ID: 954324959

View in Genome Browser
Species Human (GRCh38)
Location 3:49858535-49858557
Sequence ACGTGGCAATGAGACCTGGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 96}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954324959_954324971 27 Left 954324959 3:49858535-49858557 CCTGCCAGGTCTCATTGCCACGT 0: 1
1: 0
2: 0
3: 9
4: 96
Right 954324971 3:49858585-49858607 GCTCATGAGGTTCAGGGTACAGG 0: 1
1: 0
2: 1
3: 8
4: 123
954324959_954324969 20 Left 954324959 3:49858535-49858557 CCTGCCAGGTCTCATTGCCACGT 0: 1
1: 0
2: 0
3: 9
4: 96
Right 954324969 3:49858578-49858600 CTTAGAGGCTCATGAGGTTCAGG 0: 1
1: 0
2: 0
3: 4
4: 125
954324959_954324966 14 Left 954324959 3:49858535-49858557 CCTGCCAGGTCTCATTGCCACGT 0: 1
1: 0
2: 0
3: 9
4: 96
Right 954324966 3:49858572-49858594 CTTTCCCTTAGAGGCTCATGAGG 0: 1
1: 0
2: 0
3: 16
4: 134
954324959_954324970 21 Left 954324959 3:49858535-49858557 CCTGCCAGGTCTCATTGCCACGT 0: 1
1: 0
2: 0
3: 9
4: 96
Right 954324970 3:49858579-49858601 TTAGAGGCTCATGAGGTTCAGGG 0: 1
1: 0
2: 0
3: 10
4: 126
954324959_954324963 5 Left 954324959 3:49858535-49858557 CCTGCCAGGTCTCATTGCCACGT 0: 1
1: 0
2: 0
3: 9
4: 96
Right 954324963 3:49858563-49858585 TTGTTCCTCCTTTCCCTTAGAGG 0: 1
1: 0
2: 0
3: 20
4: 254
954324959_954324972 28 Left 954324959 3:49858535-49858557 CCTGCCAGGTCTCATTGCCACGT 0: 1
1: 0
2: 0
3: 9
4: 96
Right 954324972 3:49858586-49858608 CTCATGAGGTTCAGGGTACAGGG 0: 1
1: 0
2: 0
3: 7
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954324959 Original CRISPR ACGTGGCAATGAGACCTGGC AGG (reversed) Exonic
901866300 1:12109292-12109314 GAGTGGCCATGAGACCAGGCTGG - Intronic
903502020 1:23805845-23805867 ACATGGCAAGGAGGCCTGGAGGG - Intronic
906353522 1:45083653-45083675 AAGAGGCAATGAGACCAGGTGGG - Intronic
907073699 1:51560189-51560211 ACGTGGCCATGGGACTTTGCAGG + Intergenic
920362173 1:205426627-205426649 AAGTGGGGATGAGACCAGGCTGG + Intronic
1063355750 10:5396705-5396727 AAAAGGCAATGAGACCTGGCAGG - Intronic
1067295686 10:44974121-44974143 GGGTGGCAGTGAGACCTGGAGGG - Intronic
1071457024 10:85858754-85858776 AGGGGTCAAAGAGACCTGGCTGG - Intronic
1073393758 10:103201055-103201077 ACGTAAGAATGAGAGCTGGCTGG - Intergenic
1075516079 10:123109384-123109406 ACGTGGCAAATAAACATGGCAGG - Intergenic
1077918761 11:6627524-6627546 GCGTGGCACTGAGAGCTGGCTGG + Exonic
1081736622 11:45408891-45408913 CTGTGGGAATGAGACATGGCAGG + Intergenic
1089377312 11:118003620-118003642 AGGAGGCAAAGAGACCTGGCTGG + Intergenic
1090251087 11:125252440-125252462 ACAAGGCAAGGAGACCTTGCAGG + Intronic
1090406766 11:126480675-126480697 AGGGGGCATTCAGACCTGGCAGG + Intronic
1091897576 12:4117545-4117567 AGGTGGCAATAAGACCTCCCTGG - Intergenic
1094793348 12:33940203-33940225 AGGTGACAATGGGCCCTGGCTGG + Intergenic
1103721304 12:122976977-122976999 TCCTGGCCCTGAGACCTGGCAGG + Intronic
1104718525 12:131031848-131031870 ACGAGGCAATGACACCTCTCAGG - Intronic
1104963487 12:132498919-132498941 AGGTGGCCACGGGACCTGGCTGG - Intronic
1106165766 13:27244732-27244754 ATGTGGAAAGGAGACCTGGGAGG + Intergenic
1107571692 13:41666849-41666871 ACGTGGCGAGGAGACATGGATGG + Intronic
1113643589 13:111976231-111976253 CCGTGATAATGAGCCCTGGCTGG + Intergenic
1117004216 14:51402335-51402357 ACGTGGGAATGAGATTTGGGTGG - Intergenic
1118763175 14:68893000-68893022 ACTTGCCAAGGTGACCTGGCTGG + Intronic
1120757433 14:88257345-88257367 ACGTGGAAATGAGACTGGGAAGG - Intronic
1121829733 14:97039748-97039770 ACATGGTAATGTGACCTGGCTGG - Intergenic
1122471270 14:101968353-101968375 AGGTGGCAATGAGCCATGACTGG - Intronic
1124817882 15:33014772-33014794 ACTTTGTAATGACACCTGGCAGG - Intronic
1127898411 15:63322750-63322772 GCGTGGCCATGACACCTGGCAGG + Exonic
1129737444 15:77974094-77974116 CCATGGCAGTGAGGCCTGGCGGG - Intergenic
1137446931 16:48537622-48537644 ACTTGGAGATAAGACCTGGCTGG + Intergenic
1138030085 16:53552935-53552957 ACCTGGCAATGGGACAAGGCAGG + Intergenic
1138387700 16:56647665-56647687 ACGTGGCCAAAGGACCTGGCTGG + Intronic
1139436687 16:66940653-66940675 AGCTGGCAATGAGGCCGGGCAGG - Exonic
1143800776 17:9378585-9378607 ACTTCGCAATGAAACCAGGCGGG - Exonic
1144777088 17:17790240-17790262 AGCTGGCAGTGGGACCTGGCTGG + Intronic
1146285608 17:31572403-31572425 AGGTGGCAATGGGACCGGTCAGG - Intronic
1150270646 17:63862317-63862339 CCCTGGCAAACAGACCTGGCTGG + Intergenic
1151239656 17:72747819-72747841 CCTTGGCAATAATACCTGGCTGG - Intronic
1157318997 18:46620039-46620061 ACCTGGCAGTAACACCTGGCAGG + Intronic
1157692180 18:49692423-49692445 ACGTGGCAGAGATACATGGCAGG + Intergenic
1160077974 18:75695619-75695641 TCATGGCAATGGGACCTTGCAGG + Intergenic
1160622338 18:80180105-80180127 AAGTGGCACAGAGGCCTGGCTGG + Intronic
1160893207 19:1390359-1390381 ACGCGGCTCTGAGACCTGGCAGG - Intronic
1162039700 19:7962973-7962995 AGGTGGCAACGGGACCTGCCTGG + Exonic
1166661455 19:44649913-44649935 ACCTGGCACTCAGACCTGGGCGG + Exonic
1167618593 19:50549340-50549362 AGGTGGCAAGGGGACCGGGCGGG - Intronic
925156584 2:1652765-1652787 ACGTGGAATTGAGACCTGTAGGG - Intronic
925173357 2:1766361-1766383 ACCTGGGAGTGAGACCTCGCTGG + Intergenic
929670928 2:43876025-43876047 AGGAGGCAATGAGCCCTGCCTGG - Intronic
932873713 2:75429250-75429272 ACGTGGCAGTGAGCCCAGCCAGG + Intergenic
936947577 2:117944587-117944609 ACCCAGCAATGAGACATGGCTGG + Intronic
938030336 2:127986820-127986842 CCGTGGCGATGAGCCCTGGGCGG + Exonic
938708852 2:133957978-133958000 ACGTGGCTATGAGCCATGGCGGG + Intergenic
940692654 2:156938717-156938739 ACCTGTCAATCAGACCTGCCTGG - Intergenic
942459535 2:176159757-176159779 ACTGCGCAATGAGTCCTGGCTGG - Intronic
947582953 2:231333041-231333063 GGGTGGCAACGGGACCTGGCAGG - Intronic
948917658 2:241044570-241044592 AGGTGGCTTTGAGTCCTGGCTGG - Intronic
1173599151 20:44280405-44280427 ACTTGGCAATGAGAACTAGATGG - Intronic
1174982167 20:55408435-55408457 ATGGAGCAATGAGTCCTGGCAGG - Intergenic
1175238107 20:57526669-57526691 AGGGGGCACTGAGACCTGGTGGG + Intergenic
1175980158 20:62734663-62734685 ACTGGGCATTGAGACATGGCTGG + Intronic
1179114676 21:38479351-38479373 AGGTGGGAAGGAGACCAGGCAGG - Intronic
1180691777 22:17722536-17722558 AATAGGCAATTAGACCTGGCTGG - Intronic
1182416802 22:30226552-30226574 GCGTGGCTCTGAGGCCTGGCGGG + Intergenic
1184684709 22:46090909-46090931 ACGTGGCACTGAGCACAGGCAGG - Intronic
949519050 3:4832995-4833017 ACTATGCATTGAGACCTGGCCGG + Intronic
950767802 3:15286331-15286353 AGGTGGAAATGAGATCTGCCAGG - Intronic
954324959 3:49858535-49858557 ACGTGGCAATGAGACCTGGCAGG - Exonic
955033856 3:55247530-55247552 ACGTAGCAATGAGACGAGCCTGG + Intergenic
958075325 3:88668923-88668945 GTGTGACACTGAGACCTGGCTGG + Intergenic
961422365 3:126816469-126816491 TCCTGGCAATGACAGCTGGCTGG - Intronic
961499556 3:127322532-127322554 ATGTGGCTATGAGGACTGGCTGG + Intergenic
962431562 3:135325265-135325287 ACCTGGCCATGATACCTGGGAGG + Intergenic
969433008 4:7166997-7167019 CAGTGGGAATGAGACCTGCCAGG + Intergenic
969681714 4:8646829-8646851 ACGTGGAAATGGGCCGTGGCTGG + Intergenic
969890921 4:10259295-10259317 ACATGACAATCAGACCTCGCTGG + Intergenic
981791558 4:148542778-148542800 ACGTGGCTTTGAGACTGGGCAGG + Intergenic
982618557 4:157674924-157674946 AAGTGGCAATGAAAACTAGCTGG - Intergenic
984173560 4:176389338-176389360 ATGTGGCACCGAGACCTGCCTGG + Intergenic
988537749 5:32084138-32084160 ACGTGGCTTTGAGTCTTGGCAGG + Intronic
993379783 5:87193293-87193315 AAGTGGCGAGGAGACCAGGCAGG - Intergenic
996501719 5:124224420-124224442 ATGTGGCACTGAGAACTGCCAGG + Intergenic
996642315 5:125770798-125770820 CAGTGGCAATGAGAACTGGTGGG + Intergenic
997259293 5:132453832-132453854 ACTTGGCAAAGAGAGCTGGAAGG + Intronic
998881228 5:146647338-146647360 TTGTGGAAATGAGACCTGCCTGG + Intronic
999492906 5:152069196-152069218 AGGTGGCGATCAGACTTGGCCGG - Intergenic
1006990124 6:38208211-38208233 GCGTGGCACTGAGACGTGACGGG + Intronic
1021936735 7:25638758-25638780 AAGTGGAAATGTGACCAGGCAGG - Intergenic
1024203502 7:47130971-47130993 AGGTGGCACAGAGACCTTGCTGG - Intergenic
1024469969 7:49758011-49758033 AAGTGGCAATCAGAGCTGGTTGG - Intergenic
1024879102 7:54065764-54065786 ACATGGCAATGAAAGCTGGCAGG + Intergenic
1027564242 7:79769899-79769921 AAGTGGCAAAGAGATCTGTCTGG - Intergenic
1029122261 7:98276712-98276734 ACTCAGCAAGGAGACCTGGCTGG - Intronic
1029387798 7:100255213-100255235 ACGGGACACTGAGACCTGGGGGG + Intronic
1029647677 7:101868624-101868646 ACTTGGCAATGAGACCTTCATGG + Intronic
1030870886 7:114755008-114755030 ATGAGTCTATGAGACCTGGCTGG - Intergenic
1042848046 8:73187821-73187843 ACGTGGCATTGTGACATGGCGGG - Intergenic
1048612495 8:136038966-136038988 AAGTGGCACAGAGACCTAGCAGG - Intergenic
1049795463 8:144495353-144495375 AGATGGCCATGAGGCCTGGCTGG + Intronic
1053471326 9:38347673-38347695 ACCTGCCAAGGACACCTGGCTGG - Intergenic
1058336983 9:103842164-103842186 ATGTGGCAATGAGATGTGCCAGG + Intergenic
1059439529 9:114299165-114299187 AGGATGCAATGAGACCAGGCAGG - Intronic
1060396270 9:123319049-123319071 AGGAGGGAATGAGACCAGGCTGG + Intergenic
1188388424 X:29590486-29590508 ACGTGGAAGGGAGATCTGGCAGG + Intronic