551195 11:111014091-111014113 GGGGTCAAAAACAGGCAGGAAGG - Intergenic
1089093198 11:115895834-115895856 CTGTGCAAACAAAGGCAGTAAGG - Intergenic
1090582943 11:128179831-128179853 AAGTTAAAACAAAGACAGCAAGG - Intergenic
1091148272 11:133300316-133300338 GAGTTCACACAAGAGCAGCAGGG - Intronic
1091288326 11:134421722-134421744 GGGTTCAAGCAGAAGCAGAATGG - Intergenic
1092658488 12:10713469-10713491 GGTTTTAAACAAAGTGAGCAAGG + Intronic
1093056764 12:14563786-14563808 GGCTTCAAACACAGGCATTAGGG + Intronic
1094838168 12:34331904-34331926 GGGTCCAGCCGAAGGCAGCAGGG + Intergenic
1094844155 12:34354161-34354183 GGGTCCAGACCAAGGCGGCAGGG - Intergenic
1095941581 12:47730805-47730827 GGATTCAAACCCAGGCAGCTTGG - Intergenic
1096889154 12:54749082-54749104 GGATTCAAACTCAGGCAGCCTGG + Intergenic
1097853685 12:64439095-64439117 GGCTTCAAACCAAGGCAGTCTGG + Intronic
1098167470 12:67713180-67713202 GTGTTTAAACAAAAACAGCAAGG + Intergenic
1098188944 12:67927213-67927235 GGGTTCAAACTCAGGCAAAATGG + Intergenic
1098232983 12:68391688-68391710 AGGTTAAAACACGGGCAGCATGG + Intergenic
1098811873 12:75104814-75104836 GGATTCAAACCCAGGCAGTATGG + Intronic
1099890547 12:88584220-88584242 TGGTCCAAACAGAGGCAGAAAGG - Intergenic
1100699051 12:97126728-97126750 GGAATCAAACCTAGGCAGCAGGG + Intergenic
1101794046 12:107956426-107956448 AGGGTCAGACAAAGGCACCATGG + Intergenic
1102576091 12:113856962-113856984 GGGTTCAAACTCAGGCAGTCTGG + Intronic
1103915912 12:124375661-124375683 GGGTTCAAACCCAGGCAGCCCGG - Intronic
1105249480 13:18685050-18685072 GGCCTCAAACAAAGTCACCATGG + Intergenic
1106067730 13:26372664-26372686 GGGTTCAAATACAGGGAGTATGG - Intronic
1106738284 13:32610903-32610925 GGTTTGAACTAAAGGCAGCATGG - Intronic
1106883189 13:34153926-34153948 GGGTACAAAAAAATGCACCAGGG - Intergenic
1107183759 13:37493379-37493401 GGATTTAAACCAAGGCAGCACGG - Intergenic
1107672883 13:42764563-42764585 GGGTTTAAACGCAGGCAGCCTGG - Intergenic
1110151447 13:72259681-72259703 TGGTTCAAACTAAGGCAGTTGGG + Intergenic
1112427233 13:99313629-99313651 GGTTTCAGACAAAGGGAGGAAGG + Intronic
1115668138 14:35576804-35576826 GGATTCAAACCAAGGCAGGCTGG + Intronic
1117445630 14:55801346-55801368 GGGAATAAACAAAGGCAGCTTGG - Intergenic
1117956963 14:61130469-61130491 GGGATCTAACAAGGACAGCAAGG + Intergenic
1118145093 14:63126326-63126348 GAGATCAAACAAATCCAGCATGG - Intergenic
1119571240 14:75675333-75675355 GGGTTTAAACAAAAATAGCATGG - Intronic
1120982270 14:90300834-90300856 GCATTTAAACAAAGGCAGAAAGG + Intronic
1121412425 14:93757189-93757211 GGGTTTAAAAAAAGGAAGGAAGG + Intronic
1121814590 14:96919629-96919651 AGATTCAAACCCAGGCAGCATGG + Intronic
1202899066 14_GL000194v1_random:25418-25440 GGGCTCAAACAATGGAAGCCAGG + Intergenic
1125860079 15:42990802-42990824 GGATTCAAACCCAGGCAGCTTGG - Intronic
1126136790 15:45400440-45400462 GGTTGCAAACAAAAGCAACAAGG - Intronic
1127009774 15:54610779-54610801 GGATTCAAACCCAGGCAGTATGG + Intronic
1130358431 15:83156995-83157017 GGGTTCTAAGAAATGCATCATGG - Intronic
1131003230 15:88955031-88955053 GGGTGCAGAGAAAGGCAGCATGG + Intergenic
1132503621 16:296218-296240 GGCTTCCAACACAGGCAGGAGGG + Intronic
1135613415 16:23888464-23888486 GAGATCACAGAAAGGCAGCAAGG - Intronic
1137645297 16:50067960-50067982 GGGTACAAACAAAGGGTTCAGGG + Intronic
1138778397 16:59753272-59753294 GGGTTCAGTCAAAGTCAGCCTGG + Intronic
1139072317 16:63397962-63397984 GGATGCAAGCAAAGGAAGCAGGG - Intergenic
1142469980 17:157888-157910 AGGTTCAAAGAAAGGCAGAAAGG + Intronic
1145247875 17:21281544-21281566 GGATGCAAGCAAAGGAAGCAGGG + Intergenic
1145688523 17:26705005-26705027 GGTTTCCAACAAAGGCCTCAAGG - Intergenic
1145812462 17:27772668-27772690 AGGTTGGAACAATGGCAGCAGGG + Intronic
1146223426 17:31046466-31046488 GGGTTCAAACCCAGGCAGCCTGG + Intergenic
1146280545 17:31541586-31541608 GGATTCAAGCCCAGGCAGCAGGG + Intergenic
1146341563 17:32023504-32023526 GGGTTCAAACCCAGGCAGCCTGG - Intronic
1146351238 17:32096119-32096141 GGGTTCAAACCCAGGCAGCCTGG + Intergenic
1146811578 17:35908099-35908121 GGGTTCAAACCCAGGCAGCCTGG + Intergenic
1146944765 17:36866093-36866115 GGGTTCAAACCAAGGCCAGATGG + Intergenic
1147233001 17:39032794-39032816 GGGTTCAAACCCAGGCAGCCTGG - Intergenic
1147932299 17:43989648-43989670 GGGTTAATACAAGGCCAGCATGG + Intronic
1148173816 17:45547345-45547367 GGGTTCAAACCCAGGCAGCCTGG + Intergenic
1148275452 17:46298102-46298124 GGGTTCAAACCCAGGCAGCCTGG - Intronic
1148297558 17:46515681-46515703 GGGTTCAAACCCAGGCAGCCTGG - Intronic
1148362110 17:47020160-47020182 GGGTTCAAACCCAGGCAGCCTGG - Intronic
1149378090 17:56065553-56065575 GTGTTCAAATAAAGGAAGAATGG - Intergenic
1149590503 17:57826093-57826115 GGGTTTGAACCAAGGCAGCCTGG + Intergenic
1150405028 17:64894267-64894289 GGGTTCAAACCCAGGCAGCCTGG + Intronic
1150548812 17:66190712-66190734 AAGTTTAAAAAAAGGCAGCATGG - Intronic
1150784066 17:68148880-68148902 GGGTTCAAACCCAGGCAGCCTGG + Intergenic
1152108889 17:78346132-78346154 GGATCCAAACCTAGGCAGCAGGG - Intergenic
1153923100 18:9808600-9808622 GGATTCAAACAAAGAGAGAAGGG - Intronic
1154439353 18:14373851-14373873 GGCCTCAAACAAAGTCACCATGG - Intergenic
1156741635 18:40337515-40337537 GGCTTAAAACAAATGAAGCATGG + Intergenic
1157102566 18:44743803-44743825 GGGAGCAGACAATGGCAGCAGGG - Intronic
1158512287 18:58101149-58101171 GGCTTCAAAAAATGTCAGCAGGG + Intronic
1159784173 18:72694091-72694113 AGGTTCAAACAAGGGGAGGAAGG + Intergenic
1159962889 18:74569002-74569024 GGGAAAAAACAAAGGCAGGAGGG + Intronic
1164049329 19:21570648-21570670 GGCATCTAACAAAGGCAGAAAGG + Intergenic
1164749074 19:30637859-30637881 AGGGTTAGACAAAGGCAGCAAGG + Intronic
1164832661 19:31334547-31334569 GGCTTCAGGCAAAGCCAGCAGGG + Intronic
1164862650 19:31574687-31574709 AGGTACAAACAAAGGTGGCATGG + Intergenic
1165882606 19:39054150-39054172 GAGTTCAAAAAAAGGCAGGGTGG - Intergenic
1166076837 19:40418560-40418582 GGGTTCAAACCCAGGCAGTCTGG + Intergenic
1167675198 19:50879681-50879703 GAGTTCAAACAGATACAGCATGG + Exonic
925491310 2:4396458-4396480 GATTTCCAACAAAGGCACCAAGG - Intergenic
927824989 2:26302145-26302167 GGGTTCCTCCACAGGCAGCAGGG - Intergenic
928428688 2:31200303-31200325 GTGTTCAAACCAGAGCAGCAAGG - Intronic
929911191 2:46090723-46090745 AGCTTGATACAAAGGCAGCATGG - Intronic
930873512 2:56189861-56189883 TGGTGCAAACAAAGGCAGGGAGG + Intronic
931687428 2:64806438-64806460 GGGTTCAAATCAAGGCAGAGTGG - Intergenic
932667085 2:73706727-73706749 GGGGGCAAACCAAGGCAGCCTGG + Intergenic
932796149 2:74697953-74697975 GAGTTCACTCACAGGCAGCAAGG + Intergenic
933783369 2:85817749-85817771 GGGTTCAAATCTAGGCAGCCAGG - Intergenic
936948263 2:117950840-117950862 GGATTCAAATACAGGCAGCCTGG - Intronic
937843875 2:126555819-126555841 GGATGCAAGCAAAGGAAGCAGGG + Intergenic
939103601 2:137924520-137924542 GGCCTCAAACAAAGTCACCATGG + Intergenic
940503045 2:154518727-154518749 GGTTTGAGACAAATGCAGCATGG + Intergenic
943565805 2:189514849-189514871 GAGGTCAAACAAGGTCAGCAGGG - Intergenic
943802220 2:192075414-192075436 GAGTTTAAACAAAGACAACATGG + Intronic
945517478 2:210780215-210780237 GGGAGCCAACAAAGGCAACAGGG + Intergenic
947982256 2:234420505-234420527 TGGTTCTAAACAAGGCAGCAAGG + Intergenic
948496292 2:238352004-238352026 GGGAAGAAACAAAGGCAGGAGGG + Intronic
948550841 2:238772247-238772269 GGGTTGACACAAAGACAGCTGGG + Intergenic
948670150 2:239563403-239563425 GGGCTCAGGCCAAGGCAGCAAGG - Intergenic
1169395172 20:5222766-5222788 AGGTTGAAAAAAAGGCAGCTGGG - Intergenic
1170030381 20:11938060-11938082 GGGTGCACACAATGGCTGCATGG + Intergenic
1170748579 20:19123540-19123562 GGATTCAAAGAAAGGAAGTAGGG + Intergenic
1172110050 20:32539225-32539247 GGGTTCAAACCTAGGCAGGATGG - Intronic
1173310057 20:41889325-41889347 GTGTTCAAGCAAAGCCAGAATGG + Intergenic
1173865659 20:46311165-46311187 GGATTCAAACCAAGGCAGGCTGG + Intergenic
1173928817 20:46801194-46801216 GGGCTCAAGCGTAGGCAGCACGG - Intergenic
1176456330 21:6915557-6915579 GGCCTCAAACAAAGTCACCATGG + Intergenic
1176691349 21:9914312-9914334 TGGTTCAAATAAATACAGCATGG - Intergenic
1176834504 21:13780617-13780639 GGCCTCAAACAAAGTCACCATGG + Intergenic
1178722078 21:35018963-35018985 TTGTTCGAACAAAGGCAGCTTGG + Intronic
1180151995 21:45953404-45953426 GGCATCTAACAAAGGCAGAAAGG + Intergenic
1180839200 22:18950958-18950980 TGTTCCAAACACAGGCAGCAGGG + Intergenic
1182420141 22:30245007-30245029 GGGGTCCAACAATGGCCGCATGG + Intronic
1183250756 22:36728802-36728824 GGGCTCATAGAAAGGCAGCGGGG + Intergenic
1184470756 22:44694612-44694634 GGATTCAAACTCAGGCAGGAGGG - Intronic
1185108696 22:48888724-48888746 CTGTGGAAACAAAGGCAGCAAGG + Intergenic
949967760 3:9373181-9373203 GGATTTAAACCAATGCAGCACGG - Intronic
950528637 3:13539767-13539789 GGCTTCAAACCCAGGCAGCCTGG + Intergenic
951219587 3:20055159-20055181 GGGTTCAAACCCAGGCAGTCTGG - Intronic
951644407 3:24872288-24872310 GAGCTGAAACAAAGGCAGCAAGG - Intergenic
954322500 3:49841690-49841712 GGGTTCAAACAAAGGCAGCATGG + Intronic
955267490 3:57460743-57460765 GGGTTCAAACCAAGGCAGTTTGG - Intronic
955409174 3:58644834-58644856 GGATTCAAACAATGTCATCAGGG - Intronic
955961795 3:64348301-64348323 TGGCTCAAACACAGGGAGCAGGG + Intronic
956421198 3:69087547-69087569 GGATTCTATCAAAAGCAGCAAGG - Intronic
956864036 3:73351952-73351974 GGATTCAAACCCAGGCAGCCTGG - Intergenic
958731263 3:97962851-97962873 GGATTCAAATTCAGGCAGCATGG + Intronic
962777107 3:138672038-138672060 GGGATCTAACAAAGGCAAAAAGG + Intronic
964276450 3:155013303-155013325 GGATTCAAACCCAGGCAGCTGGG + Intergenic
965803241 3:172515850-172515872 AGGTCCAAACAAAGCCAGAAGGG + Intronic
967306024 3:188060403-188060425 AGGTGCAGACAAAGGCAGAAAGG - Intergenic
967567299 3:190987649-190987671 GGGCTCAGAAAAAGACAGCAAGG + Intergenic
976829276 4:89295576-89295598 GGGTTCCAACAAAGGCAGAATGG + Intronic
976913537 4:90339946-90339968 GGCATCAAACAAAGAAAGCATGG + Intronic
977003695 4:91537263-91537285 AGATTTAAACCAAGGCAGCAGGG + Intronic
979573583 4:122259285-122259307 GGTTTCAAACCAAGGCAGTCTGG - Intronic
980088940 4:128421371-128421393 TGGTGGAAACAGAGGCAGCAAGG + Intergenic
980484246 4:133433649-133433671 GGGTTAGAAGATAGGCAGCAAGG - Intergenic
981073192 4:140566923-140566945 GGGTTCAAACCCAGGCAGTCTGG - Intronic
981508473 4:145528846-145528868 GGATTCAAACCTAGGCAGCCTGG - Intronic
981965339 4:150593464-150593486 GGATTTAAAAACAGGCAGCACGG + Intronic
983379024 4:166967822-166967844 GGGCTCAAAAAAAGACAGAAAGG + Intronic
984677791 4:182570132-182570154 GGACTCAGACAATGGCAGCAGGG + Intronic
986797609 5:11227381-11227403 GGGTTCAAATGCAGGCAGCCTGG + Intronic
987865360 5:23528927-23528949 GGCATCTAACAAAGGCAGAAAGG + Intergenic
992424791 5:76645697-76645719 GTTTCCAAACAAAGGCAGCTTGG - Intronic
994093473 5:95828207-95828229 GAGTTCACACACAGGCACCAAGG + Intergenic
995002682 5:107153817-107153839 GTGTGCAAACAAAGGAATCATGG - Intergenic
995772261 5:115684334-115684356 GTGATCAAACAAATGCAACAGGG - Intergenic
996062292 5:119045579-119045601 GGATTCAAACACAGGCAGTCTGG + Intronic
997384713 5:133463548-133463570 GGGTGCAAACCCAGACAGCAAGG + Intronic
999748478 5:154609506-154609528 GGGTTCTAACACAGGCAGGCAGG - Intergenic
1000846876 5:166292611-166292633 GTGTTCAAATCAAGGCAGCCAGG - Intergenic
1001433975 5:171685410-171685432 ATGTTCAAACCCAGGCAGCAGGG + Intergenic
1001485324 5:172115662-172115684 GGGTTCAAACCAAGGCAGCTGGG - Intronic
1003002454 6:2348922-2348944 GAGGTTGAACAAAGGCAGCAGGG - Intergenic
1003841659 6:10126879-10126901 GGGTTAAGAAAAGGGCAGCACGG - Intronic
1004223723 6:13768452-13768474 GGGTTCAAACCAAGGCAGCCTGG + Intergenic
1004845650 6:19638927-19638949 GTCTTCAAAAAAAAGCAGCAAGG - Intergenic
1006139834 6:31921593-31921615 GGATTCAAACCCAGGCAGCATGG - Intronic
1006541981 6:34747473-34747495 GGATTCAAACACAGGCAGACTGG + Intergenic
1008367832 6:50703629-50703651 GGATGCAAGCAAAGGAAGCAGGG - Intergenic
1010751365 6:79619498-79619520 GGGTATAAACAAAGGCAACAAGG - Intergenic
1010830666 6:80524335-80524357 GTGTTCAGAGAAGGGCAGCAAGG - Intergenic
1010937627 6:81880666-81880688 GGGATCAAATAAAGGCAGCCTGG - Intergenic
1011322266 6:86108771-86108793 CGATTCAAACAGAGGCAGCATGG - Intergenic
1011352722 6:86440144-86440166 GCATTCAAACAAAGGCTGAATGG + Intergenic
1011454522 6:87533534-87533556 GGCTTCATAATAAGGCAGCATGG + Intronic
1013005148 6:106065769-106065791 GGGTTCAATCCATGGAAGCAGGG - Intergenic
1014696776 6:124631547-124631569 GTGTTCAAGCAAAGGCTGAATGG - Intronic
1014933229 6:127358398-127358420 GGATGCAAGCAAAGGAAGCAGGG - Intergenic
1016793741 6:148095229-148095251 GAGTTAAGACAATGGCAGCAGGG + Intergenic
1017858170 6:158369999-158370021 GGTCTCAAACTAGGGCAGCATGG + Intronic
1018383434 6:163281244-163281266 GGGCTCAAGAAACGGCAGCAAGG + Intronic
1018899022 6:168041999-168042021 GGGAGCAAACAGAGGCAGGAAGG + Exonic
1019115542 6:169758500-169758522 GTGGTTAAACAGAGGCAGCAGGG - Intronic
1019604265 7:1900704-1900726 GAGATCTATCAAAGGCAGCACGG - Intronic
1020909608 7:14112047-14112069 TGGTTGAAACAAAGTGAGCAAGG - Intergenic
1021281694 7:18727693-18727715 GAGGTAAAACAGAGGCAGCAGGG - Exonic
1021579027 7:22132927-22132949 GGATTCAAACAAAGGGAGGCTGG + Intronic
1022323815 7:29311574-29311596 AGGTTCAAACACAGGCAGTGTGG + Intronic
1022847494 7:34225622-34225644 AGGTTCAGACAAAGGAAGAAGGG + Intergenic
1023851046 7:44150683-44150705 GGGCTCAAACTCAGGCAGCCGGG - Intronic
1028402261 7:90436578-90436600 GGTTTCATACAAGGGAAGCAGGG + Intronic
1029581935 7:101442103-101442125 GGGTGCAAACAACAGCAGCTTGG + Intronic
1030380340 7:108803832-108803854 GGGTCTAAACAAAGGCAGTGAGG - Intergenic
1031381538 7:121092169-121092191 GGGTTGCAACAATGGCACCAAGG - Intronic
1031973530 7:128079952-128079974 GAATTCAAACATAGGCAGCCTGG - Intronic
1032064714 7:128758526-128758548 GAGTTCAAACTCAGGCAGTATGG + Intronic
1035091536 7:156316915-156316937 GTGATCAAAGAAAGGGAGCAGGG - Intergenic
1037272135 8:17141865-17141887 TGGTTCAAAAAAAGACACCACGG - Intergenic
1038068909 8:23992106-23992128 GGTTTAAAATAAATGCAGCAGGG + Intergenic
1039550304 8:38438652-38438674 GGATTCAAACACAGGTAGCCTGG + Intronic
1040008627 8:42642396-42642418 GGATTCACACAAGGGCAGCAAGG - Intergenic
1042468939 8:69161441-69161463 GGGTTCAAAGACAGGCAGTATGG - Intergenic
1042589152 8:70378962-70378984 GGTTTCAAACCCAGGCAGCCTGG + Intronic
1045301966 8:100919087-100919109 GGATGCAAGCAAAGGAAGCAGGG + Exonic
1045575889 8:103419255-103419277 GGATTCAAACCAAGGCAGTATGG - Intronic
1045631214 8:104125317-104125339 GGGTTTCAACAAAAGCAACATGG - Intronic
1046390965 8:113572265-113572287 GGTTTCATACTAAGGCAGCATGG - Intergenic
1050928724 9:11298266-11298288 GGTTTCAAACAAAGGCAAGTAGG - Intergenic
1053628281 9:39900382-39900404 TGGTTCAAATAAATACAGCATGG - Intergenic
1053777777 9:41565944-41565966 TGGTTCAAATAAATACAGCATGG + Intergenic
1054215606 9:62350319-62350341 TGGTTCAAATAAATACAGCATGG + Intergenic
1054364275 9:64316479-64316501 TGGTTCAAATAAATACAGCATGG - Intergenic
1054671875 9:67805032-67805054 TGGTTCAAATAAATACAGCATGG - Intergenic
1054856281 9:69902902-69902924 GGGTCAAAACCAAGGGAGCAGGG - Intronic
1055573890 9:77643956-77643978 GGGTTCAAACCCAGGCAGACTGG + Intronic
1056425101 9:86467747-86467769 GGGTTAAAAAAAAATCAGCAAGG - Intergenic
1057879220 9:98780499-98780521 GGTGGCAAACAAAGCCAGCAGGG + Intronic
1057968061 9:99523902-99523924 GGGTGCAAATTCAGGCAGCATGG - Intergenic
1060498251 9:124133684-124133706 GGACTCAAACACAGGCAGCCTGG - Intergenic
1060501874 9:124163891-124163913 GGGTTCATTCAAAGGAAGCTGGG + Intergenic
1186580368 X:10811040-10811062 GCATTCAAACAAAGGCAAGATGG + Intronic
1187527421 X:20066714-20066736 GGGTTTAAACAGATGGAGCAGGG - Intronic
1189512221 X:41674216-41674238 GGATGCAAGCAAAGGAAGCAGGG + Intronic
1189698175 X:43687389-43687411 GGGCTTTAACAAAGACAGCAAGG - Intronic
1192176537 X:68889698-68889720 GGGTTCAAACCCAGGCAGGCTGG + Intergenic
1196867721 X:120084948-120084970 GGGTTCCTCCACAGGCAGCAGGG + Intergenic
1196875381 X:120151333-120151355 GGGTTCCTCCACAGGCAGCAGGG - Intergenic
1197145203 X:123164468-123164490 GGTTTCACACCAAGGCTGCAGGG + Intergenic
1198024816 X:132694651-132694673 GGGGTCCAATAAAGGAAGCAGGG + Intronic
1199070497 X:143469827-143469849 GGGCTCAGAAAAAGGCAGGAAGG - Intergenic
1199474039 X:148226662-148226684 TGGTTCAAACCAAGACAGCTTGG - Intergenic
1199943285 X:152645439-152645461 GGGTTCAAACCCAGGCAGCCTGG + Intronic
1200081390 X:153578505-153578527 GGGAGCAAAGAGAGGCAGCAAGG + Intronic
1201278062 Y:12316715-12316737 GGGTTCCTCCACAGGCAGCAGGG - Intergenic