ID: 954327656

View in Genome Browser
Species Human (GRCh38)
Location 3:49872410-49872432
Sequence GGGTCCTCATAAAGGCTACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 76}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954327656_954327671 22 Left 954327656 3:49872410-49872432 CCTAGTAGCCTTTATGAGGACCC 0: 1
1: 0
2: 0
3: 4
4: 76
Right 954327671 3:49872455-49872477 AAGACAGGGGCTGCCTGGGTTGG 0: 1
1: 1
2: 3
3: 35
4: 394
954327656_954327664 8 Left 954327656 3:49872410-49872432 CCTAGTAGCCTTTATGAGGACCC 0: 1
1: 0
2: 0
3: 4
4: 76
Right 954327664 3:49872441-49872463 AGGCCTGTACCCTGAAGACAGGG 0: 1
1: 0
2: 3
3: 15
4: 208
954327656_954327665 9 Left 954327656 3:49872410-49872432 CCTAGTAGCCTTTATGAGGACCC 0: 1
1: 0
2: 0
3: 4
4: 76
Right 954327665 3:49872442-49872464 GGCCTGTACCCTGAAGACAGGGG 0: 1
1: 0
2: 4
3: 48
4: 766
954327656_954327663 7 Left 954327656 3:49872410-49872432 CCTAGTAGCCTTTATGAGGACCC 0: 1
1: 0
2: 0
3: 4
4: 76
Right 954327663 3:49872440-49872462 GAGGCCTGTACCCTGAAGACAGG 0: 1
1: 0
2: 1
3: 10
4: 165
954327656_954327672 23 Left 954327656 3:49872410-49872432 CCTAGTAGCCTTTATGAGGACCC 0: 1
1: 0
2: 0
3: 4
4: 76
Right 954327672 3:49872456-49872478 AGACAGGGGCTGCCTGGGTTGGG 0: 1
1: 1
2: 0
3: 51
4: 424
954327656_954327670 18 Left 954327656 3:49872410-49872432 CCTAGTAGCCTTTATGAGGACCC 0: 1
1: 0
2: 0
3: 4
4: 76
Right 954327670 3:49872451-49872473 CCTGAAGACAGGGGCTGCCTGGG 0: 1
1: 0
2: 0
3: 34
4: 308
954327656_954327668 17 Left 954327656 3:49872410-49872432 CCTAGTAGCCTTTATGAGGACCC 0: 1
1: 0
2: 0
3: 4
4: 76
Right 954327668 3:49872450-49872472 CCCTGAAGACAGGGGCTGCCTGG 0: 1
1: 0
2: 1
3: 30
4: 395
954327656_954327673 26 Left 954327656 3:49872410-49872432 CCTAGTAGCCTTTATGAGGACCC 0: 1
1: 0
2: 0
3: 4
4: 76
Right 954327673 3:49872459-49872481 CAGGGGCTGCCTGGGTTGGGAGG 0: 1
1: 0
2: 9
3: 83
4: 788

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954327656 Original CRISPR GGGTCCTCATAAAGGCTACT AGG (reversed) Intergenic
905736469 1:40330812-40330834 GAGTCCTCATCAAGGCTTTTTGG + Intergenic
906390698 1:45413033-45413055 AGTTCCTCAAAAAGGCCACTGGG + Intronic
909135665 1:71796910-71796932 GGGGCCTGATAAAGATTACTAGG + Intronic
909796684 1:79748443-79748465 GAGTTCTCATAAAGGCTTTTTGG + Intergenic
911051055 1:93671710-93671732 GGGTTCTCATTCAGGCTGCTTGG + Intronic
912331430 1:108823530-108823552 GGGGCCTCAGAAAGGCGAGTGGG - Intronic
914834645 1:151197192-151197214 GGGTCCTCATAAAGTAACCTAGG - Intergenic
917475638 1:175366818-175366840 AGGTCCTCACAAACGCCACTTGG - Intronic
919231735 1:194782581-194782603 GGTTCCTCAAAAAGGGTTCTGGG - Intergenic
1068963954 10:62893190-62893212 GGGGCCTCATAAAGGTTTATTGG + Intronic
1078728577 11:13955295-13955317 GAGTTCTCATAAGGGCCACTGGG - Intergenic
1081489260 11:43554747-43554769 GGGCCCTCACAGAGGCCACTTGG - Intergenic
1081683749 11:45027058-45027080 GGCTCATCACAAAGGCCACTCGG - Intergenic
1087995761 11:104806677-104806699 CTGTTCTCATAATGGCTACTGGG - Intergenic
1091587857 12:1826523-1826545 GGGTCCTCCTGAAGGCTGCATGG + Intronic
1095494643 12:42771581-42771603 GGGGGCTGAGAAAGGCTACTTGG + Intergenic
1102970205 12:117160426-117160448 AGCTCCTGCTAAAGGCTACTGGG + Intronic
1108009940 13:45995719-45995741 GGGGCCTCAGAAAGCTTACTAGG - Intronic
1110783519 13:79494743-79494765 GGTTCCTAAGAAAGGATACTTGG + Intronic
1120714107 14:87821954-87821976 GGGGCTTCATAAGGACTACTTGG + Intergenic
1124636423 15:31367604-31367626 GGCTCCTCACAAGGGCTATTAGG + Intronic
1130345134 15:83036923-83036945 GGGTCATGACAAAGGCTTCTGGG + Intronic
1131397111 15:92095349-92095371 GGATCCTCATATAGGTTAATGGG - Intronic
1137490305 16:48926879-48926901 GGGTCCTCATGATGTCTTCTGGG - Intergenic
1141640154 16:85336107-85336129 GGGTCCTCACCAAGGCTTCCAGG - Intergenic
1146653451 17:34621445-34621467 GGATCCTTAAAGAGGCTACTAGG - Intronic
1153054302 18:930539-930561 AGTTTCTCATAAAGGCTACTTGG + Intergenic
1154937658 18:21077472-21077494 TGCTGCTCATAAAGGCTACAAGG + Intronic
1155867223 18:30980988-30981010 AGGTCCTCATAAAAGCTATAAGG + Intergenic
1156061110 18:33077365-33077387 GGGTCATGTTACAGGCTACTTGG - Intronic
1156717568 18:40029428-40029450 GGACCTTCATAAAGGCCACTTGG + Intergenic
1163693226 19:18749041-18749063 GGGTCCCCAGAAAGCCTCCTTGG - Intronic
1164967018 19:32494108-32494130 GGGTGCTCAGAAAGCCTTCTTGG + Intergenic
1168152080 19:54454719-54454741 GGGCCCTCATAAGAGCTCCTGGG + Intronic
927757143 2:25717991-25718013 GGGTCTTGAAAAAGCCTACTAGG + Intergenic
928331439 2:30360794-30360816 TGTTCCTCATAAAGGCTACGAGG + Intergenic
932474237 2:71991509-71991531 GGGTCCCCATGAAGGATACTGGG - Intergenic
936824276 2:116561859-116561881 GGATCCTCAAAAAAGCTATTCGG + Intergenic
942075397 2:172352648-172352670 AGGTCCTCATCAAGACTATTTGG + Intergenic
944037743 2:195316387-195316409 GGCTCCCCAGAAAGGCAACTGGG - Intergenic
946032010 2:216712790-216712812 GTGTTCTCATAAAGGCTCTTTGG - Intergenic
946066039 2:216988036-216988058 GAGGCCTCTTAGAGGCTACTGGG + Intergenic
1171155055 20:22864441-22864463 GGGTCCTGATAAAGGAATCTGGG - Intergenic
1172117082 20:32579504-32579526 GGGACCTCAGAAATGCTGCTGGG - Intronic
1175063036 20:56260976-56260998 CGGTCCTCACAAAGTCTACAGGG + Intergenic
1184773437 22:46611269-46611291 GGGTCCCCATTCAGGCTTCTAGG + Intronic
950964746 3:17138412-17138434 GGGTTCTTATTAAGGTTACTTGG + Intergenic
954327656 3:49872410-49872432 GGGTCCTCATAAAGGCTACTAGG - Intergenic
963697855 3:148584609-148584631 GGGGCCTTATCAAGGCTCCTAGG - Intergenic
964508021 3:157420960-157420982 TGATTCTCATAAAGGCCACTTGG + Intronic
966521923 3:180882503-180882525 GTGTCCTAATAAAAGTTACTTGG + Intronic
970076558 4:12228443-12228465 GGGTCCCCATAAATACTGCTAGG + Intergenic
978741551 4:112143652-112143674 GGCCCATCAGAAAGGCTACTGGG + Intergenic
990519372 5:56563832-56563854 GGGTCCTAATGAGGGCTTCTGGG - Intronic
991271854 5:64793170-64793192 GAGTGCTCATGAAGGCCACTAGG - Intronic
993086860 5:83374103-83374125 GGGTCCTCTTACAGGATGCTGGG - Intergenic
997849669 5:137319985-137320007 GAGTTCTCATAAAGGCTTTTTGG - Intronic
998793926 5:145797256-145797278 GAGTTCTCATAAAGGCAATTTGG - Intronic
1006499949 6:34451942-34451964 GTGTCCTCATAAAGGGTGCAGGG - Intergenic
1007685539 6:43665329-43665351 GAGTCTTCCTAAAGGCTGCTGGG + Intronic
1007910188 6:45505683-45505705 GGGTGCTCAAAAATGCTAGTTGG - Intronic
1013646077 6:112142704-112142726 GGGTCCTCATAAAAGGGACATGG + Intronic
1015703983 6:136067411-136067433 AGGTCTTCATAAAGTCTAGTAGG - Intronic
1019771133 7:2884176-2884198 GGGTCCTCAGAAAGGAGGCTGGG + Intergenic
1024330902 7:48154473-48154495 GGGTCCTAATAAAATCTTCTGGG + Intergenic
1030543032 7:110857073-110857095 GGGTCATCATTAAGGCTTTTGGG + Intronic
1034551650 7:151824491-151824513 GGCTCCACACAGAGGCTACTAGG - Intronic
1036182107 8:6594453-6594475 GGGCCCTCATAGAAGCTCCTAGG + Intronic
1042857764 8:73285367-73285389 GGGACCTGAGGAAGGCTACTAGG - Intergenic
1053162206 9:35820958-35820980 GGGGCCTCATACAGGATTCTTGG - Intronic
1053789330 9:41675358-41675380 GGGCCCTCATAATGGAGACTGGG + Intergenic
1054155812 9:61639404-61639426 GGGCCCTCATAATGGAGACTGGG - Intergenic
1054177611 9:61886711-61886733 GGGCCCTCATAATGGAGACTGGG + Intergenic
1054475581 9:65570405-65570427 GGGCCCTCATAATGGAGACTGGG - Intergenic
1054659920 9:67694097-67694119 GGGCCCTCATAATGGAGACTGGG - Intergenic
1055129161 9:72754521-72754543 GGGTCCTCAGAAAGCCCTCTGGG + Intronic
1057111590 9:92477222-92477244 GGGTCCTGGTAAAGGTTACTGGG + Intronic
1057182246 9:93036467-93036489 GGGACCTTGCAAAGGCTACTTGG + Intergenic
1062407101 9:136402052-136402074 GGGCCGTCAGAAAGGCAACTGGG + Exonic
1062461353 9:136663828-136663850 GGGTTCTCAGACAGGCTTCTTGG - Intronic
1192219255 X:69186078-69186100 TGCTCCCCTTAAAGGCTACTCGG - Intergenic