ID: 954325296

View in Genome Browser
Species Human (GRCh38)
Location 3:49860170-49860192
Sequence CTTTGCCAGGGCCAAGTGGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 860
Summary {0: 1, 1: 0, 2: 3, 3: 36, 4: 820}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954325296_954325301 -7 Left 954325296 3:49860170-49860192 CCTTCCACTTGGCCCTGGCAAAG 0: 1
1: 0
2: 3
3: 36
4: 820
Right 954325301 3:49860186-49860208 GGCAAAGTTCTTTTCAATCTGGG 0: 1
1: 0
2: 0
3: 9
4: 177
954325296_954325300 -8 Left 954325296 3:49860170-49860192 CCTTCCACTTGGCCCTGGCAAAG 0: 1
1: 0
2: 3
3: 36
4: 820
Right 954325300 3:49860185-49860207 TGGCAAAGTTCTTTTCAATCTGG 0: 1
1: 0
2: 1
3: 10
4: 222

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954325296 Original CRISPR CTTTGCCAGGGCCAAGTGGA AGG (reversed) Exonic
900425445 1:2576311-2576333 CTCTGCCCTGGCCAAGGGGAAGG - Intergenic
900469482 1:2846429-2846451 CTTTGGGAGGCCCAAGTGGGTGG + Intergenic
900852312 1:5153739-5153761 CTTTGCTAGGGCAGTGTGGAAGG + Intergenic
900968038 1:5973126-5973148 CTTTGGGAGGCCCAGGTGGATGG - Intronic
901220618 1:7581580-7581602 CTTGTCCACGGCCCAGTGGAGGG - Intronic
901306162 1:8234622-8234644 CTTTGGGAGGCCGAAGTGGAAGG - Intergenic
901656857 1:10774361-10774383 CTTGGCCAGGGCCAAGTTCAGGG + Intronic
901893587 1:12289324-12289346 CTTTGGGAGGCCAAAGTGGATGG - Intronic
902257065 1:15196595-15196617 CTTTGCGAGGCTCAAGTGGGAGG - Intronic
902264111 1:15248829-15248851 CTTTGGGAGGCCCAGGTGGACGG - Intronic
902271265 1:15306843-15306865 CTTTGCTAGGGCAGTGTGGAAGG + Intronic
902461473 1:16580579-16580601 CTTTGGAAGGCCCAAGTGGGAGG - Intronic
902462258 1:16586878-16586900 CTTTGGAAGGCCCAAGTGGGAGG - Intronic
902945658 1:19835823-19835845 CTTTGAGAGGGCAAAGTGGGAGG + Intergenic
903204865 1:21773892-21773914 CTTTGGGAGGGCAAGGTGGAAGG + Intronic
903214756 1:21837652-21837674 CTTTGCCATGGCCAAGTCCCTGG - Intronic
903453190 1:23469059-23469081 CTTTGGGAGGCCCAAGTGGGTGG + Intronic
903834214 1:26192344-26192366 CTTTGGCAGGCCAAAGTGGGTGG + Intronic
903881072 1:26509784-26509806 CTTTGGGAGGCCCAAGTGGGCGG - Intergenic
904442441 1:30540535-30540557 CTGTGGCAGGGCCAAAGGGAAGG + Intergenic
904508798 1:30983844-30983866 CTTTGGGAGGCCAAAGTGGAAGG - Intronic
904543901 1:31253445-31253467 CTTTGCAAGGCCAAAGTGGGAGG - Intergenic
904588068 1:31590999-31591021 CTTTCCCAGGGCCAAGGGTGTGG + Intergenic
904638438 1:31902867-31902889 CTTTGGGAGGCCGAAGTGGAGGG + Intergenic
904653528 1:32025022-32025044 CTTTGGGAGGCCGAAGTGGAAGG + Intronic
904851534 1:33463220-33463242 ATTTTCCAGGGCCAAGCAGAAGG - Intergenic
905451678 1:38061057-38061079 TTTTGCCAAGGCCAATTGGGAGG + Intergenic
905810985 1:40913079-40913101 CTTTGCCAGGACAAGGTGGGCGG - Intergenic
906226545 1:44127150-44127172 CTTTGGGAGGCCCAGGTGGAAGG - Intronic
906256912 1:44357401-44357423 CTTTGGCAGGCCAAGGTGGAAGG + Intergenic
906360190 1:45149923-45149945 CTTTGGGAGGCCAAAGTGGAAGG + Intronic
906985055 1:50674192-50674214 CTTTGGGAGGCCCAAGTGGGTGG - Intronic
907227362 1:52960412-52960434 CTTTGGCAGGCCCAGGTGGAAGG - Intronic
907326910 1:53644208-53644230 CTGGGGCAGAGCCAAGTGGAGGG - Intronic
907355109 1:53866041-53866063 CTTTGGGAGGCCCAAGTGGGCGG - Intronic
907585486 1:55613267-55613289 CTTTGCCAGAGCACAGTGGGTGG - Intergenic
908196952 1:61754603-61754625 CTTTGAAAGGCCCAAGTGGGAGG - Intronic
909083724 1:71147038-71147060 CTCTGCTAGGGCAATGTGGAAGG + Intergenic
909710831 1:78647402-78647424 CTCTGCTAGGGCAATGTGGAAGG - Intergenic
909755545 1:79220993-79221015 CTCTGCTAGGGCAATGTGGAAGG + Intergenic
910367063 1:86477197-86477219 CTTTGGCAGGTCGAAGTGGGAGG - Intronic
911006724 1:93233838-93233860 CTTTGGGAGGCCCAAGTGGGTGG - Intronic
911111525 1:94192693-94192715 CTTCTCCAGGGCCAAGTGTGGGG - Intronic
911112615 1:94207250-94207272 CTTTGGGAGGGCGAAGTGGGCGG - Intronic
911213849 1:95170570-95170592 CTTTGGGAGGCCAAAGTGGACGG - Intronic
911376401 1:97056869-97056891 CTTTGCTAGGGCAGGGTGGAAGG + Intergenic
911972163 1:104452495-104452517 CTCTGCTAGGGCAATGTGGAAGG + Intergenic
912333829 1:108844470-108844492 CTTTGCCAAGGCCCAGTGGAAGG + Intronic
912352128 1:109024206-109024228 CTTTGGGAGGCCAAAGTGGAGGG + Intronic
912368679 1:109155897-109155919 CTTTGTGAGGCCAAAGTGGAAGG + Intronic
912486145 1:110030174-110030196 CTTTGGTAGGCCAAAGTGGAGGG - Intergenic
912536223 1:110374282-110374304 CTTTGGGAGGTCCAAGTGGGTGG - Intronic
912907364 1:113720788-113720810 CTTTGCTAGGGCAGTGTGGAAGG - Intronic
913146131 1:115992083-115992105 CTCTGCCAGGTCCCAGTGGTAGG - Exonic
913207527 1:116554440-116554462 CTTTGGTAGGCCAAAGTGGAAGG + Intronic
913553877 1:119944290-119944312 CTTTGGGAGGTCCAGGTGGACGG + Intronic
914364389 1:146965254-146965276 CTTTGGAAGGCCCAAGTGGGAGG + Intronic
914365156 1:146971544-146971566 CTTTGGAAGGCCCAAGTGGGAGG + Intronic
914487292 1:148121883-148121905 CTTTGGAAGGCCCAAGTGGGAGG - Intronic
915391520 1:155548276-155548298 CTTTGGCAGGCCAAAGTGGGTGG + Intronic
915668538 1:157466975-157466997 CTTTGGGAGGCCGAAGTGGACGG + Intergenic
916027399 1:160845610-160845632 CTTTGGGAGGCCCAGGTGGATGG + Intronic
916218605 1:162420665-162420687 CTTTGAGAGGCCAAAGTGGAAGG + Intergenic
916258484 1:162815467-162815489 CTTTGGGAGGCCAAAGTGGAAGG + Intergenic
917865989 1:179196044-179196066 CTTTGGCAGGCCGAGGTGGACGG + Intronic
917875504 1:179283177-179283199 CTTTGGGAGGCCGAAGTGGACGG - Intergenic
917897492 1:179505848-179505870 CTATGCCAGGATCAGGTGGATGG - Intronic
917920928 1:179749198-179749220 TTGTGCCTGGACCAAGTGGAGGG + Intronic
919388705 1:196954551-196954573 CTCTGCTAGGGCAGAGTGGAAGG - Intronic
919999493 1:202786251-202786273 CTTTGGGAGGCCAAAGTGGAAGG - Intronic
920499156 1:206475489-206475511 CTTTGGGAGGCCCAAGTGGGCGG + Intronic
920505035 1:206509322-206509344 CTAAGCCTGGGTCAAGTGGAAGG + Intronic
920521870 1:206633809-206633831 ATCTTCCAGAGCCAAGTGGAAGG - Intergenic
920848282 1:209611531-209611553 CTTTGCTAAGAGCAAGTGGAGGG + Exonic
920905118 1:210156935-210156957 CTTTGGGAGGCCGAAGTGGATGG - Intronic
921644994 1:217604105-217604127 CTTTGGGAGGGCGAGGTGGAAGG + Intronic
921756140 1:218857900-218857922 CTTTGGGAGGCCCAAGTGGGTGG + Intergenic
921880522 1:220249978-220250000 CTTTGCTAGGGCAGTGTGGAAGG + Intronic
922284113 1:224153675-224153697 CTTTGGGAGGGCAAAGTGGGTGG + Intronic
922756493 1:228099871-228099893 CTTGGCCAGGGCCCTGAGGAAGG + Intergenic
923086174 1:230705075-230705097 GGTTGCCGGGGCCAAGGGGAAGG + Intronic
923099795 1:230803239-230803261 CTTTCCCAGGGACATATGGATGG - Intergenic
923600789 1:235400945-235400967 CTTTGCAAGGCCAAAGTGGGCGG - Intronic
923982701 1:239343281-239343303 CTTTGGGAGGCCGAAGTGGATGG - Intergenic
1063250528 10:4268850-4268872 CTTTGCCATGGACACGGGGATGG + Intergenic
1063310236 10:4945401-4945423 CTCTGCTAGGGCAATGTGGAAGG + Intronic
1063785340 10:9377429-9377451 CTTAGAAAGGGCCAAGTGGAAGG - Intergenic
1064048121 10:12037323-12037345 CTTTGGGAGGCCCAGGTGGATGG - Intronic
1064056091 10:12098806-12098828 CTTTGGGAGGCCAAAGTGGATGG - Intronic
1064061093 10:12137761-12137783 CTTTGGCAGGCCAAAGTGGGAGG + Intronic
1064744136 10:18462496-18462518 CTTTGGGAGGTCCAGGTGGAAGG - Intronic
1064776355 10:18782057-18782079 TTGTGTCAGGGACAAGTGGATGG + Intergenic
1065008466 10:21401254-21401276 CTTTGGGAGGCCAAAGTGGAAGG - Intergenic
1065178335 10:23100140-23100162 CTTTGCCAAAGCTAAGAGGAGGG + Intronic
1065299384 10:24307530-24307552 CTTTGGGAGGTCAAAGTGGAAGG + Intronic
1065830048 10:29606996-29607018 CTTTGGGAGGTCGAAGTGGATGG - Intronic
1065952248 10:30662847-30662869 TTTTTGCAGGGCCAGGTGGAGGG + Intergenic
1066370885 10:34816851-34816873 CTTTCCCATGGCTGAGTGGAAGG - Intergenic
1066451880 10:35537311-35537333 CTTTGCCAGGACTGTGTGGAAGG + Intronic
1066628701 10:37436980-37437002 CTTTGGCAGGCCGAGGTGGAGGG - Intergenic
1066724928 10:38381155-38381177 CTTTGGGAGGCCAAAGTGGAAGG + Intergenic
1067447724 10:46362603-46362625 GTTTGCCAGGGACATGGGGAAGG + Intergenic
1067812282 10:49439169-49439191 CTTTGCTAGGGCAGTGTGGAAGG - Intergenic
1068017851 10:51540958-51540980 CTTTGGGAGGCCCAGGTGGATGG - Intronic
1068353273 10:55878193-55878215 CTTTGGCAGGCCAAGGTGGAGGG + Intergenic
1068512810 10:57987454-57987476 CTTTGCCAGAGCCAAGAGATGGG - Intergenic
1068708859 10:60109298-60109320 CTTTACCAGGCTCAAATGGAAGG + Intronic
1068781297 10:60921698-60921720 CTCTGCCAGCCCCAGGTGGAAGG - Intronic
1068901665 10:62276667-62276689 CTCTGCCAATGGCAAGTGGAAGG - Intergenic
1069455481 10:68550647-68550669 CTTTGGGAGGTCAAAGTGGATGG - Intergenic
1069979200 10:72240525-72240547 CTTTGGGAGGCCCAAGTGGGAGG + Intergenic
1070021724 10:72593027-72593049 CTTTGGGAGGGCGAAGTGGGTGG - Intronic
1070064557 10:73020889-73020911 CTTTGGGAGGCCAAAGTGGATGG + Intronic
1070113930 10:73510690-73510712 CTTTGGGAGGCCAAAGTGGATGG - Intronic
1071002898 10:80851192-80851214 CTTTGGGAGGCCCAGGTGGATGG - Intergenic
1072080002 10:92019963-92019985 CTTTGGCAGGCCCAGGTGGGAGG - Intronic
1072338889 10:94426817-94426839 CTTTGCAAGGCCGAAGTGGGTGG - Intronic
1072367428 10:94727369-94727391 CTTTGGGAGGCCAAAGTGGAAGG + Intronic
1072979751 10:100090076-100090098 CTTTGGGAGGGCAAAGTGGGTGG - Intergenic
1073014685 10:100388498-100388520 CTTTGGGAGGCCAAAGTGGATGG + Intergenic
1073172527 10:101522960-101522982 CTTTGGGAGGCCGAAGTGGATGG + Intronic
1073310831 10:102540405-102540427 CTTTGGGAGGCCCAAGTGGGTGG + Intronic
1073408793 10:103322447-103322469 CTTTGGGAGGCCAAAGTGGATGG - Intronic
1073537671 10:104292399-104292421 CTTTGGAAGGTCAAAGTGGAAGG - Intronic
1073619910 10:105036085-105036107 CTGATCCAGGGCCAAGTGAATGG + Intronic
1073853109 10:107644116-107644138 ATTTGCCAGGAGCAAGAGGATGG - Intergenic
1074262757 10:111870519-111870541 CTCTGCTAGGGCAGAGTGGAAGG + Intergenic
1074286239 10:112100661-112100683 CTCTGCTAGGGCAATGTGGAAGG - Intergenic
1074325887 10:112450133-112450155 CTTTGGGAGGCCCAAGTGGGTGG - Intronic
1074411299 10:113230753-113230775 CTTTGGGAGGCCCAAGTGGGTGG + Intergenic
1074871483 10:117579416-117579438 CCATGCCTGGGCCAAGTGAAGGG + Intergenic
1075151571 10:119937380-119937402 CTTTGGCAGGCCGAGGTGGACGG + Intronic
1075169582 10:120101207-120101229 CTTTGGGAGGCCAAAGTGGAAGG - Intergenic
1075317666 10:121465731-121465753 ATTTGTCAGGGCCATCTGGAGGG + Intergenic
1076166675 10:128287692-128287714 CTTGGCCCAGGCCAAGTTGAGGG - Intergenic
1076254791 10:129013599-129013621 CATGGCCCAGGCCAAGTGGAAGG - Intergenic
1076407517 10:130222555-130222577 CTCTGCCAGGGGCAAGGGTAGGG + Intergenic
1077507175 11:2935230-2935252 CTTTGGGAGGACCAAGTGGGAGG + Intergenic
1077517985 11:3013605-3013627 CTTTGGGAGGGCGAAGTGGGTGG + Intronic
1077679549 11:4225873-4225895 CTTTGGGAGGCCCAAGTGGGAGG + Intergenic
1077681938 11:4250034-4250056 CTTTGGGAGGCCCAAGTGGGAGG - Intergenic
1077688964 11:4322453-4322475 CTTTGGGAGGCCCAAGTGGGAGG + Intergenic
1077787052 11:5395752-5395774 CTTTGCCAAAGCCATATGGAAGG + Intronic
1078553262 11:12294700-12294722 CTTTGGCAGCCCCAAGAGGAAGG + Exonic
1078844230 11:15107153-15107175 CTTTGGGAGGCCCAAGTGGGAGG + Intergenic
1079030162 11:16980677-16980699 CTTTGGGAGGCCAAAGTGGATGG + Intronic
1079370294 11:19846769-19846791 TTTTACCAGGGCCAAGAGGAGGG - Intronic
1079400935 11:20105776-20105798 CCTGGCCAGGGCCCAGAGGATGG - Intronic
1081874833 11:46401480-46401502 CTTTGGGAGGTCCAAGTGGGTGG - Intronic
1082268314 11:50143072-50143094 CTCTGCTAGGGCAATGTGGAAGG + Intergenic
1082287759 11:50335443-50335465 CTCTGCTAGGGCAATGTGGAAGG - Intergenic
1082827632 11:57592241-57592263 CTTTGGGAGACCCAAGTGGATGG - Intergenic
1083085068 11:60134372-60134394 CTCTGCTAGGGCAATGTGGAAGG + Intergenic
1083369379 11:62166246-62166268 CTGTGTCAGGGCCAAGGAGATGG + Intergenic
1083825101 11:65197641-65197663 CTTTGGGAGGCCCAGGTGGACGG + Intronic
1083914545 11:65732227-65732249 CTTTGCGAGGGCCAGGTGGGCGG + Intergenic
1084200209 11:67552004-67552026 CTCTGCTAGGGCAATGTGGAAGG + Intergenic
1084393914 11:68896589-68896611 CTTTGCCAGCCGCCAGTGGAAGG - Exonic
1085233836 11:74995908-74995930 CTTTGCGAGGCCAAAGTGGGAGG + Intronic
1085600674 11:77853695-77853717 CTTTGGGAGGCCAAAGTGGATGG + Intronic
1085608336 11:77923074-77923096 CTTTGCGAGGCCGAAGTGGCTGG + Intronic
1085659639 11:78351967-78351989 CTTTGGGAGGCCGAAGTGGAAGG + Intronic
1086216956 11:84394861-84394883 CTTTGGGAGGCCAAAGTGGATGG - Intronic
1086726548 11:90192434-90192456 GATTGCCTGGGCCAAGTGGCAGG + Exonic
1087807271 11:102568764-102568786 CTTTGTCAGGGCAATGTGGGAGG - Intergenic
1088292028 11:108249284-108249306 ATTTGCTTGGGCCAAGTGCAGGG + Intronic
1088820785 11:113455103-113455125 CTTTGGGAGGCCGAAGTGGATGG + Intronic
1089317782 11:117603998-117604020 CTTGGCCAGGGCCCTGTGGCTGG + Intronic
1089685246 11:120142406-120142428 CTTGCCCAGGGGCAAGGGGATGG - Intronic
1090445473 11:126761264-126761286 CTTTGCCTGGGCAGAGTGCAGGG - Intronic
1090452358 11:126817904-126817926 CTCAGCCAGAGCCAAGAGGACGG - Intronic
1090910965 11:131118934-131118956 CTTTGAGAGGGCAAGGTGGAAGG - Intergenic
1091490592 12:929107-929129 CTTTGGGAGGCCCAGGTGGAAGG - Intronic
1091545968 12:1501516-1501538 CTTTGGGAGGCCGAAGTGGATGG - Intergenic
1091833647 12:3568827-3568849 CTTTGCCAGGGACAAGTGGCTGG + Exonic
1091956089 12:4644666-4644688 CTTTGGGAGGCCGAAGTGGAGGG + Intronic
1092478593 12:8839988-8840010 CTTTGGGAGGCCCAGGTGGACGG - Intronic
1093459536 12:19395773-19395795 CTTTGGGAGGCCGAAGTGGATGG + Intergenic
1093537307 12:20237568-20237590 CTCTGCTAGGGCAATGTGGAAGG + Intergenic
1093842267 12:23918680-23918702 CTTTGGGAGGCCCAGGTGGAGGG + Intronic
1095460407 12:42437844-42437866 AGTTGCCAGGGGAAAGTGGAAGG - Intronic
1095729902 12:45494991-45495013 CTTTGGGAGGCCAAAGTGGAAGG + Intergenic
1095836782 12:46648063-46648085 CTTTGCTAGGGCACTGTGGAAGG - Intergenic
1096068481 12:48760038-48760060 CTTTGGGAGGCCCAAGTGGGTGG - Intergenic
1096314674 12:50553895-50553917 CTTTGGGAGGTCAAAGTGGAAGG - Intronic
1096949767 12:55455714-55455736 CTTTGGGAGAGCGAAGTGGAAGG + Intergenic
1097144328 12:56929661-56929683 CAATGCCAGGGCCAAGTACAGGG - Intronic
1097360465 12:58653991-58654013 CTTTGCTAGAGCAAACTGGAAGG - Intronic
1097771337 12:63589883-63589905 CTTTGGCAGGCCCAGGTGGCTGG + Intronic
1098236607 12:68424053-68424075 CTTTGGGAGGCCCAAGTGGGTGG - Intergenic
1098525839 12:71486005-71486027 CTTTGGGAGGCCAAAGTGGACGG - Intronic
1098903287 12:76134792-76134814 CTTTGGGAGGCCAAAGTGGAAGG - Intergenic
1098918364 12:76280040-76280062 CTGGGCTAGGGCCAGGTGGAAGG + Intergenic
1098918389 12:76280215-76280237 CTGGGCTAGGGCCAGGTGGAAGG + Intergenic
1099396528 12:82147220-82147242 CTCTGCTAGGGCAATGTGGAAGG + Intergenic
1100482374 12:94991482-94991504 CTTTGCGAGGCCAAAGTGGGTGG + Intronic
1101082848 12:101207086-101207108 CTTTGCCATGACCAATTGGGAGG + Intronic
1102339553 12:112110940-112110962 CTTTGGCAGGCCAAAGTGGGTGG + Intergenic
1102714957 12:114962340-114962362 GTTTGATAGGGCCAAGAGGATGG + Intergenic
1102735111 12:115152195-115152217 TTTTGCCAGGGCCAAGACAAGGG - Intergenic
1103288760 12:119826318-119826340 CTTTGCCAAGGTCAAGTGCTTGG - Intronic
1103372098 12:120427323-120427345 CTTTGACAGGCCAAAGTGGGAGG - Intergenic
1103421640 12:120789579-120789601 CTTTGGAAGGCCGAAGTGGATGG + Intronic
1103535813 12:121633208-121633230 CTTAGCAAGGGCCAAGAAGAGGG - Intronic
1103802007 12:123544283-123544305 CTTTGGGAGGCCAAAGTGGAAGG - Intergenic
1103850064 12:123927298-123927320 CTTTGGGAGGCCGAAGTGGAAGG - Exonic
1104119409 12:125784685-125784707 CTTTGGGAGGGCCAGGTGGGCGG - Intergenic
1104829980 12:131743759-131743781 CTTTGCTAGGGCAGTGTGGAGGG - Intronic
1104863277 12:131936643-131936665 CTTTGGGAGGCCAAAGTGGACGG + Intronic
1104865575 12:131951293-131951315 CTTTGCGAGGGCGAGGTGGGCGG - Intronic
1106443226 13:29799208-29799230 CTTTGCCGGGGGCAGGGGGAAGG - Intronic
1106605045 13:31221272-31221294 CTTGGCCTGGGGCAAGTGGTGGG + Intronic
1106731976 13:32551139-32551161 CTTTGGGAGGGCAAAGTGGGGGG + Intergenic
1106981293 13:35285184-35285206 CTTTGGGAGGTCCAGGTGGATGG + Intronic
1107814531 13:44232474-44232496 CACTGCCAAGGCCAAGGGGAGGG + Intergenic
1108200292 13:48036901-48036923 CTCTGGTAGGCCCAAGTGGAAGG + Intergenic
1108513415 13:51175026-51175048 CTCTACTAGGGCAAAGTGGAGGG + Intergenic
1109019076 13:57061850-57061872 CTTTGGGAGGGCCAGGTGGGTGG - Intergenic
1109826068 13:67723696-67723718 CTTTGGGAGGCCCAAGTGGGTGG - Intergenic
1110774249 13:79388337-79388359 CTTTGGGAGGCCCAAGTGGGTGG - Intronic
1111715766 13:91877166-91877188 CTCTGCCAGGGCAGTGTGGAAGG + Intronic
1112048716 13:95623695-95623717 CTTTGGGAGGCCCAAGTGGGAGG + Intronic
1112206184 13:97325485-97325507 CTTTGGGAGGGCAAAGTGGGAGG + Intronic
1112810203 13:103209510-103209532 CTTTGGCAGGCCAAGGTGGACGG - Intergenic
1112971721 13:105270324-105270346 CTTTGCCAGGGCAGTGTGGAAGG + Intergenic
1113896051 13:113765111-113765133 CTTTGCAAGGGTCAAGAGGCAGG + Intronic
1115031296 14:28797656-28797678 CTTTGGGAGGCCGAAGTGGACGG + Intronic
1115085772 14:29513171-29513193 CTCTGCCAGGGCAAGGTGGAAGG - Intergenic
1115696737 14:35907491-35907513 CTTTGGGAGGCCAAAGTGGACGG - Intronic
1116829223 14:49701414-49701436 CTTTGGGAGGCCAAAGTGGATGG + Intronic
1116893834 14:50295980-50296002 CTTTGGGAGGCCGAAGTGGATGG - Intronic
1117203708 14:53418662-53418684 CTCTGCTAGGGCAATGTGGAAGG + Intergenic
1117412619 14:55464458-55464480 CTTTGGGAGGCCCAGGTGGACGG - Intergenic
1117685670 14:58250296-58250318 CTTTGGAAGGCCCAAGTGAAAGG - Intronic
1118666797 14:68078744-68078766 CTTTGGGAGGCCAAAGTGGAAGG + Intronic
1118769662 14:68933736-68933758 CTTTGGGAGGCCAAAGTGGAAGG + Intronic
1118789675 14:69078728-69078750 GGTTGCCAGGGCCTAGTGGCAGG + Intronic
1118811539 14:69278250-69278272 CTTTGGGAGGCCAAAGTGGAAGG - Intronic
1119088228 14:71756093-71756115 CTTTGGGAGGCCCAAGTGGGTGG + Intergenic
1119567696 14:75642348-75642370 CTTAGGCAGGGCCATGGGGACGG + Intronic
1120132526 14:80823912-80823934 CTCTGCTAGGGCAATGTGGAAGG - Intronic
1120141654 14:80936271-80936293 CTTTGACAGGCCAAAGTGGGAGG + Intronic
1120802995 14:88713697-88713719 CTTTGGGAGGCCAAAGTGGAAGG - Intronic
1121132747 14:91463680-91463702 CTTTGGCAGGCCAAAGTGGGAGG - Intronic
1121532801 14:94670391-94670413 CTTTGGGAGGCCCAGGTGGATGG + Intergenic
1121546007 14:94764151-94764173 CTTTGGGAGGCCGAAGTGGATGG + Intergenic
1121811181 14:96891986-96892008 CTTTGGGAGGTCAAAGTGGATGG - Intronic
1121922601 14:97896832-97896854 GTTGACCAAGGCCAAGTGGAGGG + Intergenic
1122442564 14:101742289-101742311 CTTTGGGAGGGCAAGGTGGATGG - Intergenic
1122521753 14:102349007-102349029 CTTTGGGAGGCCCAAGTGGGTGG + Intronic
1122572129 14:102712115-102712137 CTTTGCAAGGCCATAGTGGAAGG - Intronic
1122816980 14:104318787-104318809 CTTGGACAGGGCCGAGAGGAGGG - Intergenic
1122937432 14:104966643-104966665 CCCTGGCAGGGCCACGTGGAGGG - Intronic
1123133751 14:106009012-106009034 CTTTGGGAGGGCAAAGTGGGTGG + Intergenic
1202840572 14_GL000009v2_random:117280-117302 CTTTGGGAGGCCGAAGTGGAAGG - Intergenic
1123539052 15:21269235-21269257 CTTTGTAAGGCCCAGGTGGATGG + Intergenic
1123708440 15:22967625-22967647 CTATCCCAGGCCCAGGTGGAGGG - Intronic
1123711982 15:22994998-22995020 CTTTGGGAGGCCCAGGTGGACGG + Intronic
1124016504 15:25880843-25880865 CTTTGGGAGGCCAAAGTGGATGG + Intergenic
1124635604 15:31362930-31362952 ATTTGACAGGCCCCAGTGGAAGG + Intronic
1124870824 15:33540450-33540472 CTTTGCCTAGGCCAAGTGTTGGG + Intronic
1126440603 15:48683902-48683924 CTCTGCCTGGGGAAAGTGGAGGG + Intergenic
1126622368 15:50652916-50652938 CTTTGAGAGGCCAAAGTGGAAGG + Intronic
1127241047 15:57114539-57114561 CTTTCAGAGGCCCAAGTGGAAGG - Intronic
1127590399 15:60416461-60416483 CTTTGCTAGGGCCAAGGGCCTGG - Intergenic
1127778464 15:62289283-62289305 TTTTGCAAGGACCAGGTGGATGG + Intergenic
1127860357 15:62988917-62988939 CTTTGGGAGGGCCAGGTGGGAGG - Intergenic
1128072704 15:64807522-64807544 CTGTGCCAGGTCCCAGTAGAGGG + Intergenic
1128356995 15:66935115-66935137 CTTTGCCAGTGACAAGTTAAGGG + Intergenic
1129042921 15:72705826-72705848 CTTTGGGAGGCCCAGGTGGACGG - Intronic
1129953088 15:79609155-79609177 CTTTGGCAGGACCATGTGGCTGG + Intergenic
1130068989 15:80630583-80630605 CTTTGGCAGGCCAAGGTGGAAGG - Intergenic
1130114486 15:80994809-80994831 CTCTGGCAGGGCGAGGTGGATGG - Intergenic
1130130400 15:81136346-81136368 CTTTGCCTTGGCAAAGGGGAAGG + Intronic
1130571512 15:85049356-85049378 GTTTGCTAGGGACAAGGGGAAGG - Intronic
1131027715 15:89158905-89158927 CTTTGGGAGGGCGAAGTGGGTGG - Intronic
1132100238 15:99017880-99017902 CTTTGAGAGGCCAAAGTGGATGG + Intergenic
1132107032 15:99070559-99070581 CTTTGCGAGGCCAAGGTGGATGG + Intergenic
1132108139 15:99079926-99079948 CTTTGCCAGGCCAAGGTGGGAGG - Intergenic
1132169969 15:99640790-99640812 CTTTGGGAGGGCCAGGTGGGAGG - Intronic
1132244915 15:100286944-100286966 CTTTGCAAGGCCGAAGTGGGCGG + Intronic
1132427885 15:101735115-101735137 CTTTGCGAGGCCAAGGTGGAAGG - Intergenic
1133610769 16:7431482-7431504 CTTTGGGAGGCCAAAGTGGAAGG - Intronic
1134110595 16:11513158-11513180 CTTTGGGAGGGCGAGGTGGAAGG + Intronic
1134171103 16:11970454-11970476 CTTTGGCAGGCCAAAGTGGGTGG - Intronic
1135034443 16:19065188-19065210 CTTTGGGAGGCCGAAGTGGAAGG - Intergenic
1135106976 16:19658284-19658306 CTTTGGGAGGCCGAAGTGGATGG + Intronic
1135265903 16:21025181-21025203 CTTTGGGAGGCCCAGGTGGATGG - Intronic
1135296039 16:21280134-21280156 CTTTGGGAGGCCCAAGTGGGTGG + Intronic
1135509697 16:23071673-23071695 CTTTGCCCAGGCCACGTGGTGGG - Intronic
1135576500 16:23590014-23590036 CTTTGGGAGGCCAAAGTGGAAGG + Intronic
1135650881 16:24205396-24205418 CTTTGGGAGGCCCAGGTGGAAGG - Intronic
1135867284 16:26115556-26115578 TTTTTCCAGGTCCAAATGGATGG - Intronic
1136033563 16:27520960-27520982 CTTTGGCAGGCCCAGGTGGGTGG - Intronic
1136052918 16:27665842-27665864 CTTTGCCAGGCCGAGGTGGGTGG - Intronic
1136062210 16:27734453-27734475 CTTTGGGAGGGCGAGGTGGACGG + Intronic
1136173673 16:28503494-28503516 CTTTGGGAGGCCCAGGTGGAAGG - Intronic
1137637173 16:49996620-49996642 CTTTGCCAGGCCAAGGTGGGTGG + Intergenic
1137657032 16:50168887-50168909 CTTTGGGAGGCCGAAGTGGACGG - Intronic
1138877221 16:60966559-60966581 CTTTGGGAGGCCCAAGTGGGAGG + Intergenic
1139041334 16:63002260-63002282 CTTTGCCAGGGCAGTGAGGAAGG + Intergenic
1139134624 16:64187077-64187099 CTTTACCAAGGCCAAGTAGCAGG - Intergenic
1139188237 16:64832675-64832697 CTCTGCTAGGGCAATGTGGAAGG + Intergenic
1140087990 16:71813322-71813344 CTTTGGGAGGGCAAAGTGGGAGG - Intergenic
1140206765 16:72939642-72939664 CTTTGGGAGGCCCAAGTGGGCGG + Intronic
1140520939 16:75581204-75581226 CTTTGGGAGGTCGAAGTGGAAGG + Intergenic
1140868054 16:79081405-79081427 CTTTGGGAGGCCAAAGTGGATGG - Intronic
1141094963 16:81156687-81156709 CTTTGGCAGGCCAAGGTGGACGG - Intergenic
1141289040 16:82700722-82700744 CTTTGTGAGGGCAAAGAGGAGGG - Intronic
1141954416 16:87360887-87360909 CTTGGCCAGGGCCCAGTGCAGGG + Intronic
1142320952 16:89382578-89382600 CTTTGGGAGGCCGAAGTGGATGG - Intronic
1142327844 16:89428650-89428672 CTTTGGGAGGCCGAAGTGGATGG + Intronic
1142339677 16:89513177-89513199 CTTTGGGAGGCCCAGGTGGAAGG + Intronic
1203092107 16_KI270728v1_random:1222401-1222423 CTTTGGAAGGCCAAAGTGGATGG + Intergenic
1142615636 17:1132997-1133019 CTTTGGGAGGCCGAAGTGGACGG + Intronic
1143057003 17:4170025-4170047 CTTTTCAAAGGCCAAGTGCACGG + Intronic
1144019565 17:11228386-11228408 CTTTGCCAGGCCAAGGTGGGTGG + Intergenic
1144102166 17:11951435-11951457 CTTTGGGAGGCCCAAGTGGGTGG + Intronic
1144244411 17:13348635-13348657 CTTTGGAAGGCCGAAGTGGAAGG - Intergenic
1144393630 17:14820742-14820764 CTTTGGGAGGCCCAGGTGGATGG + Intergenic
1145033319 17:19522051-19522073 CTTTGGGAGGCCCAAGTGGATGG - Intronic
1145040986 17:19578437-19578459 CTTTGGGAGGGCAAGGTGGAAGG - Exonic
1145407158 17:22611740-22611762 CTTTGGGAGGGCAAAGTGGGAGG - Intergenic
1146354997 17:32126391-32126413 CTTTGGCAGGCCAAAGTGGTAGG + Intergenic
1146995733 17:37319577-37319599 CTTTGACAGGTCAAAGTGGGAGG + Intronic
1147307005 17:39570960-39570982 CAGTGCCAGGGCAGAGTGGAGGG + Intergenic
1147593481 17:41701071-41701093 CTTTGGGAGGGCAAAGTGGGAGG - Intergenic
1147736851 17:42644615-42644637 CTTTGGGAGGCCTAAGTGGATGG - Intergenic
1149590762 17:57828191-57828213 CTTTGGGAGGCCAAAGTGGAGGG + Intergenic
1149756246 17:59188693-59188715 CTTTGCAAGGCCAAAGTGGATGG + Intronic
1149829494 17:59859283-59859305 CTTTGGGAGGGCAAAGTGGGAGG - Intergenic
1149914426 17:60595937-60595959 CTTTGGGAGGCCAAAGTGGAAGG - Intergenic
1150468700 17:65417373-65417395 ATTGGCCAGGGCTAAGTGCAGGG - Intergenic
1150570113 17:66378077-66378099 CTTTGGGAGGCCCAAGTGGGTGG + Intronic
1150829381 17:68505567-68505589 CTTTGGGAGGCCCAAGTGGATGG + Intergenic
1150988494 17:70227416-70227438 CTTTCCCAGGGTCAAGTGCCTGG - Intergenic
1151037132 17:70813712-70813734 CTTTGGGAGGCCGAAGTGGACGG + Intergenic
1151467874 17:74299456-74299478 CTTGCCCAGGGCCAAGTGTTGGG + Intronic
1151553178 17:74833760-74833782 CTTGGGCAGGGCCAAGTGCCAGG + Intronic
1151641526 17:75398989-75399011 CTTTGGGAGGGCAAAGTGGGCGG - Intronic
1151835978 17:76583130-76583152 CTTTGGGAGGCCCAGGTGGACGG + Intronic
1152574842 17:81135444-81135466 AATCTCCAGGGCCAAGTGGAGGG - Intronic
1152775981 17:82202221-82202243 CTTTGGGAGGCCCAGGTGGATGG + Intronic
1153138904 18:1949444-1949466 CTTTGGGAGGCCCAGGTGGAAGG - Intergenic
1153213078 18:2789412-2789434 CTGTGTCAAGGCTAAGTGGAAGG + Intronic
1153348336 18:4052233-4052255 CTTTGCTAGGGCAATGTAGAAGG - Intronic
1153611650 18:6891834-6891856 CTTTGGGAGGCCGAAGTGGAAGG - Intronic
1153784041 18:8518490-8518512 CTTTGGGAGGCCAAAGTGGAAGG - Intergenic
1157616374 18:48990062-48990084 ATTTGGCAGGGCCAGGAGGAAGG - Intergenic
1157674371 18:49558128-49558150 CTTTGGGAGGCCAAAGTGGAAGG - Intergenic
1157867658 18:51199382-51199404 CTTTGAGAGGCCCAGGTGGAAGG - Intronic
1158668568 18:59454782-59454804 CTTGGCCAAGGCCAGGTGGAAGG - Intronic
1159208447 18:65284216-65284238 CTTTGGGAGGCCGAAGTGGATGG + Intergenic
1159582019 18:70243891-70243913 CTTTGCTAGGGCAAAGGGGAGGG - Intergenic
1159811833 18:73025906-73025928 CTCTGCTAGGGCAATGTGGAAGG + Intergenic
1161683743 19:5693196-5693218 CTCTGCCTGGGCCAAGGAGAGGG - Intronic
1161706152 19:5822755-5822777 CTTTGGGAGGCCAAAGTGGAAGG + Intergenic
1161747568 19:6070286-6070308 CTTGGCCAGGGCTAGGTGCATGG + Intronic
1161817776 19:6510369-6510391 CTTTGGGAGGGCGAAGTGGGCGG + Intergenic
1161838214 19:6662272-6662294 CTTTGGGAGGTCAAAGTGGACGG - Intronic
1161909447 19:7181822-7181844 CTTTGGGAGGCCGAAGTGGACGG - Intronic
1162039897 19:7964314-7964336 CTTTGCCAGGGCCACTTGTAGGG + Intronic
1162115987 19:8429745-8429767 CTTTGGCAGGCCAAAGTGGGTGG - Intronic
1162181720 19:8873786-8873808 CTTTGCGAGGCCCAGGTGGGTGG - Intronic
1162272006 19:9623759-9623781 CTTTGGGAGGACCAGGTGGATGG - Intronic
1162487888 19:10972865-10972887 CTTTGGGAGGCCAAAGTGGACGG + Intronic
1162579195 19:11518047-11518069 CTTTGGGAGGCCAAAGTGGAAGG + Intronic
1162607938 19:11725849-11725871 CTTTGCAGGGCCAAAGTGGAAGG + Intronic
1162679336 19:12328241-12328263 CTTTGGGAGGCCAAAGTGGAAGG + Intronic
1162947492 19:14052620-14052642 CTTTGGCAGGCCAAGGTGGAAGG + Exonic
1163069842 19:14830104-14830126 CTTTGGGAGGCCAAAGTGGAAGG - Intronic
1164447416 19:28329875-28329897 CTCTGCCAGGGCAGTGTGGAAGG + Intergenic
1164934112 19:32197851-32197873 CTTTGGGAGGCCAAAGTGGAAGG - Intergenic
1165702315 19:37948013-37948035 CCTAGCCAGGGCCCCGTGGAGGG - Intronic
1165974762 19:39665995-39666017 CTCTGCTAGGGCCATGTGGAAGG - Intergenic
1166002251 19:39884816-39884838 CTTTACCACTGCCACGTGGAGGG + Intronic
1166005035 19:39901067-39901089 CTTTACCACTGCCACGTGGAGGG + Intronic
1166674073 19:44728607-44728629 CTTTGCAAGGGCAAGGTGGATGG - Intergenic
1166698368 19:44867263-44867285 CTTTGAGAGGCCCAGGTGGACGG - Intronic
1167111231 19:47462829-47462851 CTTTGGGAGGTCGAAGTGGATGG - Intronic
1167297472 19:48660118-48660140 CTTTGGCAGGCCAAGGTGGAAGG + Intergenic
1167408362 19:49329537-49329559 CTTTGCAAGGGCGAGGTGGGAGG + Intergenic
1167472466 19:49683160-49683182 CTTTGGGAGGCCAAAGTGGATGG - Intronic
1167472606 19:49684048-49684070 CTATGCCCGGGACAAGTGGCTGG + Exonic
1167475687 19:49699709-49699731 CTTTGGGAGGCCCAAGTGGGTGG + Intronic
1167588272 19:50387484-50387506 CTGTGCCAGGGCCAATGAGAGGG + Intronic
1167692037 19:50991503-50991525 CTTTGGGAGGCCGAAGTGGATGG + Intergenic
1167839347 19:52101584-52101606 CTTTGCGAGGCCAAGGTGGATGG + Intergenic
1168485769 19:56760744-56760766 CTTTGCGAGGCCGAAGTGGGAGG + Intergenic
1168648606 19:58078089-58078111 CTTTGACAGGCCCAGGTGGGAGG - Intronic
1202677911 1_KI270711v1_random:24326-24348 CTTTGGAAGGCCCAAGTGGGAGG - Intergenic
926372137 2:12189323-12189345 CTTTGCTGGGGCAAAGTGGCAGG + Intergenic
927251953 2:21003833-21003855 CTCTGCCAGGGCCAAATCAAGGG - Intronic
927380751 2:22476725-22476747 CTTTGCTAGGGCAGTGTGGAAGG + Intergenic
927501544 2:23586602-23586624 CTTTGGGAGGCCCAGGTGGACGG - Intronic
928928181 2:36598998-36599020 CTTTGGCAGGCCCAGGTGGACGG + Intronic
930007215 2:46907638-46907660 CTTTGGGAGGCCAAAGTGGAAGG - Intronic
930902079 2:56519985-56520007 GTTTGCCAGGGGTAAGTGGGTGG - Intergenic
931356880 2:61544955-61544977 CTTTGGGAGGCCCAAGTGGGGGG - Intergenic
931637685 2:64355397-64355419 CATTTCCAGGGCCCTGTGGAGGG - Intergenic
931955971 2:67425255-67425277 CTTTGGGAGGCCAAAGTGGATGG - Intergenic
931967106 2:67546318-67546340 CTCTGCTAGGGCAGAGTGGAAGG - Intergenic
932147993 2:69341194-69341216 CTTTGGGAGGGCAAAGTGGGAGG - Intronic
932681971 2:73833965-73833987 CTTTGGGAGGCCGAAGTGGATGG + Intronic
932788353 2:74629507-74629529 CTTTGGGAGGCCCAAGTGGGTGG + Intronic
933375727 2:81477657-81477679 CTTTGGGAGGCCCAGGTGGATGG - Intergenic
933617275 2:84495404-84495426 CTTTGGGAGGCCAAAGTGGATGG - Intergenic
933878257 2:86642153-86642175 CTTTGGGAGGCCCAGGTGGATGG - Intronic
933912656 2:86956949-86956971 CTGTGTCAGTGGCAAGTGGATGG + Intronic
934010338 2:87812941-87812963 CTGTGTCAGTGGCAAGTGGATGG - Intronic
934674792 2:96241934-96241956 CTTTGGAAGGCCAAAGTGGAAGG - Intergenic
934945085 2:98534958-98534980 CTTAGCCAAGGGCAGGTGGAGGG + Intronic
935773905 2:106453661-106453683 CTGTGTCAGTGGCAAGTGGATGG - Intronic
935906158 2:107842252-107842274 CTGTGTCAGTGGCAAGTGGATGG + Intronic
935992627 2:108734775-108734797 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936127946 2:109807417-109807439 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936216751 2:110564068-110564090 CTGTGTCAGTGGCAAGTGGATGG - Intronic
936425890 2:112418649-112418671 CTGTGTCAGTGGCAAGTGGATGG - Intronic
936684556 2:114812356-114812378 CTTTGGGAGGCCAAAGTGGAAGG + Intronic
937257396 2:120565087-120565109 CTTTGCCAGGCTGCAGTGGAGGG + Intergenic
937326534 2:120992930-120992952 CTTTGCCAAGGCCAACTGCTGGG - Intergenic
938015848 2:127866630-127866652 CTTTGCCAGACCCACGTGGTTGG - Intronic
939283746 2:140101302-140101324 CTTTGGGAGGCCCAGGTGGATGG + Intergenic
939772379 2:146337120-146337142 CTTTGACAGGCCAAGGTGGATGG - Intergenic
940696859 2:156990566-156990588 CTTTGGGAGGGCGAGGTGGACGG + Intergenic
940840928 2:158580940-158580962 CTGTGCCAGGGCCATGGGGGTGG - Intronic
941090241 2:161166946-161166968 CTTTTCTAGGGCAAAGTGGAAGG + Intronic
941333285 2:164207500-164207522 ATTGGGCAGGGCCAAGTGGTGGG - Intergenic
941396301 2:164977913-164977935 CTTTGTAAGGCCCAGGTGGATGG + Intergenic
941807418 2:169722885-169722907 CTTTGGGAGGCCGAAGTGGATGG - Intronic
942624702 2:177887518-177887540 CTTTGGGAGGCCAAAGTGGAAGG + Intronic
943389270 2:187243270-187243292 CTTTGGGAGGCCCAAGTGGGTGG + Intergenic
943889311 2:193266095-193266117 CTTTGGGAGGTCAAAGTGGAGGG - Intergenic
944485488 2:200200749-200200771 CTTTGGGAGGCCAAAGTGGATGG + Intergenic
944561226 2:200940556-200940578 CTTTGAGAGGCCCAGGTGGATGG + Intronic
944702115 2:202255084-202255106 CTTTGGGAGGCCCATGTGGATGG - Intergenic
944790431 2:203119360-203119382 CTTTGCAAGGCCTAAGTGGGTGG - Intronic
945146026 2:206739170-206739192 CTTTGGAAGGCCAAAGTGGATGG + Intronic
945307326 2:208270283-208270305 CTTTGGGAGGCCGAAGTGGACGG - Intronic
945736339 2:213605405-213605427 CTTTGGGAGGCCAAAGTGGAAGG + Intronic
947009412 2:225549122-225549144 CTTTGGGAGGCCCAAGTGGATGG - Intronic
947191899 2:227515162-227515184 CTTTGCGAGGCCCAAACGGATGG - Intronic
947576329 2:231277804-231277826 CTTTGGGAGGGCGAAGTGGGTGG - Intronic
947926455 2:233926247-233926269 CTTTGCAGTGGCCAAGTGCATGG - Intronic
948056026 2:235009907-235009929 CTTTCCCAGGAGCAAGAGGAAGG - Intronic
948070900 2:235123814-235123836 CTTTGGGAGGCCAAAGTGGATGG - Intergenic
948374802 2:237514340-237514362 CTTTGAGAGGCCCAAGTGGGAGG - Intronic
948842843 2:240664204-240664226 CTTTGGGAGGTCCATGTGGATGG + Intergenic
948894458 2:240921803-240921825 CTATGCCTGGGCCAAATGCATGG - Intronic
949032328 2:241802951-241802973 CTGTGCCAGGGGCCCGTGGAGGG + Intronic
1168963253 20:1883118-1883140 CTTTGGGAGGCCCAAGTGGGTGG - Intergenic
1169094194 20:2881755-2881777 CTTTGGGAGGCCGAAGTGGACGG + Intronic
1169129503 20:3158212-3158234 CTTTGGGAGGCCGAAGTGGAAGG - Intronic
1169243107 20:4001690-4001712 CTTTGGCAGGCCAAGGTGGAAGG + Intronic
1169271135 20:4200252-4200274 CTTTGGGAGGCCCAAGTGGGTGG + Intergenic
1169411914 20:5378094-5378116 CTTTGGGAGGTCCAGGTGGAAGG - Intergenic
1169492476 20:6082901-6082923 CTTTGGGAGGCCAAAGTGGACGG - Intronic
1169802993 20:9530438-9530460 CTGTGCCAGGTCCAAGTCGGGGG + Exonic
1169877066 20:10309681-10309703 CTCTGCCAGTGCCAAGTAGGAGG - Intergenic
1169896321 20:10508796-10508818 CTTTCCCAGGCCCCAGCGGATGG - Intronic
1170134390 20:13056691-13056713 CTTTGGGAGGCCAAAGTGGATGG - Intronic
1170188494 20:13619139-13619161 CTTTGGGAGGCCGAAGTGGACGG - Intronic
1171482430 20:25464171-25464193 CTTTGGGAGGCCGAAGTGGAAGG + Intronic
1171498562 20:25575507-25575529 CTTTGGGAGGGCAAGGTGGATGG + Intronic
1171896337 20:30813552-30813574 CTTTGCCAGGGTAGGGTGGAGGG + Intergenic
1172078864 20:32322363-32322385 CTTTGAGAGGCCCAGGTGGACGG + Intronic
1172163004 20:32881438-32881460 CTTTGGGAGGCCGAAGTGGATGG - Intronic
1172182759 20:33013693-33013715 GCCTGCCTGGGCCAAGTGGAGGG + Intronic
1172365809 20:34348241-34348263 CTTTGGGAGGCCGAAGTGGAAGG - Intergenic
1172466258 20:35157032-35157054 CTTTGGGAGGCCAAAGTGGATGG - Intergenic
1172788937 20:37489123-37489145 CTTTGGGAGGCCGAAGTGGAAGG - Intergenic
1173515436 20:43662419-43662441 CTTTGGGAGGGCAAGGTGGAAGG - Intergenic
1173539823 20:43842950-43842972 CTTTCCAAGGGCCAGGTGGCAGG - Intergenic
1174358272 20:50012457-50012479 CTTTGCCAGGGGCAAAGAGAAGG - Intergenic
1175150377 20:56928848-56928870 CTTTGGGAGGCCCAGGTGGATGG - Intergenic
1175186269 20:57181259-57181281 CTTTGGGAGGCCAAAGTGGAAGG + Intronic
1175874547 20:62223158-62223180 CTGGGCCAGAGCCATGTGGACGG + Intergenic
1176126024 20:63475144-63475166 CTTTGCCTGGGCGCAGAGGAGGG - Intergenic
1176388574 21:6151837-6151859 CTCTGCCAGGGCCAAGGGAAGGG + Intergenic
1177560234 21:22741655-22741677 CTTTGGGAGGCCCAAATGGAAGG - Intergenic
1177604459 21:23360076-23360098 CTCTGCCAGGGCAGTGTGGAAGG - Intergenic
1177606050 21:23379054-23379076 CTCTGCTAGGGCAATGTGGAAGG + Intergenic
1177744950 21:25200779-25200801 CCTTGGCATGGCCAAGTAGAAGG - Intergenic
1178711146 21:34917885-34917907 CTTTGGGAGGTCCAGGTGGATGG + Intronic
1178764882 21:35440955-35440977 CTTTGGTAGGCCCAGGTGGATGG - Intronic
1179126822 21:38598395-38598417 CTTGTTCAGGGCCAGGTGGATGG - Intronic
1179734898 21:43386411-43386433 CTCTGCCAGGGCCAAGGGAAGGG - Intergenic
1180981655 22:19880932-19880954 CTTTCCCAGGGCAGAGTGGAGGG - Intronic
1181065198 22:20302550-20302572 CTTTGGGAGGCCAAAGTGGAAGG - Intergenic
1181785333 22:25222493-25222515 CTTTGCCAGGCCGAGGTGGGAGG + Intronic
1182020820 22:27080220-27080242 CTTGGCCAGAGCCCTGTGGAGGG - Intergenic
1182085272 22:27556927-27556949 CTGTGCTGGGGCCAGGTGGAGGG - Intergenic
1182333445 22:29567607-29567629 CTTTGGGAGGCCAAAGTGGAAGG + Intronic
1182418694 22:30238054-30238076 CAAGGCCAGGGCCAGGTGGATGG - Intergenic
1182525501 22:30915205-30915227 CTTTGCGAGGCCCAGGTGGGTGG + Intergenic
1183033674 22:35124442-35124464 CTTTGGGAGGGCGAGGTGGACGG + Intergenic
1183159407 22:36101776-36101798 CTTTGGGAGGGCAAAGTGGATGG - Intergenic
1183729306 22:39608593-39608615 CTTTGGCAGGCCGAGGTGGATGG + Intronic
1184200468 22:42965254-42965276 GTTTGCCAGGGCCAGGGGGCAGG + Intronic
1184270387 22:43377999-43378021 CTTTTCAAGGGCCAGGAGGAAGG - Intergenic
1184373120 22:44095263-44095285 CTTTGGAAGGCCAAAGTGGACGG + Intronic
1184536008 22:45087319-45087341 CTTTGGGAGGCCGAAGTGGATGG + Intergenic
1184578224 22:45392190-45392212 CTTTGGGAGGCCGAAGTGGATGG - Intronic
1184899922 22:47439563-47439585 AGTTGCCAGGGCCAAGCGCAAGG + Intergenic
1185147913 22:49149426-49149448 CTTTTGCAGGGCCAGGAGGAAGG + Intergenic
1185289420 22:50016136-50016158 CTGGGCCAGGACCAAGTGGGTGG + Intronic
1185369888 22:50456144-50456166 CTTGGGTAGAGCCAAGTGGACGG - Intronic
949418659 3:3841054-3841076 CTTTGGGAGGCCGAAGTGGACGG + Intronic
949520769 3:4852001-4852023 CTTTGGGAGGCCAAAGTGGATGG + Intronic
949891855 3:8739200-8739222 CTTTCCCAGGGTCCAGTGGTGGG + Intronic
950016685 3:9759487-9759509 CTTTGCCAAGAGCAAGTGGAAGG - Exonic
950733935 3:14989549-14989571 CTTTGAGAGGCCCAGGTGGAAGG + Intronic
951904003 3:27685730-27685752 CTTAGCCAGGGCCAAGGGCTAGG - Intergenic
952247118 3:31606682-31606704 CTTTGCTAGGGCAGTGTGGAAGG + Intronic
952413192 3:33067522-33067544 CTTTGGGAGGCCAAAGTGGAGGG - Intronic
952889625 3:38031325-38031347 CTGTGCCAGGGGCCAGAGGAGGG - Intergenic
952953964 3:38545201-38545223 CTGTGACAGGGCCACCTGGAGGG + Intergenic
953446644 3:42974274-42974296 CTCTGCCAGGGCAGTGTGGAAGG + Intronic
953456562 3:43047039-43047061 CTTTGCTAGGGCAATGTGGAAGG + Intronic
953805821 3:46066484-46066506 CTTTGGGAGGCCCAAGTGGGTGG - Intergenic
953860559 3:46540774-46540796 GTTTGCCAGGGCCACGAGAAGGG - Intronic
954038476 3:47866510-47866532 CTTTGGCAGGCCAAAGTGGGTGG + Intronic
954263798 3:49458489-49458511 CTTTGGGAGGCCCAGGTGGATGG - Intergenic
954325296 3:49860170-49860192 CTTTGCCAGGGCCAAGTGGAAGG - Exonic
954759551 3:52864141-52864163 CTCTGCTAGGGCAATGTGGAAGG - Intronic
954825801 3:53372371-53372393 CTTTGAGAGGCCCAGGTGGATGG + Intergenic
955165938 3:56511397-56511419 CTTTGGCAGGCCGAAGTGGGAGG + Intergenic
955192530 3:56774656-56774678 CTTTGGGAGGGCGAAGTGGGTGG + Intronic
955306731 3:57840195-57840217 CTTTGGGAGGCCAAAGTGGATGG - Intronic
955682554 3:61517651-61517673 GTTTCCAAGGTCCAAGTGGATGG + Intergenic
955692541 3:61604768-61604790 CTGTGCCACGGCCACATGGAGGG + Intronic
956044488 3:65180836-65180858 CTTTGCGAGGGCTAGGTGGGAGG - Intergenic
956075522 3:65501235-65501257 CTTTGGGAGGCCGAAGTGGATGG + Intronic
956077350 3:65519625-65519647 CTTTGGCAGGCCAAAGTGGGTGG - Intronic
956139856 3:66135072-66135094 CTTTGCGAGGCCAAAGTGGCTGG - Intronic
956830203 3:73039364-73039386 CTTTGGGAGGCCCAGGTGGATGG - Intronic
958006065 3:87813022-87813044 CTTTGCTAGGGCAATGTAGAAGG + Intergenic
958481637 3:94651931-94651953 CTCTGCTAGGGCAATGTGGAAGG + Intergenic
958736788 3:98018864-98018886 CTTTGGCAGGCCGAGGTGGACGG + Intronic
958925631 3:100154091-100154113 CTTTGGGAGGCCCAGGTGGACGG - Intronic
959104626 3:102051832-102051854 CTTTGCTAGGGCAGCGTGGAAGG + Intergenic
959386318 3:105713024-105713046 CTTTGGGAGGCCGAAGTGGAAGG + Intronic
959872057 3:111340175-111340197 CTTTTCCAAGGCCACGTAGATGG - Intronic
960287360 3:115844731-115844753 CTTTGGGAGGCCCAAGTGGGTGG + Intronic
960689374 3:120327988-120328010 CTTTGGGAGGCCGAAGTGGATGG - Exonic
960867915 3:122220728-122220750 CTTTGCGAGGCCGAGGTGGATGG + Intronic
961161072 3:124726571-124726593 CTTTGAAAGGCCAAAGTGGAAGG + Intergenic
962481582 3:135802810-135802832 CTTTGCCAGGGCCCTTTGGCAGG - Intergenic
963290642 3:143483641-143483663 CTTGGACAGGGCCACGTGAAAGG + Intronic
963317845 3:143779612-143779634 CTTTGGGAGGCCGAAGTGGATGG - Intronic
963552260 3:146739288-146739310 CTTTGCCTGGGCCTGGTGGCAGG + Intergenic
963787814 3:149552796-149552818 CTTCTCCAGAGCCAAGTGTACGG + Intronic
963815957 3:149831125-149831147 CTTTGCTAGGGCAGTGTGGAAGG + Intronic
964571971 3:158117533-158117555 CTTTGGCAGGCCGAAGTGGGTGG - Intronic
965343613 3:167519988-167520010 CTTTGGGAGGGTGAAGTGGAAGG + Intronic
965410268 3:168321305-168321327 CTTTGGGAGGCCGAAGTGGAAGG - Intergenic
966123375 3:176547908-176547930 CTTTGCTAGGCCAATGTGGAAGG - Intergenic
966393205 3:179474858-179474880 CTTTGGGAGGGCAAGGTGGAAGG - Intergenic
966455975 3:180116801-180116823 CTTTGCCAGAGCCCAATGCAAGG - Intergenic
966631965 3:182086170-182086192 CTTTGGCAGGCCAAAGTGGAAGG + Intergenic
967505238 3:190246023-190246045 CTCTGCTAGGGCAATGTGGAAGG - Intergenic
967851815 3:194088184-194088206 CTGAGCCTGGGCCAAGAGGAGGG + Intergenic
968129458 3:196184348-196184370 CTTTGGGAGGTCAAAGTGGAAGG + Intergenic
968205652 3:196797508-196797530 CTTTGCGAGGCCGAAGTGGGTGG + Intronic
968482737 4:843624-843646 CCTTTCCTGGGCCAAGTAGAGGG - Intergenic
968636579 4:1684130-1684152 CTTTGCCCGCGGCACGTGGAGGG - Intronic
968641559 4:1717484-1717506 CTGGGCCAGGGCCGGGTGGATGG - Intronic
968738519 4:2313499-2313521 CTTTGGGAGGCCCAGGTGGATGG - Intronic
969468606 4:7372549-7372571 CTTTGGGAGGCCCAGGTGGATGG - Intronic
970397138 4:15680425-15680447 CTTTGGGAGGCCCAAGTGGGTGG + Intronic
970756867 4:19437458-19437480 CTCTGCTAGGGCAATGTGGAAGG + Intergenic
970758117 4:19450833-19450855 CTCTGCTAGGGCAGAGTGGAAGG - Intergenic
970981156 4:22098879-22098901 CTTTGGGAGGGCGAGGTGGAAGG + Intergenic
971063765 4:23003709-23003731 CTTTGCCATGGCCATAAGGATGG - Intergenic
971206957 4:24580162-24580184 CTTTGGGAGGCCCAAGTGGGAGG + Intronic
971386597 4:26146188-26146210 CTTTGGGAGGCCGAAGTGGAAGG - Intergenic
971459408 4:26878489-26878511 CTTTGCCTGGGCCTTGTGGGTGG + Intronic
971586807 4:28414875-28414897 CTTTGGTAGGCCCAAGTGGGTGG - Intergenic
971857089 4:32058027-32058049 CTTTGCTAGGGCAATGTAGAAGG - Intergenic
972278385 4:37580973-37580995 CTTTGCCTGGGAAAAGGGGAGGG - Intronic
974253371 4:59419142-59419164 CTTTGAGAGGCCGAAGTGGATGG - Intergenic
974321351 4:60354056-60354078 CTTTGGGAGGCCCAGGTGGATGG - Intergenic
974774992 4:66467767-66467789 CTTTGGGAGGCCGAAGTGGATGG - Intergenic
975375900 4:73645716-73645738 CTTGGCCTGTGGCAAGTGGAGGG - Intergenic
975675902 4:76827364-76827386 CTTTGGGAGGCCAAAGTGGATGG - Intergenic
976442296 4:85089270-85089292 CTCTGCCAGGGCAGTGTGGAAGG + Intergenic
976503115 4:85814839-85814861 CTCTGCTAGGGCAATGTGGAAGG - Intronic
976723035 4:88188454-88188476 CTTTGGGAGGCCAAAGTGGAAGG - Intronic
977747848 4:100572426-100572448 CTTTGGCAGGCCAATGTGGAAGG + Intronic
977806891 4:101310434-101310456 CTTTGGGAGGCCCAAGTGGAAGG + Intronic
977864732 4:102010634-102010656 CTTTGGGAGGCCAAAGTGGATGG - Intronic
978513223 4:109544022-109544044 CTTTGGCAGGTCCAGGTGGGAGG + Intergenic
978904072 4:113985580-113985602 CTCTGCTAGGGCAATGTGGAAGG + Intergenic
978922541 4:114201504-114201526 CATTGCCAGGGCATAGAGGAGGG + Intergenic
978942455 4:114453079-114453101 CTTTGCCAGGGCCAAAGTCAAGG - Intergenic
979390097 4:120117887-120117909 CTATGCTAGGGCAATGTGGAAGG - Intergenic
980083939 4:128372283-128372305 CTTGGCCAGTGTCAAGTTGAGGG - Intergenic
980125946 4:128774360-128774382 CTTTGGGAGGCCCAAGGGGAAGG - Intergenic
980772499 4:137395096-137395118 CTTTGGGAGGCCCAAGTGGGTGG + Intergenic
980785554 4:137549781-137549803 CTTTGAAAGGCCCAGGTGGAAGG + Intergenic
981046609 4:140270616-140270638 CATTGCCAGGGCCAGGTAGCAGG - Intronic
981412428 4:144448746-144448768 CTTTGGGAGGCCAAAGTGGATGG - Intergenic
981542264 4:145858386-145858408 CTTTGGGAGGGCAAAGTGGGAGG + Intronic
981576725 4:146213414-146213436 CTGTGTCAGGACCCAGTGGAGGG + Intergenic
981579009 4:146233643-146233665 CTTTGGGAGGCCCAGGTGGACGG - Intergenic
981995122 4:150965785-150965807 CTTTGCAAGGCCGAGGTGGAAGG - Intronic
982252431 4:153420708-153420730 CTTTGTGAGGGCCAGGTGGGAGG + Intergenic
983170291 4:164528424-164528446 CTTTGGGAGGCCCAAGTGGGTGG + Intergenic
983460687 4:168022816-168022838 CTCTGCCAGGGCAGTGTGGAAGG - Intergenic
984079006 4:175219480-175219502 CTTTGCCAAGGCCAATGTGAAGG + Intergenic
984496738 4:180507377-180507399 CTTTGCGAGGCCGAGGTGGACGG + Intergenic
984673893 4:182524771-182524793 CTTTGGGAGGCCAAAGTGGATGG + Intronic
985893644 5:2736240-2736262 CTTCACCAGGGCCCAGTGGAGGG - Intergenic
985968229 5:3353767-3353789 CTTTGCAGGGGGCAAATGGATGG + Intergenic
986378977 5:7163660-7163682 CTTTACCAGGCCAAAGTGGGAGG - Intergenic
986756734 5:10843855-10843877 CTCTGCTAGGGCAATGTGGAAGG - Intergenic
987332988 5:16873568-16873590 CTTTGCTAGGGCAGTGTGGAAGG - Intronic
987510701 5:18834286-18834308 CTTTGGGAGGGCGAGGTGGATGG - Intergenic
987692023 5:21279622-21279644 CTTTGGGAGGCCGAAGTGGATGG + Intergenic
987827452 5:23051084-23051106 CTTTGGGAGGCCCAAGCGGACGG - Intergenic
987895646 5:23942995-23943017 CTCTGCTAGGGCAATGTGGAAGG - Intergenic
988368379 5:30333111-30333133 CTTTGGGAGGCCAAAGTGGATGG - Intergenic
988557152 5:32247104-32247126 CTTTGCAAGGCCAAAGTGGGAGG + Intronic
989042902 5:37248031-37248053 CTTTGGGAGGACGAAGTGGATGG - Intronic
989602087 5:43209856-43209878 CTTTGGGAGGCCCAGGTGGATGG - Intronic
989630823 5:43481343-43481365 CTTTGGGAGGCCAAAGTGGAAGG - Intronic
989753427 5:44922784-44922806 CTCTGCCAGGGCAGTGTGGAAGG + Intergenic
990549565 5:56860607-56860629 CTTTGGGAGGGCGAAGTGGGCGG + Intronic
990967472 5:61464696-61464718 GTTTACCAGGGCCAAGAGGAAGG - Intronic
991535943 5:67669414-67669436 CTCTGCTAGGGCAATGTGGAAGG + Intergenic
991725981 5:69536425-69536447 CTTTGGGAGGCCCAGGTGGACGG + Intronic
991868975 5:71091442-71091464 CTTTGGGAGGCCCAGGTGGACGG - Intergenic
992073576 5:73171063-73171085 ATATGCCATGACCAAGTGGAAGG - Intergenic
992088898 5:73300835-73300857 CTTTGCCTGGGCCAAGGGAGCGG + Intergenic
992167337 5:74067553-74067575 CTTTGCCAGGGCCTCGTGTTAGG + Intergenic
992456258 5:76918855-76918877 GATTGCCAGGGACAAGTGGGAGG - Intronic
992485506 5:77190631-77190653 CCTTACCAGGGCCAAGTGAAAGG - Intergenic
992560758 5:77950578-77950600 CTTTGCGAGGCTGAAGTGGACGG + Intergenic
992831060 5:80593893-80593915 CTTTGGGAGGGCAAAGTGGGTGG + Intergenic
993262249 5:85673881-85673903 CTTTGGGAGGCCGAAGTGGATGG + Intergenic
993868722 5:93224905-93224927 CTTTGGGAGGCCCAGGTGGATGG + Intergenic
994177140 5:96723206-96723228 CTTTGGGAGGCCCAGGTGGAAGG - Intronic
994920709 5:106039396-106039418 CTTTGGCAGGCCCAGGTGGGTGG - Intergenic
995107745 5:108394241-108394263 CTTTGGGAGGCCAAAGTGGAAGG - Intergenic
995147793 5:108806339-108806361 CTCTGCTAGGGCAATGTGGAAGG + Intronic
995774600 5:115711853-115711875 CTCTGCCAGGGCAGTGTGGAAGG - Intergenic
996070921 5:119130584-119130606 CTTTGGGAGGCCCAGGTGGATGG - Intronic
996852940 5:127973015-127973037 CTTTGGGAGGTCCAAGTGGGAGG - Intergenic
997057317 5:130460010-130460032 CTCTGCTAGGGCAATGTGGAAGG + Intergenic
997495495 5:134320630-134320652 CTTTGCGAGGCCCAGGTGGGTGG + Intronic
997868203 5:137483380-137483402 CTTTTCCAGAGCCAAGAGAAGGG - Intronic
998173194 5:139884314-139884336 CCTTGCCAGGGACAAGTGAGGGG + Intronic
998188487 5:140001616-140001638 CTTTGGCAGGGCAAGGTGGGAGG + Intronic
998393191 5:141800977-141800999 CTTTCTCAAGGCCAAGGGGAAGG + Intergenic
998591963 5:143487863-143487885 CTTTGCCAGGCCAAGGTGGGCGG - Intergenic
999812304 5:155139416-155139438 CTCTGCCAAGGCCACGTGGCTGG + Intergenic
999967949 5:156830035-156830057 CGTTGCAAGGACCAGGTGGATGG - Intergenic
1000104769 5:158048975-158048997 TTTTCTCAGGACCAAGTGGATGG + Intergenic
1000466441 5:161583830-161583852 CTTTGCCAGGCCAAGGTGGGAGG + Intronic
1000768314 5:165319047-165319069 CTCTGCCAGGGCGGTGTGGAAGG - Intergenic
1000777854 5:165442079-165442101 CTGTGCTAGGGCAATGTGGAAGG - Intergenic
1001181647 5:169526111-169526133 CTGTGCTAGGGCAATGTGGAAGG - Intergenic
1001221097 5:169901779-169901801 CTTTCCCAGAGCCAAATGGAGGG + Intronic
1001925785 5:175635714-175635736 CTTTGGGAGGCCGAAGTGGATGG + Intergenic
1002138186 5:177121504-177121526 CTTTGGGAGGCCCAAGTGGGTGG - Intergenic
1002384674 5:178857488-178857510 CTTTGGGAGGCCCAAGTGGGTGG - Intergenic
1002629369 5:180560186-180560208 CTTTGGGAGGGCGAAGTGGGTGG - Intronic
1002768552 6:266891-266913 CTTTGGGAGGCCCAGGTGGATGG + Intergenic
1003550352 6:7097709-7097731 CTTTGGGAGGCCCAAGTGGGTGG + Intergenic
1004261804 6:14114935-14114957 CTTTGGAAGGCCCAGGTGGACGG - Intergenic
1004418079 6:15443347-15443369 CATTGGAAGGGCTAAGTGGAAGG + Intronic
1005604952 6:27467350-27467372 CTTTGGGAGGCCAAAGTGGATGG + Intronic
1005623202 6:27638887-27638909 CTTTGGGAGGCCAAAGTGGATGG - Intergenic
1005921740 6:30407715-30407737 CTCTGCTAGGGCAATGTGGAAGG + Intergenic
1006004486 6:30991491-30991513 CTTTGGGAGGCCGAAGTGGATGG + Intergenic
1006085783 6:31593911-31593933 CTTTGGGAGGCCTAAGTGGATGG - Intergenic
1006351495 6:33524506-33524528 CTTTGGCAGGCCCAGGTGGATGG + Intergenic
1006827554 6:36947269-36947291 CTTTGCAAGGCCCAGGTGGGTGG + Intergenic
1007711807 6:43829043-43829065 CACTGTCAGGGCCAAGGGGAAGG - Intergenic
1008105044 6:47431942-47431964 CTTTGGGAGGCCAAAGTGGATGG + Intergenic
1008300996 6:49839189-49839211 CTTTGAGAGGGCAAAGTGGAAGG + Intronic
1009328860 6:62389289-62389311 CTCTGACAGGGACAAGTGGGTGG + Intergenic
1009634932 6:66253128-66253150 CTTTGCTAGGGCAGTGTGGAAGG - Intergenic
1009733001 6:67634452-67634474 CTCTACTAGGGCCATGTGGAGGG + Intergenic
1010232669 6:73549059-73549081 CTTTGGCAGGCCAAGGTGGATGG + Intergenic
1010448248 6:75973221-75973243 CTTTGGGAGGCCGAAGTGGAAGG - Intronic
1010812491 6:80315725-80315747 CTTTGGCAGGCCGACGTGGAAGG - Intronic
1010845538 6:80702564-80702586 CTTTGCTAGGGCAGTGTGGAAGG + Intergenic
1011268462 6:85551022-85551044 CTTTGCGAGGCCGAAGTGGGTGG - Intronic
1011281532 6:85682659-85682681 CTTTGGGAGGTCCAGGTGGAAGG - Intergenic
1011635571 6:89369646-89369668 CTTTGGGAGGCCAAAGTGGAAGG - Intronic
1011811643 6:91138898-91138920 CTTTGCCAGTGCCAAGTTTTTGG + Intergenic
1011947129 6:92919705-92919727 CTTTACAAAGGGCAAGTGGATGG + Intergenic
1012219659 6:96633402-96633424 CTCTGGGAGGGACAAGTGGAGGG + Intergenic
1012328137 6:97949759-97949781 CTTTGGGAGGCCCAGGTGGATGG - Intergenic
1012449946 6:99344360-99344382 CTCAGGCAGGGCCAAGGGGAAGG - Intronic
1012543587 6:100391927-100391949 CTTTGGGAGGCCCAGGTGGATGG + Intronic
1012706573 6:102539036-102539058 CTCTGCCAGGGCAATGTGAAAGG + Intergenic
1012768299 6:103397224-103397246 GTCTGCTAGGGCCACGTGGAAGG + Intergenic
1013642683 6:112102238-112102260 CTTTGGGAGGCCGAAGTGGATGG + Exonic
1016472422 6:144388743-144388765 CTTTGGGAGGCCCAAGTGGGTGG - Intronic
1016987911 6:149908967-149908989 CTCTGCCAGGGCAGTGTGGAAGG + Intergenic
1017106485 6:150893306-150893328 CTTTGAGAGGGCCATGTGGGTGG - Intronic
1017228340 6:152045287-152045309 CTTTTCAATGGCCAAGTGCACGG - Intronic
1017739633 6:157395407-157395429 CTTTGGGAGGCCGAAGTGGAAGG - Intronic
1017841007 6:158222985-158223007 CTTTGCAAGGGCGAGGTGGGAGG + Intergenic
1017988301 6:159463920-159463942 CTTTGGGAGGCCCAAGTGGGTGG - Intergenic
1018511154 6:164526229-164526251 CTTTGCTAGGGCAGTGTGGAAGG + Intergenic
1018646888 6:165957235-165957257 CTTTGGAAGGCCAAAGTGGAAGG + Intronic
1019373326 7:675134-675156 CTTTGCCAAGGTCACGTGGGAGG - Intronic
1019475836 7:1243865-1243887 CTTTGCTGGGGCCAAGGGAAGGG - Intergenic
1019479571 7:1260279-1260301 TTTCTCCAGGGACAAGTGGAGGG - Intergenic
1020077345 7:5266957-5266979 CTTTGGAAGGGCGAAGTGGGAGG + Intergenic
1020249673 7:6457423-6457445 CTTTGCGAGGCCGAAGCGGACGG - Intronic
1020537843 7:9424194-9424216 CTCTGCTAGGGCAGAGTGGAAGG - Intergenic
1020761788 7:12276642-12276664 CTTTGGGAGGCCGAAGTGGAGGG - Intergenic
1020795385 7:12672451-12672473 CTTTGGGAGGCCAAAGTGGAAGG + Intergenic
1020934172 7:14439618-14439640 CTTTGGGAGGCCGAAGTGGATGG + Intronic
1021444228 7:20715651-20715673 CTTTGGGAGGCCCAAGTGGGAGG - Intronic
1021927358 7:25546244-25546266 CTATGCCAGGGCAAGGAGGAGGG + Intergenic
1022630449 7:32079619-32079641 CTTTGGCAGGGACAGCTGGAAGG + Intronic
1022656570 7:32324703-32324725 CTTTGGGAGGCCAAAGTGGAAGG + Intergenic
1022725693 7:32979492-32979514 CTTTGCCAAAGGCCAGTGGAAGG + Intronic
1023480416 7:40627847-40627869 CTCTGCCAGGGCTAAATGGCAGG + Intronic
1023753023 7:43389874-43389896 CTTTGGGAGGCCAAAGTGGAAGG - Intronic
1023813696 7:43931929-43931951 CTTTGGGAGGCCCAAGTGGGTGG - Intronic
1024788445 7:52934680-52934702 CTTTGGGAGGCCAAAGTGGATGG + Intergenic
1024843977 7:53620609-53620631 CTCTGCTAGGGCAATGTGGAAGG + Intergenic
1024860151 7:53829787-53829809 CTTTGGGAGGCCGAAGTGGATGG + Intergenic
1024907346 7:54401255-54401277 CTTTGGGAGGCCAAAGTGGATGG - Intergenic
1025055814 7:55764068-55764090 CTTTGGGAGGCCGAAGTGGATGG + Intergenic
1025123790 7:56328862-56328884 CTTTGGGAGGCCGAAGTGGACGG + Intergenic
1025201775 7:56966717-56966739 CTTTGGAAGGGCGAAGTGGGAGG - Intergenic
1025210232 7:57016177-57016199 CTTTGGAAGGGCAAAGTGGGTGG - Intergenic
1025661721 7:63560670-63560692 CTTTGGAAGGGCAAAGTGGGTGG + Intergenic
1025670171 7:63610211-63610233 CTTTGGAAGGGCGAAGTGGGAGG + Intergenic
1025720950 7:64012554-64012576 CTTTGCGAGGCCAAGGTGGAAGG - Intergenic
1026170778 7:67952170-67952192 CTTGGCCAGGACCAAATAGAAGG + Intergenic
1026423854 7:70269928-70269950 CTTTGGGAGGCCAAAGTGGAAGG + Intronic
1026505631 7:70980309-70980331 CTTTGGGAGGGCAAAGTGGGGGG - Intergenic
1027224060 7:76233057-76233079 CTTTGGGAGGCCAAAGTGGAAGG + Intronic
1027407432 7:77876647-77876669 CTTTGGGAGGGCAAAGAGGAAGG + Intronic
1027661368 7:80991736-80991758 CTTTGGGAGGCCGAAGTGGATGG - Intergenic
1027888894 7:83945678-83945700 CTTTGGGAGGCCCAAGTGGGTGG + Intergenic
1029414142 7:100432502-100432524 CTTTGCCAGCCCCAACTGCAGGG + Intronic
1029471331 7:100756318-100756340 CTTTAGCAGGCCGAAGTGGAGGG + Intronic
1029826837 7:103206163-103206185 CTTTGGGAGGCCCAAGTGGCTGG + Intergenic
1030784261 7:113640823-113640845 CTCTGCTAGGGCAATGTGGAAGG - Intergenic
1032242945 7:130179730-130179752 CTTTGGGAGGCCAAAGTGGAGGG + Intronic
1033260447 7:139839593-139839615 CTTTGGGAGGGCAAAGTGGGAGG + Intronic
1033421068 7:141205067-141205089 CTTTGGGAGGCCAAAGTGGAAGG - Intronic
1034214760 7:149396849-149396871 CTTTGGAAGGCCGAAGTGGAAGG + Intergenic
1034526887 7:151670249-151670271 TTTTGCCATGGAAAAGTGGATGG - Intronic
1034915913 7:155038825-155038847 CTTTGGGAGGCCGAAGTGGAAGG - Intergenic
1035416380 7:158692059-158692081 CTTTGCCAGGGCAAGGTGGGAGG + Intronic
1036407263 8:8466261-8466283 CTTTGGGAGGGCGAAGTGGGTGG + Intergenic
1037533853 8:19806933-19806955 CTTTGGGAGGCCAAAGTGGAAGG - Intergenic
1037554056 8:20004754-20004776 CATGCCCAGGGCCAAGTGGCGGG + Intergenic
1038158655 8:25015579-25015601 CTTTGGGAGGCCCAAGTGGGTGG + Intergenic
1038421151 8:27434756-27434778 CTTTGGGAGGCCAAAGTGGATGG + Intronic
1038555079 8:28505593-28505615 CTTTGGGAGGCCCAAGTGGGTGG - Intronic
1039616864 8:38962243-38962265 CTTTGGGAGGCCAAAGTGGAAGG + Intronic
1039867172 8:41515794-41515816 CTTTGCGAGGCCGAAGTGGGTGG + Intergenic
1040015054 8:42692842-42692864 CTTTGGGAGGGCGAGGTGGAAGG + Intergenic
1040704723 8:50111700-50111722 ATTTACCAAGGCCCAGTGGAGGG + Intronic
1040813431 8:51481919-51481941 CTCTGCCAGGGCAGTGTGGAAGG + Intronic
1041424335 8:57703374-57703396 CTTTCCCAGCGCTAAGTGAATGG + Intergenic
1041457459 8:58076201-58076223 CTTTGCAACGGCGAGGTGGAAGG - Intronic
1042135240 8:65626775-65626797 CTTTGGGAGGCCAAAGTGGAAGG + Intronic
1043705881 8:83349875-83349897 CTTTGGGAGGACCAGGTGGATGG - Intergenic
1044051838 8:87515318-87515340 CTATGCCAGGGCAGTGTGGAAGG + Intronic
1044078751 8:87858005-87858027 CTTTGGGAGGGCGAAGTGGGCGG - Intergenic
1044829691 8:96235212-96235234 CTTTTCTAAGGCCAAGGGGAAGG + Intronic
1045919320 8:107511260-107511282 CTCTGCCAGGGCAGTGTGGAAGG + Intergenic
1046051956 8:109033941-109033963 CTTTGTCAGGGCCAAGAGGGTGG - Intergenic
1046106946 8:109677889-109677911 CTTTGGCAGGGCGAGGTGGGTGG + Intronic
1046880185 8:119299107-119299129 CTCTGCTAGGGCAATGTGGAAGG - Intergenic
1047553250 8:125899835-125899857 CTTTGCCCTGGCCCAGTGTAAGG + Intergenic
1047615197 8:126557688-126557710 TTTTGCCAGGGCCAGGCGAAGGG - Intronic
1047649736 8:126907395-126907417 CTTTGCCAGCCCAGAGTGGAAGG + Intergenic
1047924527 8:129669747-129669769 CTCTGCTAGGGCAATGTGGAAGG + Intergenic
1048768285 8:137867860-137867882 CTCTGCTAGGGCAATGTGGAAGG + Intergenic
1049178773 8:141209730-141209752 CTGTGGCAAGGCCATGTGGAGGG + Intronic
1049329383 8:142042233-142042255 CTTTGCCATGGCCACGGGGTGGG + Intergenic
1049539834 8:143203342-143203364 CATTCCCAGGGCCCAGTGGTCGG + Intergenic
1050126095 9:2357653-2357675 CTTTGCTTTGGCCAAATGGAAGG - Intergenic
1050290617 9:4150411-4150433 CTATGCCAGGGCAAAGTCGCAGG + Intronic
1050531558 9:6594450-6594472 CTTTGAGAGGCCAAAGTGGACGG + Intronic
1050541744 9:6676299-6676321 CTTTGGGAGGGCCAGGTGGGTGG - Intergenic
1051602396 9:18888509-18888531 CTTTGCCAGGGCCAAATGAAAGG - Intronic
1051653343 9:19352888-19352910 CTTTGCGAGGCCCAGGTGGGAGG + Intronic
1052977610 9:34422920-34422942 CTTTGGAAGGCCGAAGTGGAAGG + Intronic
1053015114 9:34657428-34657450 CATGGCCAGGGCCCTGTGGATGG - Exonic
1053477782 9:38394533-38394555 CTTTGGTAGGCCGAAGTGGAAGG - Intronic
1053544280 9:39007178-39007200 CTTTGCGAGGACGAGGTGGAAGG - Intergenic
1053808709 9:41830672-41830694 CTTTGCGAGGACGAGGTGGAAGG - Intergenic
1054163231 9:61694432-61694454 CTTTGGGAGGGCAAGGTGGATGG + Intergenic
1054621883 9:67356756-67356778 CTTTGCGAGGACGAGGTGGAAGG + Intergenic
1054791143 9:69257992-69258014 CTTTGGGAGGCCAAAGTGGATGG - Intergenic
1055175560 9:73313852-73313874 CTCTGCTAGGGCAATGTGGAAGG - Intergenic
1055454654 9:76460838-76460860 CCTTTACAGGGCCAAGTTGAAGG - Intronic
1056340876 9:85630721-85630743 CTTTGTCAGGCCAAGGTGGATGG - Intronic
1056425592 9:86472587-86472609 CTTTGGGAGGCCAAAGTGGATGG - Intergenic
1056954603 9:91072191-91072213 CTCGGCCAGGGGCATGTGGAAGG - Intergenic
1057052780 9:91938213-91938235 CTTTGGGAGGCCAAAGTGGAGGG + Intronic
1057086347 9:92214310-92214332 CTTTGGGAGGCCCAAGTGGGTGG + Intronic
1057334265 9:94143567-94143589 CTTTGAGAGGCCAAAGTGGATGG + Intergenic
1058141188 9:101358136-101358158 CTCTGCTAGGGCAATGTGGAAGG - Intergenic
1058300347 9:103363871-103363893 CATTGCCAGGGACAAGCTGAAGG - Intergenic
1058649224 9:107159455-107159477 CTCTGCTAGGGCAATGTGGAAGG + Intergenic
1059041549 9:110820659-110820681 CTTTGCTGGGGGCAAGTGGAGGG + Intergenic
1059050372 9:110918161-110918183 CTTTGGGAGGCCAAAGTGGATGG - Intronic
1059447293 9:114346299-114346321 CTCGGCCAAGGACAAGTGGAGGG + Intronic
1060487550 9:124058252-124058274 CTTTGGGAGGCCGAAGTGGAAGG + Intergenic
1060588813 9:124803150-124803172 CTTTGGGAGGCCAAAGTGGATGG - Intronic
1060595729 9:124847533-124847555 CTTTGGGAGGCCAAAGTGGATGG - Intergenic
1060641975 9:125246472-125246494 CTTTGGGAGGGCGAGGTGGAAGG + Intergenic
1060998669 9:127889684-127889706 CTTTGGGAGGCCGAAGTGGACGG - Intronic
1061037490 9:128121667-128121689 CTTTGGGAGGCCAAAGTGGATGG + Intronic
1061114192 9:128598189-128598211 CTTTGGGAGGCCCAAGTGGGCGG - Intronic
1061278929 9:129586038-129586060 CTTTGCAAGGCCGAGGTGGACGG - Intergenic
1061303883 9:129721822-129721844 CTTTGGGAGGCCGAAGTGGACGG - Intronic
1061667124 9:132167068-132167090 GTTTGCCCAGGCCAAGTGGGAGG + Intronic
1062093029 9:134688534-134688556 CTTTGCTGGGGCCAGGTGGGAGG + Intronic
1062268973 9:135700141-135700163 CTTGGGCAGGGCCAGGTGAAGGG - Intergenic
1062288767 9:135785423-135785445 CTTTCCCAGGGCCCTGTGGGTGG - Intronic
1185797758 X:2981462-2981484 CTTTGCTAGGGCAGTGTGGAAGG + Intergenic
1186451177 X:9674821-9674843 CTTTGCAAGGTCGAGGTGGAAGG - Intronic
1187583657 X:20636432-20636454 CTGTGCAGGGGCCAAGTGGCAGG - Intergenic
1187961801 X:24573407-24573429 CTTTGGGAGGCCGAAGTGGATGG - Intronic
1188306780 X:28568815-28568837 CTTTGGGAGGTCGAAGTGGATGG + Intergenic
1188704800 X:33314499-33314521 CTTTGCGAGGCCAAGGTGGACGG - Intronic
1189040774 X:37540704-37540726 CTTTGGGAGGCCCAGGTGGATGG - Intronic
1189207609 X:39255383-39255405 CTTTGGGAGGACCAGGTGGAAGG + Intergenic
1189400972 X:40668137-40668159 CTTTGGGAGGGCGAAGTGGGCGG + Intronic
1189976346 X:46464234-46464256 CTTTGCCATGGGCCAGTGAAGGG - Intronic
1190454455 X:50613355-50613377 CTTTGCGAGGCCGAAGTGGGTGG - Intronic
1190729903 X:53218815-53218837 CTTTGGGAGGCCGAAGTGGATGG - Intronic
1190868801 X:54407570-54407592 CTTTGGGAGGCCAAAGTGGAAGG + Intergenic
1192118009 X:68429790-68429812 CTTTGGGAGGCCAAAGTGGATGG + Intronic
1192476578 X:71449231-71449253 CTTTGGGAGGCCCAGGTGGACGG - Intronic
1193121151 X:77824049-77824071 CTTTGGGAGGCCCAAGTGGGTGG - Intergenic
1193291296 X:79776504-79776526 CTTTGAAAGGGCTAAGTGGGCGG - Intergenic
1193459709 X:81775787-81775809 CTTTGCTAGGGCAGTGTGGAAGG - Intergenic
1193564119 X:83056378-83056400 CTCTACCAGGGCAATGTGGAGGG - Intergenic
1194321143 X:92447640-92447662 CTCTGCTAGGGCAATGTGGAAGG + Intronic
1194473985 X:94335736-94335758 CTCTGCTAGGGCAATGTGGAAGG + Intergenic
1194864929 X:99054019-99054041 CTCTGCTAGGGCCGTGTGGAAGG + Intergenic
1195672172 X:107479032-107479054 CTTGGCCACAGCCAAGTGGGGGG - Intergenic
1196636338 X:118007163-118007185 CTTTGGGAGGCCCAAGTGGGAGG + Intronic
1196808988 X:119613639-119613661 CTTTGGGAGGCCGAAGTGGAAGG + Intergenic
1197160545 X:123317875-123317897 CTCTGCCAGGGCAATGCGGAAGG - Intronic
1198195836 X:134360945-134360967 CTTTGAAAGGTCCAAGTGGGAGG + Intergenic
1198307045 X:135393685-135393707 CTTTGGCAGGGCGAGGTGGGCGG + Intergenic
1198464465 X:136892401-136892423 CTTTGGGAGGTCGAAGTGGACGG - Intergenic
1199508985 X:148598449-148598471 CTGTGCCATGGCCAGGTGGCAGG + Intronic
1200618054 Y:5405428-5405450 CTTTGGGAGGCCCAAGTGGGAGG - Intronic
1201421642 Y:13806018-13806040 CTTTGGGAGGCCAAAGTGGATGG - Intergenic
1202073855 Y:21018835-21018857 CTTTGGGAGGTCGAAGTGGATGG + Intergenic
1202078555 Y:21060689-21060711 CTTTGGGAGGTCGAAGTGGATGG + Intergenic