ID: 954327473

View in Genome Browser
Species Human (GRCh38)
Location 3:49871283-49871305
Sequence GACCCACCCCACCACTGGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 190}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954327467_954327473 6 Left 954327467 3:49871254-49871276 CCTGGGCTCTGAGTGGTCTCGGG 0: 1
1: 0
2: 0
3: 15
4: 168
Right 954327473 3:49871283-49871305 GACCCACCCCACCACTGGGTAGG 0: 1
1: 0
2: 0
3: 9
4: 190
954327465_954327473 7 Left 954327465 3:49871253-49871275 CCCTGGGCTCTGAGTGGTCTCGG 0: 1
1: 0
2: 0
3: 11
4: 162
Right 954327473 3:49871283-49871305 GACCCACCCCACCACTGGGTAGG 0: 1
1: 0
2: 0
3: 9
4: 190
954327463_954327473 20 Left 954327463 3:49871240-49871262 CCACTTCTGGGGTCCCTGGGCTC 0: 1
1: 0
2: 7
3: 42
4: 377
Right 954327473 3:49871283-49871305 GACCCACCCCACCACTGGGTAGG 0: 1
1: 0
2: 0
3: 9
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954327473 Original CRISPR GACCCACCCCACCACTGGGT AGG Intergenic
901441500 1:9281078-9281100 GACCCGCAGCACCACTTGGTGGG + Intergenic
902660194 1:17895645-17895667 GACCCTCCCCACCACAGGAGTGG - Intergenic
902747006 1:18481111-18481133 TTCCCACCCCACCGCTGGGCTGG - Exonic
907509177 1:54945723-54945745 GCCCCACCCCACCCCTCTGTGGG - Intergenic
908048620 1:60201967-60201989 CCCCAATCCCACCACTGGGTTGG - Intergenic
908052638 1:60249207-60249229 GACCCACCCTCACTCTGGGTGGG + Intergenic
908351005 1:63286370-63286392 GGCCCACCCCAGCACCAGGTTGG + Intergenic
908768250 1:67572966-67572988 GACCCAACCCCCCACTGGCATGG - Intergenic
909873668 1:80777974-80777996 GACCCACACCAGTCCTGGGTAGG - Intergenic
910370971 1:86514641-86514663 GACCCACCCTAAATCTGGGTGGG + Intergenic
911727603 1:101258314-101258336 GACCAAGCCCACCCCTAGGTAGG - Intergenic
912119806 1:106456134-106456156 GACCCACCCTCACTCTGGGTGGG - Intergenic
914464576 1:147915025-147915047 GCTCCAACACACCACTGGGTGGG + Intergenic
915071530 1:153272735-153272757 GGCCCACCCCAGCACCAGGTTGG - Intergenic
916791575 1:168129816-168129838 TGCCCACCCCAGCCCTGGGTTGG - Intronic
922057025 1:222051133-222051155 GACCCACCCTCCATCTGGGTGGG + Intergenic
922365574 1:224860394-224860416 GACCCACCCTCCATCTGGGTGGG - Intergenic
1063455220 10:6178273-6178295 CACCCACCTGACCACTGTGTGGG + Intronic
1064100457 10:12459259-12459281 GCCCCAGCCCACTACTGTGTTGG + Intronic
1065226836 10:23552231-23552253 GACCCACCCTCCATCTGGGTGGG + Intergenic
1067538563 10:47135361-47135383 GACTCACCACCCCAGTGGGTAGG - Intergenic
1067877842 10:50020460-50020482 GAGCCACCCCGGCACTGGGGTGG - Intergenic
1069371940 10:67757467-67757489 GACCCACCCTCACTCTGGGTGGG + Intergenic
1069788230 10:71003438-71003460 GACCCACCCCCAGTCTGGGTGGG - Intergenic
1070315815 10:75311294-75311316 GACCCACCCCCAAACTGGGTGGG - Intergenic
1074974144 10:118566765-118566787 CAGCCACCCCACCACAGGGCAGG - Intergenic
1075091023 10:119444306-119444328 GACCCACCCAAAAGCTGGGTGGG + Intronic
1075361361 10:121838221-121838243 CCCCCACCCCAGCAGTGGGTTGG + Intronic
1075712593 10:124538528-124538550 GGTCCACCCCACCACTTGGGGGG - Intronic
1076329691 10:129655154-129655176 GTCCCACCCCTACACTGGCTGGG - Intronic
1077302530 11:1853921-1853943 CACCCACCCCAGCACAGGGCTGG - Intronic
1077310762 11:1888133-1888155 CACCCATCACACCACAGGGTGGG + Intronic
1077487124 11:2844148-2844170 GTCCCACCCCACCACTCTGCGGG - Intronic
1079871332 11:25801722-25801744 GACCCACCCCCAACCTGGGTGGG - Intergenic
1084601200 11:70146928-70146950 GACCCACCCTTCATCTGGGTGGG - Intronic
1086947175 11:92854399-92854421 GCCCCACCCCCCTACTGAGTTGG - Intronic
1086981207 11:93199227-93199249 GATCCACCCCAACACAGGTTAGG - Intergenic
1088916616 11:114232585-114232607 AACCCAGCCCAACCCTGGGTGGG - Intronic
1089200443 11:116721565-116721587 GACCCACCCTTCATCTGGGTGGG - Intergenic
1092751749 12:11725698-11725720 CACTCACCCCACCACAGGGAGGG - Intronic
1096243947 12:49974101-49974123 CTCCCACCCCACCAGTGGGTTGG - Intronic
1096406259 12:51346335-51346357 GACCCACCCCACTACCAGATGGG + Intronic
1097603375 12:61722454-61722476 GACCCACTTCACAACTGTGTTGG - Intronic
1098175134 12:67782223-67782245 GACCCACCCTTCATCTGGGTGGG + Intergenic
1103325402 12:120116843-120116865 GCCCCGCCCCACCACTGCGCAGG + Intronic
1110378260 13:74819493-74819515 GACCCACCCTTAAACTGGGTGGG + Intergenic
1110575101 13:77046894-77046916 TGCCCACCCCACCAGTGGGTGGG + Intronic
1111346743 13:86966913-86966935 GACCCACCCTTCATCTGGGTGGG + Intergenic
1112524691 13:100133768-100133790 GACCCACCCCCAATCTGGGTGGG + Intronic
1114239759 14:20855687-20855709 AACCTACTCCCCCACTGGGTTGG - Intergenic
1115014241 14:28590664-28590686 GACCCACCCTCAAACTGGGTGGG + Intergenic
1116122704 14:40741107-40741129 GACCCACCCCTAATCTGGGTGGG - Intergenic
1116593866 14:46815008-46815030 CAGCAACCCCACTACTGGGTAGG + Intergenic
1119536791 14:75409305-75409327 CCCCCACTCCACCACTTGGTAGG - Intergenic
1121183599 14:91947752-91947774 GCCCCGCCCCGCCCCTGGGTGGG - Exonic
1122765799 14:104068993-104069015 GACCCACCCTCCATCTGGGTGGG + Intergenic
1123719261 15:23048232-23048254 GCCCCACAGCACCACTGGCTAGG - Intergenic
1129395913 15:75246190-75246212 GAGCCACTCCAGCACTGTGTTGG - Intergenic
1129405629 15:75315335-75315357 GAGCCACTCCAGCACTGTGTTGG - Intergenic
1131275792 15:90979594-90979616 GATCCACCCCTCTACTGGCTGGG - Intronic
1133648575 16:7787886-7787908 GACCCACCCTTACTCTGGGTGGG + Intergenic
1136134912 16:28249873-28249895 GACCCACCCTCCATCTGGGTGGG + Intergenic
1136928193 16:34394790-34394812 GACCCACCCCTAATCTGGGTGGG - Intergenic
1136976381 16:35017014-35017036 GACCCACCCCTAATCTGGGTGGG + Intergenic
1138821640 16:60267274-60267296 CATCCAGCCCACCATTGGGTGGG + Intergenic
1138907073 16:61349739-61349761 GACCCACCCTCAAACTGGGTGGG - Intergenic
1142677292 17:1521711-1521733 GCCCCACCCCACCTATGGGCAGG - Intronic
1143324782 17:6091710-6091732 GACCACCCCCACCACTGGCAAGG + Intronic
1144714047 17:17422038-17422060 GACCCTGCCCACCACATGGTGGG + Intergenic
1144735661 17:17553954-17553976 CCCCCACCCCACCCCTGGCTGGG - Intronic
1145005945 17:19337853-19337875 CACCCACCCCACATCTGGATGGG - Intronic
1146526593 17:33572301-33572323 CACCCCCCCCACCCCAGGGTAGG + Intronic
1146616450 17:34360694-34360716 CACCCAAGCCACCACTGGGTGGG + Intronic
1147139816 17:38454540-38454562 GACCCACCCCACCCCTGGTAGGG + Intronic
1147317048 17:39626078-39626100 AACCCACCCCAACTCTGGGCCGG + Intergenic
1147782997 17:42957083-42957105 GGCCCATCCCAGCACTGGGAGGG - Intronic
1151134070 17:71928135-71928157 GACCCACCCTTACTCTGGGTGGG + Intergenic
1151732434 17:75919486-75919508 GACCCATCACACCCATGGGTGGG - Intronic
1152398952 17:80052435-80052457 GACCCACCCCCAATCTGGGTGGG - Intronic
1153475677 18:5495988-5496010 GACCTCTCCCACCACTGTGTGGG + Intronic
1161039165 19:2100823-2100845 GACCGAGGCCACCACGGGGTGGG + Intergenic
1161362542 19:3859082-3859104 GACCCACCCTCACTCTGGGTGGG + Intronic
1162456582 19:10788631-10788653 GATCCACCCCATGACTTGGTTGG + Intronic
1162909114 19:13840024-13840046 CCCCCACCCCAGCCCTGGGTGGG - Intergenic
1163721610 19:18900545-18900567 GTCCCACCCCACCTCTGAGGAGG - Intronic
1165090797 19:33387556-33387578 GGCCCACCCCACCATGGGATGGG + Intronic
1165511312 19:36268221-36268243 CCCCCACCCCGCCACGGGGTAGG - Intergenic
1166702531 19:44890667-44890689 CCCCCACCCCACCTCTGGTTCGG - Intronic
1166921704 19:46232901-46232923 GACCCACCCCACCCACGGGGTGG + Intergenic
1167481429 19:49734156-49734178 GACTCACCCCAGCTCTGGGAAGG - Intergenic
1167605522 19:50479842-50479864 GACCCACTCCATCGCTGGGCTGG + Intronic
1168124836 19:54277562-54277584 GCCCCTCACCCCCACTGGGTCGG - Exonic
1168676180 19:58279380-58279402 GACCGACCCCAGCCCTGGGGAGG - Exonic
925152163 2:1622465-1622487 CACCCACCCAACCCCTGGTTAGG - Intergenic
925487597 2:4353227-4353249 GACCCACCCAAAATCTGGGTGGG + Intergenic
925509804 2:4612857-4612879 GACCCACCCTCGAACTGGGTGGG - Intergenic
926446825 2:12953013-12953035 GCCCCATGCCTCCACTGGGTGGG + Intergenic
927643925 2:24863233-24863255 GACCCACCCTAAATCTGGGTGGG + Intronic
930032959 2:47069513-47069535 ATCCCACCCCAGCACTGGGTGGG + Intronic
940452207 2:153853238-153853260 GACCCACCCCCAATCTGGGTGGG - Intergenic
944845997 2:203668311-203668333 GACCCACCCCTAATCTGGGTGGG + Intergenic
946901500 2:224377319-224377341 GACCCACCCCCAGTCTGGGTGGG + Intergenic
947955274 2:234184509-234184531 CATCCAGCCCACCACTGGGGAGG - Intergenic
948526591 2:238574598-238574620 GAGGCACCTCACCTCTGGGTGGG - Intergenic
1170964253 20:21052440-21052462 AGCCCACCCCAGCACTGGGCTGG + Intergenic
1171018102 20:21560146-21560168 GACCCACCTCCCCACTGAATAGG - Intergenic
1171170499 20:23011372-23011394 AACCCACCTCACCATGGGGTGGG + Intergenic
1171285034 20:23929996-23930018 GAAACACCCCACCCTTGGGTTGG - Intergenic
1171343763 20:24450487-24450509 GACACACCCCACCAGTGGAAAGG - Intergenic
1175606693 20:60317112-60317134 CACCCACCCCACCCCTAAGTTGG + Intergenic
1175900209 20:62357072-62357094 CACCCACCTCACCATGGGGTGGG + Intronic
1178804298 21:35825635-35825657 GACCCACCCCCAATCTGGGTAGG + Intronic
1180241530 21:46510313-46510335 GACCCACCCTAAATCTGGGTGGG - Intronic
1180636199 22:17264795-17264817 GACCCAGCTCACCTCTGGCTGGG - Intergenic
1180916565 22:19492950-19492972 TCCACACCCCACCTCTGGGTGGG - Intronic
1181167057 22:20989514-20989536 GCCCCACCCCCACACAGGGTAGG - Intronic
1181583260 22:23839310-23839332 GACCCACGACACCACGGGGGCGG + Intergenic
1183692715 22:39399933-39399955 GACACACCCCACCACGGAGAGGG - Intronic
1184531834 22:45061324-45061346 GGCCCACTCCACCACTCGCTGGG + Intergenic
1185319989 22:50196224-50196246 GACCCACTCCACCTCTGGAGGGG - Intronic
949568998 3:5273730-5273752 GACCCACCCCCGATCTGGGTGGG + Intergenic
954327473 3:49871283-49871305 GACCCACCCCACCACTGGGTAGG + Intergenic
954377941 3:50204827-50204849 CCCCCACCCCACCCCTGGTTGGG + Intergenic
954664332 3:52243834-52243856 TCCCCAACCCACCCCTGGGTGGG - Intergenic
960021308 3:112956948-112956970 GACTCACCCCAGCACGAGGTGGG - Intronic
960137197 3:114117956-114117978 GAGCCACTCCACCACTGTGATGG + Intergenic
961149340 3:124623667-124623689 GACCCACCCTTACTCTGGGTGGG - Intronic
961360664 3:126365207-126365229 GACCCACTCCTCCACTGCCTGGG - Intergenic
962836996 3:139198419-139198441 GATCCAGCACACCACTGGGGCGG + Intronic
963355338 3:144204375-144204397 GACCCACCCTTCATCTGGGTGGG - Intergenic
963378315 3:144497717-144497739 GACCCTGCCCTCCACTGGGGAGG - Intergenic
966221571 3:177556825-177556847 GACCCACCCCCAATCTGGGTGGG + Intergenic
967277270 3:187788622-187788644 GCTCCAGCACACCACTGGGTAGG - Intergenic
968745656 4:2358639-2358661 GGCCCACCCCACCAGTGAGCAGG - Intronic
969076552 4:4583459-4583481 GACCCACCCTCACTCTGGGTGGG + Intergenic
969292257 4:6247552-6247574 GACCCACCCTTCATCTGGGTAGG - Intergenic
969389151 4:6877742-6877764 GACCCACCCTTCATCTGGGTGGG - Intronic
969431083 4:7154672-7154694 TAACCACCCCACCCCTGGGGAGG - Intergenic
969474315 4:7412672-7412694 GCCCCTCCCCACCCCTGGGGCGG + Intronic
970372265 4:15419900-15419922 AAACCACCCCACCACTGGCAAGG - Intronic
970733891 4:19142753-19142775 GACCCACCCTAAGTCTGGGTGGG + Intergenic
970858281 4:20673434-20673456 GACCCACCCTTAAACTGGGTGGG + Intergenic
977514567 4:98005234-98005256 GACCCACCCCTAATCTGGGTGGG - Intronic
986427761 5:7651606-7651628 GACCCACCCTCCATCTGGGTGGG - Intronic
986639457 5:9858026-9858048 GACCACCCCCAGCACTGGGATGG - Intergenic
987521799 5:18994858-18994880 GACCCACCCCGAATCTGGGTGGG - Intergenic
988517889 5:31920390-31920412 GCCCCCCCCCCCCACTGGGGTGG + Intronic
989071235 5:37513809-37513831 GACCCACCCTTACTCTGGGTGGG - Intronic
992175602 5:74146252-74146274 GGCCTTCCCCACCACTGGGCAGG - Intergenic
992494544 5:77280031-77280053 CATACACCCCACCTCTGGGTTGG + Intronic
994051865 5:95371084-95371106 GACCCACCCCCAATCTGGGTGGG + Intergenic
995409910 5:111845024-111845046 GACCCACCCCAGCACTAGGCTGG - Intronic
997047349 5:130333895-130333917 GACTCTCCCTACCACTGGATGGG + Intergenic
997391981 5:133524673-133524695 CCCCCACCCCGCCCCTGGGTGGG + Intronic
997453320 5:134000619-134000641 AACCCACCCCACCACTTTCTAGG + Intronic
997599136 5:135127506-135127528 ATCCCACCCCACCACTGACTGGG - Intronic
997666276 5:135631935-135631957 GACCTCCCCCTCCCCTGGGTTGG - Intergenic
998133080 5:139660863-139660885 CACCCACCCACCCACTGGCTGGG + Intronic
1000792222 5:165621950-165621972 GACCCACCCCTAATCTGGGTGGG - Intergenic
1001447061 5:171793956-171793978 GGCCCACACCAGCACTGGGGGGG - Intronic
1001605718 5:172958677-172958699 GCGCCACCCAACCACTGGCTAGG - Intergenic
1003179111 6:3777224-3777246 CACCCACCCCAACAGAGGGTGGG - Intergenic
1006037260 6:31223368-31223390 GACCCACCCTAAATCTGGGTGGG + Intergenic
1008382412 6:50849957-50849979 GACCCGACCCACGACGGGGTGGG + Intergenic
1009682784 6:66920740-66920762 GCCCCACCCTTCCACTGGGGAGG - Intergenic
1016856572 6:148676652-148676674 GACCCACCCCCAACCTGGGTGGG - Intergenic
1018063609 6:160109761-160109783 CACCCGCCCCACCTCTGGGAGGG + Intronic
1019040324 6:169098726-169098748 GACCCACCCTCACTCTGGGTGGG + Intergenic
1019338237 7:495097-495119 GGCCCAGCCCACCCCTGGGGTGG + Intergenic
1019408013 7:893994-894016 CACCCACTCCAGCCCTGGGTCGG + Intronic
1022464778 7:30646365-30646387 GACCCACCTCACCACTGCACGGG - Intergenic
1023875032 7:44282289-44282311 CACCCACCCCACCACGGGCTGGG + Intronic
1024216932 7:47255885-47255907 CACACACACAACCACTGGGTGGG - Intergenic
1027717284 7:81688833-81688855 GACCCAGCCAGCCACTTGGTTGG + Intergenic
1029995157 7:105000856-105000878 GCCCCACTCCACCACAGAGTGGG + Intergenic
1030460421 7:109827989-109828011 GACCCACCCTTCTTCTGGGTGGG - Intergenic
1033640979 7:143263314-143263336 TACCCACCCCGCCCCTGGCTGGG + Intronic
1038024482 8:23576490-23576512 GCCCCAGCACACCACTGGCTGGG - Intergenic
1044167650 8:89007034-89007056 GACCCACCCTCCATCTGGGTGGG + Intergenic
1044458481 8:92416617-92416639 GACCCACCCTACATCTGGTTAGG + Intergenic
1046176561 8:110582774-110582796 GACCCACCCTTACTCTGGGTGGG - Intergenic
1046630799 8:116621467-116621489 GACCCACCCTAAATCTGGGTGGG + Intergenic
1048268865 8:133012049-133012071 GTCCCACCCAACCTGTGGGTTGG - Intronic
1049195461 8:141313268-141313290 CCCCCACCCCACCGCTGTGTAGG - Intergenic
1050249243 9:3726907-3726929 GACCCACACAACTACTAGGTTGG + Intergenic
1051443896 9:17119831-17119853 GACCCACCCTTACTCTGGGTGGG - Intergenic
1053050089 9:34954218-34954240 GACCCACAGCAGCAGTGGGTAGG + Intergenic
1058020306 9:100079143-100079165 GACCCACCCCTAATCTGGGTGGG + Intronic
1060317527 9:122526594-122526616 TGCCCACCCCACCACGGGTTCGG + Exonic
1061656616 9:132096586-132096608 GACCCACCCTCAGACTGGGTAGG - Intergenic
1062275762 9:135729871-135729893 GCCCAACCCCACCACTGGGCAGG + Intronic
1185643390 X:1600509-1600531 GACGCCCCCCACCCCTGGGCTGG + Intronic
1186136572 X:6527971-6527993 GACCCACCCTCACTCTGGGTGGG - Intergenic
1188640931 X:32503799-32503821 GCCCCACCCCAGCACTGAGCTGG - Intronic
1193605900 X:83567411-83567433 GACCCATCCCTCCCCCGGGTGGG - Intergenic
1194513082 X:94819472-94819494 GACACACCCCAAATCTGGGTGGG - Intergenic
1195210781 X:102651311-102651333 GGCCCCGCCCACCTCTGGGTCGG + Intergenic
1195221072 X:102745889-102745911 GGCCCCGCCCACCTCTGGGTCGG + Intronic
1198456827 X:136825275-136825297 GACCCACCCCATCATAAGGTTGG + Intergenic
1200279362 X:154763256-154763278 GTCCCACGCCACCGCGGGGTGGG - Intronic