ID: 954325565

View in Genome Browser
Species Human (GRCh38)
Location 3:49861564-49861586
Sequence GTCCCTCAGGGCCACGGGGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 223}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954325565_954325585 22 Left 954325565 3:49861564-49861586 CCCTCCCCGTGGCCCTGAGGGAC 0: 1
1: 0
2: 1
3: 23
4: 223
Right 954325585 3:49861609-49861631 GGCAGAATCAGGGGTAGGGCAGG 0: 1
1: 0
2: 1
3: 50
4: 372
954325565_954325583 17 Left 954325565 3:49861564-49861586 CCCTCCCCGTGGCCCTGAGGGAC 0: 1
1: 0
2: 1
3: 23
4: 223
Right 954325583 3:49861604-49861626 GCGTGGGCAGAATCAGGGGTAGG 0: 1
1: 0
2: 1
3: 14
4: 225
954325565_954325575 1 Left 954325565 3:49861564-49861586 CCCTCCCCGTGGCCCTGAGGGAC 0: 1
1: 0
2: 1
3: 23
4: 223
Right 954325575 3:49861588-49861610 CCAGCCCCTGAGCCTGGCGTGGG 0: 1
1: 0
2: 6
3: 44
4: 390
954325565_954325584 18 Left 954325565 3:49861564-49861586 CCCTCCCCGTGGCCCTGAGGGAC 0: 1
1: 0
2: 1
3: 23
4: 223
Right 954325584 3:49861605-49861627 CGTGGGCAGAATCAGGGGTAGGG 0: 1
1: 0
2: 1
3: 20
4: 138
954325565_954325573 0 Left 954325565 3:49861564-49861586 CCCTCCCCGTGGCCCTGAGGGAC 0: 1
1: 0
2: 1
3: 23
4: 223
Right 954325573 3:49861587-49861609 ACCAGCCCCTGAGCCTGGCGTGG 0: 1
1: 0
2: 1
3: 38
4: 409
954325565_954325572 -5 Left 954325565 3:49861564-49861586 CCCTCCCCGTGGCCCTGAGGGAC 0: 1
1: 0
2: 1
3: 23
4: 223
Right 954325572 3:49861582-49861604 GGGACACCAGCCCCTGAGCCTGG 0: 1
1: 0
2: 1
3: 41
4: 397
954325565_954325579 11 Left 954325565 3:49861564-49861586 CCCTCCCCGTGGCCCTGAGGGAC 0: 1
1: 0
2: 1
3: 23
4: 223
Right 954325579 3:49861598-49861620 AGCCTGGCGTGGGCAGAATCAGG 0: 1
1: 0
2: 0
3: 15
4: 155
954325565_954325580 12 Left 954325565 3:49861564-49861586 CCCTCCCCGTGGCCCTGAGGGAC 0: 1
1: 0
2: 1
3: 23
4: 223
Right 954325580 3:49861599-49861621 GCCTGGCGTGGGCAGAATCAGGG 0: 1
1: 0
2: 0
3: 12
4: 180
954325565_954325582 13 Left 954325565 3:49861564-49861586 CCCTCCCCGTGGCCCTGAGGGAC 0: 1
1: 0
2: 1
3: 23
4: 223
Right 954325582 3:49861600-49861622 CCTGGCGTGGGCAGAATCAGGGG 0: 1
1: 0
2: 0
3: 11
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954325565 Original CRISPR GTCCCTCAGGGCCACGGGGA GGG (reversed) Exonic
900387210 1:2416173-2416195 GTCGCTCAGGACCCCGAGGAGGG + Intergenic
900526126 1:3129669-3129691 GGCCCTCAGTGCCACAGGTAGGG + Intronic
903068002 1:20711542-20711564 GTCCATCGCTGCCACGGGGAGGG + Intronic
903291263 1:22315690-22315712 GTCCCTGGGGGACACGTGGATGG + Intergenic
903478811 1:23638391-23638413 GCCTCTCAGGGCCACAGAGAAGG - Intronic
903967332 1:27099047-27099069 GTGCCCCAGGGACAAGGGGAAGG + Exonic
904504029 1:30936100-30936122 GGCCCTCAGGGACTCTGGGAAGG + Intronic
904505493 1:30949529-30949551 GGCCCTCAGGGACTCTGGGAAGG + Intronic
904675670 1:32197932-32197954 AGCCCTCAGGGCCACCGTGATGG - Exonic
905370796 1:37481843-37481865 GTCTGTCAGGGCCTCTGGGAGGG - Intronic
907291339 1:53414888-53414910 GTCCCTCCTGGCCACTGGCATGG - Intergenic
909958243 1:81802985-81803007 GACCCGGCGGGCCACGGGGAGGG + Intronic
912656281 1:111488843-111488865 GTCCCTCAGGGCCACATGATTGG + Exonic
912793449 1:112675126-112675148 GTCCCTCTGCGCCCCGGGGCGGG - Intronic
915622234 1:157092804-157092826 GTCCCTCAGGCCCGAGGGGCTGG - Exonic
916075019 1:161195671-161195693 GTCCCTCAGGGCATGGGGAAGGG - Intronic
916254416 1:162772049-162772071 CCCCCTCAGGGCCACTGGGCTGG - Exonic
917329728 1:173868611-173868633 CTCCCTCAGGACCCCGGGAAGGG + Intronic
1063382235 10:5592697-5592719 GCCCTTCAGGGCCACGGTGCAGG + Intergenic
1066201146 10:33143653-33143675 ATCCCTCAGGGCTGTGGGGAAGG + Intergenic
1069860633 10:71468959-71468981 CTCCCTCAGGCCCACAGAGAAGG - Intronic
1070642442 10:78179486-78179508 GACCCTCAGGGGCAAGGGCAGGG + Intergenic
1071531649 10:86394040-86394062 GTGCCGCTGGGGCACGGGGAGGG - Intergenic
1072286984 10:93925643-93925665 GCCACTCAGGGCCAAGGTGAAGG + Intronic
1073543986 10:104333972-104333994 GACCCTCAGGGCTGTGGGGAGGG - Intronic
1074542301 10:114374878-114374900 GTCCCTTAGGGCCACGGAACAGG + Intronic
1075144452 10:119872136-119872158 GGCCCGCAGAGCCGCGGGGAGGG - Intronic
1075324249 10:121517914-121517936 TTCCCACAGGGCCAGGAGGATGG - Intronic
1075611891 10:123861206-123861228 GGCTCTCAGGGCCAGGGGCAAGG + Intronic
1076052333 10:127345823-127345845 CTCCCTCAGGGCCCAGGGGAAGG + Intronic
1076095848 10:127734986-127735008 GACCCGCAGGGCCACCGGCATGG - Intergenic
1076401724 10:130189632-130189654 GTGCCCCAGGGCCCCGGGGAAGG - Intergenic
1077294750 11:1820944-1820966 GGCCCCCAGGGCCACATGGAGGG - Intergenic
1078895521 11:15593881-15593903 GTGCCACAGGGCCAGGGAGAGGG + Intergenic
1080412661 11:32040477-32040499 GCCCCTCAGGTGCAAGGGGAAGG + Intronic
1083255678 11:61494137-61494159 GTCCATAAGGGCCACGGCCATGG - Intergenic
1083615522 11:64024211-64024233 GTCCTTCAGGGCCATGGGAATGG - Intronic
1083624928 11:64067531-64067553 GTCCCTGAGCCCCAGGGGGAGGG - Intronic
1083716084 11:64577861-64577883 GTCCCTCATGGCCCTGAGGAAGG - Intergenic
1083782618 11:64925977-64925999 GACCAGCAGGGCCATGGGGAGGG + Intronic
1083935363 11:65867154-65867176 CTGCCTCACGGCCACGGGGCAGG - Intronic
1084589868 11:70084379-70084401 GGCCATCAGGGTGACGGGGATGG + Intronic
1084636914 11:70398808-70398830 GTCCGCGAGGGCCACGAGGACGG + Intronic
1084771603 11:71346058-71346080 GTCCCTCAGGGCCAGGGTGTAGG - Intergenic
1086912673 11:92491238-92491260 GTCCCTTAGGGACAGGAGGAAGG - Intronic
1089664514 11:120009650-120009672 CTGCCTCACAGCCACGGGGAGGG - Intergenic
1090434608 11:126676417-126676439 GTCCCCCAGGGCCACTGGGCTGG + Intronic
1091855728 12:3737764-3737786 CTCCCACAAGGCCACTGGGATGG + Intronic
1092644187 12:10551468-10551490 CTCCCTCCGAGCCACGGGGCAGG - Intergenic
1092945633 12:13451365-13451387 CTCCCTCAGGGCCAGGGCCAGGG - Intergenic
1097151167 12:56980992-56981014 GTCACTGAGGGCCACAGAGAGGG + Intergenic
1097187390 12:57203073-57203095 GGCCTTCAGAGACACGGGGATGG + Intronic
1101424574 12:104577101-104577123 GTCACTCAGGGCCAGGGCAAAGG + Intronic
1102071036 12:110019931-110019953 GTGCCTCTGGGCCACATGGAGGG + Intronic
1102347301 12:112168296-112168318 GTCCCTCTGGGCCAGGCTGAGGG + Intronic
1103852066 12:123939891-123939913 GTCCCACAGGCCCTGGGGGAAGG - Intronic
1104917381 12:132272867-132272889 GTGGCGCAGAGCCACGGGGAAGG - Intronic
1106881001 13:34130236-34130258 GTCCTTCGGGGCCACCTGGATGG - Intergenic
1106924603 13:34600792-34600814 ATCCCTCAGAGCCACTGTGAAGG + Intergenic
1107872688 13:44761684-44761706 CTCCCTCAAGGCCACAGGGCAGG - Intergenic
1112734409 13:102400722-102400744 GTCCCACAGGGCCAGGGGTGGGG - Intronic
1113767487 13:112890214-112890236 TTCCCCCAGGGCGACGGTGAGGG - Intergenic
1113885282 13:113655574-113655596 GCCGCCCATGGCCACGGGGACGG - Intronic
1114519509 14:23324382-23324404 GTTCCTGAAGACCACGGGGAGGG - Intronic
1114712369 14:24791697-24791719 GTCCCTGAGACCCACTGGGAAGG - Intergenic
1117808485 14:59519748-59519770 GTCACTCAGGTGCAAGGGGAGGG - Intronic
1119027452 14:71165422-71165444 CTCCCTCAGGGCCACCAGGAAGG + Intergenic
1120387854 14:83868173-83868195 GACCCTCAGGTCTATGGGGATGG - Intergenic
1121305923 14:92906829-92906851 GCCTCTCAAGGACACGGGGACGG + Intergenic
1122207886 14:100157244-100157266 CTACCTCAGGGCCACCTGGAGGG - Intronic
1122317772 14:100835906-100835928 GACTCTCAGGGCCACGGCGGAGG - Intergenic
1122423622 14:101592624-101592646 CTCCATGAGGGCCAGGGGGATGG - Intergenic
1124949024 15:34299089-34299111 GTCCCTCAAAGCAAAGGGGAAGG + Intronic
1125730890 15:41892318-41892340 GACCCTCATGGCCAGGGTGAGGG - Intronic
1129301104 15:74626066-74626088 GTCCCTCAGGCCCAGGAGAATGG - Intronic
1129678301 15:77644011-77644033 ATCCATCAGAGCCACGGGGCAGG + Intronic
1130347032 15:83057040-83057062 GTCCCTCATGGCCAAAGAGAGGG + Intronic
1131025832 15:89140862-89140884 CTCCCTCAGTGCCACGAAGATGG - Intronic
1132550628 16:552555-552577 ATGCCCCAGGCCCACGGGGAGGG + Intronic
1132581773 16:688080-688102 CTCCCACAGGGCCACGGGAGTGG - Intronic
1132722656 16:1324411-1324433 GTCCCGCAGGGCTGCGAGGAGGG - Intronic
1132883840 16:2173768-2173790 GTCCTGCAGGGCCAAGGGCAGGG - Exonic
1133609510 16:7419622-7419644 GTCCCTGAGGGCTGCGGAGAGGG - Intronic
1133786175 16:8975179-8975201 GCACCTCAGGGCCTTGGGGAGGG + Intergenic
1134993833 16:18723766-18723788 ATACCTCAGAGCCACGTGGAGGG - Intergenic
1135239969 16:20795981-20796003 GTTCCTCAGGGCCATGGAAATGG + Intronic
1135669419 16:24362275-24362297 CTCCCTCAGGGCCACCTGGGCGG - Exonic
1136045234 16:27610080-27610102 GGACCTCATGGCCACTGGGATGG + Intronic
1136567772 16:31080331-31080353 GTCCTTCAGGGCCATGCGGTTGG - Exonic
1136568894 16:31085197-31085219 GCCTCCCAGGGCCATGGGGAGGG + Exonic
1136775378 16:32868967-32868989 GTCACACAGGGCCTGGGGGAAGG - Intergenic
1136895238 16:33992545-33992567 GTCACACAGGGCCTGGGGGAAGG + Intergenic
1137597530 16:49734663-49734685 CTCCCTCAGGGCCATGTGCATGG + Intronic
1137627851 16:49920925-49920947 GTCCCTGGGGGCTGCGGGGAAGG - Intergenic
1137674713 16:50298655-50298677 GTTCCTAAGGGCCTCGGGGAGGG - Intronic
1137701934 16:50503682-50503704 ATCCCACAGGGCCCCAGGGAGGG + Intergenic
1141044653 16:80705269-80705291 GTCCCTCAGGGTCAGGTGGCTGG + Intronic
1141442151 16:84036593-84036615 GTCCCTCAGGGCCCAGGCCAGGG + Intronic
1203077795 16_KI270728v1_random:1131076-1131098 GTCACACAGGGCCTGGGGGAAGG - Intergenic
1142598260 17:1040010-1040032 CTCCCTCAGGGCCAGGGGCCCGG + Intronic
1143102518 17:4512295-4512317 GACCCTGAGGCCCACGGGGATGG + Intronic
1143106652 17:4533610-4533632 GTGCCTCAGGGCCGTGGGCATGG + Intronic
1143311730 17:5997577-5997599 GTGCCTCTGGGCCTCAGGGATGG + Intronic
1147191714 17:38741827-38741849 GTCCATCAGGGACACTGGCAGGG - Intronic
1147228132 17:38996643-38996665 GACCCCCAGGGCCACAGGGTAGG - Intergenic
1149030016 17:52072083-52072105 TGCCCTCAGGGGCAGGGGGATGG - Intronic
1151559703 17:74863731-74863753 TTCTCTCAGGGCCAAGAGGAGGG + Intronic
1152184367 17:78844794-78844816 GTGCCACAGGGCCACAGGAAGGG - Intergenic
1153606230 18:6836254-6836276 GTCTCTCAGGGCCAATGGGAAGG + Intronic
1156360548 18:36380952-36380974 TTTCCTCATGGCCACGGGGCTGG + Intronic
1157815916 18:50729497-50729519 GCCCCCCACGGCCACGGGGCTGG + Exonic
1158718434 18:59900546-59900568 GTTCCTCGTGGCCCCGGGGAAGG - Intronic
1159805467 18:72952470-72952492 ATCCCTCAGGGCCATGCTGAGGG + Intergenic
1160021724 18:75186644-75186666 GCCCCTCTGGGCAGCGGGGAAGG - Intergenic
1160820149 19:1054117-1054139 GGACCCCAGGGCCACTGGGAAGG - Intronic
1160874409 19:1290504-1290526 GTCCCTCGGGGTCACGGCGGAGG + Intronic
1161196027 19:2987245-2987267 GTCCCTGAGGGTGAGGGGGAAGG + Intronic
1161237274 19:3204313-3204335 GCCCCTCAGAGCCCCGGGGTTGG - Intronic
1161307061 19:3574056-3574078 GGCCCACAGGACCAAGGGGAGGG - Intronic
1162019966 19:7863873-7863895 GCTCCTCAGGGCCCCGGGGCAGG + Intronic
1162329218 19:10017129-10017151 GTCCAGCTGGGCCACGGTGAGGG - Exonic
1163035020 19:14565088-14565110 GTCCCGCAGGGCCATGTGGATGG - Exonic
1163574770 19:18104250-18104272 GACCCTAATGGCCACGGTGATGG + Intronic
1163587731 19:18173204-18173226 GTCCCACGGGACCACGGTGAGGG + Intronic
1164583295 19:29448568-29448590 GTCACTCATGACCACGAGGAGGG - Intergenic
1165161703 19:33820426-33820448 TCCCCGCAGGGCCAAGGGGAGGG + Intergenic
1167641969 19:50687122-50687144 CTCCCTCGGGGCCCCGGGGTGGG + Intronic
927853887 2:26516160-26516182 CTCCCTCAGGGCCACTGGGGAGG + Intronic
928361412 2:30665011-30665033 GTCCTTCAGGGGCACGGCGATGG + Intergenic
928615427 2:33033987-33034009 GTCCCCCAGGGAGCCGGGGAGGG - Intronic
929158777 2:38811311-38811333 GTCCCACAGTGCCATGGGAAAGG - Intronic
931391653 2:61849815-61849837 GTCCTTCACAGCCACGTGGATGG + Intronic
932812297 2:74835128-74835150 CCCCCGCAGGGCCGCGGGGAAGG - Intronic
936071389 2:109374069-109374091 CTCCCTCAGGGCCATGAGGAGGG + Intronic
936330852 2:111547058-111547080 GCCTCTCACGGCAACGGGGAGGG + Intergenic
937246893 2:120499384-120499406 GTTCCTCATAGCCACGGGCAAGG + Intergenic
937438277 2:121896903-121896925 GTCCTTCAGTGCCTCAGGGAAGG - Intergenic
937900650 2:127016600-127016622 CTCGCTCAGGGCCACGTGGGAGG - Intergenic
940849381 2:158673559-158673581 CGCTCTCAGGGCCACAGGGATGG - Intronic
941125863 2:161582163-161582185 CTCTCTCAGGGCCAAGGTGATGG + Intronic
942454858 2:176130586-176130608 GTCCCGGAGGGCGGCGGGGACGG - Exonic
942463947 2:176188922-176188944 TTCCCTCTGGGCAACGGCGACGG + Exonic
943645890 2:190408059-190408081 GTCCCTCCGGGCCGCCGGGGCGG + Intergenic
947793164 2:232879161-232879183 GTCCCTGGGGGCCAGGGGCATGG + Exonic
948459858 2:238123863-238123885 ACCCCACTGGGCCACGGGGAAGG - Intronic
948941803 2:241200527-241200549 GTCTCTCAGGGCCCGGGCGATGG + Intronic
1169811325 20:9612045-9612067 GTGCCTCAGGGGCATGGGGGTGG - Intronic
1170718929 20:18858262-18858284 CTCACTCATTGCCACGGGGATGG - Intergenic
1172612200 20:36260543-36260565 GTCCCTGAGTGCCACAGGCATGG - Intronic
1173161563 20:40656500-40656522 GTCCCTCTGGTTCACGGGGAGGG - Intergenic
1174069057 20:47887327-47887349 GTCCCTCAGGTGCACTGGGGCGG - Intergenic
1174209299 20:48864821-48864843 GTCCCTGTGGACCAGGGGGAAGG + Intergenic
1174292693 20:49520092-49520114 GTCCCTGTAGGCCATGGGGAGGG - Intronic
1175957498 20:62618811-62618833 TCCCCTCAGAGCCCCGGGGAGGG - Intergenic
1176215388 20:63945360-63945382 GTCCGTCAGGACCACGGCAAGGG + Intronic
1177858510 21:26425933-26425955 GCCTCTCAGGGCCAATGGGAAGG - Intergenic
1179266151 21:39805462-39805484 GTTCCTCAGGCCCACAGGCATGG - Intergenic
1179270663 21:39848098-39848120 GTCCCTCAAGGCCACAGGGTAGG - Intergenic
1180075536 21:45459678-45459700 GTCCCTCAGGTCCACGAGGAAGG + Intronic
1180177655 21:46098262-46098284 GTCCCTCGGGTCCCCGGGAAGGG + Intronic
1180189285 21:46154896-46154918 GGCCCTAAGGGCCACCTGGAAGG - Intronic
1180875574 22:19173722-19173744 GTCCCTTGGGGCCACGAGCATGG - Intergenic
1181514667 22:23403756-23403778 GTCCCTCAGGGCCACCTCCATGG - Intergenic
1181917605 22:26293021-26293043 GTCCATCAGGGCCATGGGGCTGG - Exonic
1182856491 22:33522049-33522071 GTCACTCATTACCACGGGGATGG + Intronic
1183333888 22:37235835-37235857 GAATCTCAGGGCCACGGTGATGG + Intronic
1183924752 22:41197678-41197700 GCCCCACAGGGACACCGGGAAGG - Intergenic
1184656803 22:45946033-45946055 GTCCCCCAGGACCACGGGCCTGG - Intronic
1185067438 22:48639237-48639259 GACCCACAGTGCCACTGGGAAGG - Intronic
1185345402 22:50308434-50308456 GTCCTTCAGGGCCAGGAGGTGGG + Intergenic
949611444 3:5707770-5707792 GTCCCTCAAGGGGAAGGGGAAGG - Intergenic
950146288 3:10652206-10652228 CTCCCTCTGGGCCACGTGGTGGG - Intronic
950264352 3:11563247-11563269 GTCCCTGAAGGACACGGGTATGG - Intronic
952132633 3:30383292-30383314 GTCCTGCAGAGCCACAGGGATGG - Intergenic
954135415 3:48580034-48580056 GTCCCCCAGGACCCCCGGGACGG - Exonic
954325565 3:49861564-49861586 GTCCCTCAGGGCCACGGGGAGGG - Exonic
955820059 3:62887321-62887343 GTCCCTCAGGCCACCAGGGATGG - Intergenic
961662184 3:128475321-128475343 GGCCCTCAGGGCCACAGAAATGG - Intergenic
963259418 3:143177624-143177646 GCCCCTCAGGGTCACAGGGGTGG + Intergenic
966832069 3:184018105-184018127 GTCTCGCAGAGGCACGGGGAAGG - Intergenic
969300269 4:6293314-6293336 GTCCCTGAGGGCCTGGCGGAGGG - Intronic
969398868 4:6940426-6940448 CGCCCTCAGGGCTCCGGGGAAGG + Intronic
969465888 4:7356148-7356170 GGCCCTGAGGGCCAGGGGGCAGG - Intronic
969647548 4:8441169-8441191 GTCCCTCAGGGGCACTGAGGCGG - Exonic
969668474 4:8575755-8575777 GTCCCTCAGTGCCATGGAGCTGG - Intronic
973792968 4:54395170-54395192 GTGCCTCAGAGCCATGGGTAAGG + Intergenic
974345863 4:60680204-60680226 GTACCTCTGGACCACTGGGATGG - Intergenic
976602388 4:86949942-86949964 GTCCCGCAGGGCCATGTGGATGG + Intronic
979765826 4:124463139-124463161 GTCCCACAGGGCCATGTGGATGG + Intergenic
981778092 4:148393600-148393622 GCTCCTCAGGGACACAGGGATGG + Intronic
984668052 4:182449047-182449069 GTTCCTCACGGCCACAGCGAGGG + Intronic
985527575 5:415016-415038 GACCCTCAGTGGCACGGGGTGGG + Intronic
985643439 5:1074253-1074275 GCCCCTCAGGGCCTCGGCGGGGG - Intronic
986179001 5:5376154-5376176 GGCCATCAGGGCCAGGTGGAAGG + Intergenic
989131537 5:38111989-38112011 GTCCCTTAGGGCCACTTGGAGGG + Intergenic
989692775 5:44165016-44165038 GTCCTTCAGAGCAACGTGGATGG - Intergenic
990302136 5:54459830-54459852 GTCCCCCAGGTCCAAAGGGATGG + Intergenic
996667508 5:126077016-126077038 GTAACTCATGGCCACAGGGAAGG + Intergenic
999990674 5:157047207-157047229 ATCCCCCAGGGGCACAGGGAAGG - Intronic
1001975627 5:175996388-175996410 GAGGCTCAGGGCCATGGGGATGG - Intronic
1002176125 5:177402503-177402525 GTGCCTGACGGCCTCGGGGAAGG + Intronic
1002241802 5:177847384-177847406 GAGGCTCAGGGCCATGGGGATGG + Intergenic
1002419802 5:179139608-179139630 GTCTCTCCTGGCCACGGGCATGG - Intronic
1002925716 6:1604813-1604835 GGCCCTCAGGTCCTCGGGGGAGG + Intergenic
1004426626 6:15511209-15511231 GTCCCTGAGGGTGACGGGGGTGG + Intronic
1005851962 6:29828918-29828940 CTCCCTCAGGACCAGAGGGAGGG - Intronic
1005865716 6:29934385-29934407 CTCCCTCAGGACCAGAGGGAGGG - Intergenic
1005866914 6:29943643-29943665 CTCCCTCAGGACCAGAGGGAGGG - Intronic
1006114388 6:31767490-31767512 GTCTCCCAGGGCCAGGAGGAAGG - Exonic
1006186855 6:32186355-32186377 GCCCCTCAGGGTCACAGGGGTGG - Exonic
1011079809 6:83477191-83477213 GTTCCTCAGGGCCAGCGGCATGG - Intergenic
1017352587 6:153459408-153459430 GTGCCTCAGTCCCACAGGGAAGG + Intergenic
1017737234 6:157376289-157376311 GTCTCTCAGGGAAATGGGGATGG - Intergenic
1018987527 6:168649110-168649132 TCCTCTGAGGGCCACGGGGAAGG + Intronic
1020261204 7:6531586-6531608 GTCCCTCCCGACCCCGGGGAGGG - Intronic
1024063417 7:45715185-45715207 GTCCAGGAGGGCCACTGGGAAGG + Exonic
1025007464 7:55365691-55365713 GGCTCTGCGGGCCACGGGGAAGG + Exonic
1026604147 7:71801601-71801623 GTCTCTCAGGGCCATGCAGAGGG + Intronic
1027225776 7:76242996-76243018 CTCACTCATGGCCATGGGGAGGG + Intronic
1029390771 7:100272393-100272415 CACCCTCAGGACCACGGGGAAGG + Intergenic
1031887062 7:127253693-127253715 GTCCCTCAGACCCTCGGGGGCGG - Intergenic
1032089622 7:128904686-128904708 CTGCCCCAGGGCCACGGGGTTGG - Intronic
1034358587 7:150474003-150474025 GTCCCACAGGCCCAAGGGAAAGG + Exonic
1036176308 8:6541346-6541368 GTAACTCGGGGCCACGTGGAAGG + Intronic
1038679307 8:29652267-29652289 GTATCTCTGGGCCACGGGCAGGG - Intergenic
1043997536 8:86836918-86836940 GTCCTTCAGGACCATGGAGAGGG - Intergenic
1049256039 8:141614411-141614433 GTCACCCTGGGCCCCGGGGAGGG - Intergenic
1049541370 8:143210664-143210686 GTCCCCCAGGGCCAGGGCTAAGG - Intergenic
1049554650 8:143275835-143275857 GTCCCTCCGTGCCACGGTGGGGG + Intronic
1053149297 9:35732546-35732568 GTCCCACAGTGCCACGGGGTGGG + Exonic
1053850551 9:42286361-42286383 GTTCCTCATGGACACAGGGAGGG + Intergenic
1055550411 9:77427767-77427789 CTCCCTCAGGGCAGCTGGGATGG - Intronic
1055626053 9:78178603-78178625 GTCCCACGGTGCCACGGGAAAGG + Intergenic
1057198457 9:93127856-93127878 GTGCCGCAGGGCCACAGGGAGGG + Intronic
1058441981 9:105017841-105017863 GTCCCTCAGGGCCTCTAGAAAGG - Intergenic
1059751244 9:117249616-117249638 GTGCCTCAAGACCAGGGGGAAGG - Intronic
1060741896 9:126104245-126104267 GTCCCCCAGGGCCCAGGGGCTGG - Intergenic
1061367692 9:130181137-130181159 GTACGTCAGGGCCCCAGGGACGG + Intronic
1061881433 9:133571122-133571144 GTGCCTCAGGGCCTCAGGGTGGG - Intronic
1062343027 9:136102176-136102198 GTCCCTCTGGGCTACGTGGGCGG + Intergenic
1062460937 9:136662323-136662345 GTCCCTGAGGCCCATGGTGAGGG - Intronic
1062601312 9:137319817-137319839 GTCCCTCAGGGCCAGTGCGATGG - Intronic
1062623622 9:137433505-137433527 TGCCCTCAGGGCCACTGTGAAGG - Exonic
1062682386 9:137788757-137788779 GTCCGTCAGAGCCTCGCGGAGGG + Intronic
1203772988 EBV:58868-58890 GCCCCTCAGGACCACGGAGCTGG + Intergenic
1196434822 X:115665236-115665258 GTCCCACAGCGCCACAGGAAAGG + Intergenic
1200055224 X:153456707-153456729 GGCCCTCAGCCCCACAGGGAAGG + Intronic
1200104540 X:153705090-153705112 GTCACACAGGGCCTGGGGGAAGG + Intronic