ID: 954327659

View in Genome Browser
Species Human (GRCh38)
Location 3:49872421-49872443
Sequence TTATGAGGACCCTCCTAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 64}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954327654_954327659 2 Left 954327654 3:49872396-49872418 CCAGATTAGCATTGCCTAGTAGC 0: 1
1: 0
2: 0
3: 3
4: 61
Right 954327659 3:49872421-49872443 TTATGAGGACCCTCCTAAGGAGG 0: 1
1: 0
2: 0
3: 3
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954327659 Original CRISPR TTATGAGGACCCTCCTAAGG AGG Intergenic
900507260 1:3035967-3035989 TGGTGAGGACCCTCATATGGAGG - Intergenic
901364948 1:8738773-8738795 TGAAAAGGAACCTCCTAAGGAGG - Intronic
902777006 1:18681344-18681366 TCATGAGGACCCTTCTAACTTGG - Intronic
909219831 1:72942914-72942936 TTATGAGGACACTTCAAAGTTGG - Intergenic
909851949 1:80477793-80477815 TTATGAGGACCTTTTTGAGGAGG + Intergenic
913339932 1:117748511-117748533 TTGTGAGGACAGTACTAAGGGGG - Intergenic
913575443 1:120169018-120169040 TTATGAGGACACTCTGAATGAGG + Intronic
914557753 1:148784660-148784682 TTATGAGGACACTCTGAATGAGG + Intergenic
914615081 1:149345570-149345592 TTATGAGGACACTCTGAATGAGG - Intergenic
916700027 1:167282535-167282557 ATATGAGGACCTTCATAATGTGG + Intronic
922590566 1:226772713-226772735 TTATGATGTCCCTGCTATGGGGG - Intergenic
923504755 1:234595693-234595715 TTACAAGGATCCTCGTAAGGAGG + Intergenic
1069388034 10:67902612-67902634 TTATGAGGACTCTCCTTAGCAGG + Intronic
1069793225 10:71036562-71036584 TTGGGAAGACCCTCCTGAGGAGG + Intergenic
1073119310 10:101111881-101111903 CTTTGGGGACCCTCCAAAGGTGG - Intronic
1083353337 11:62046954-62046976 TTATGTTGACCCAGCTAAGGAGG - Intergenic
1083745083 11:64730984-64731006 TTATGAGCCCCCTCATAAGCAGG - Intronic
1089743711 11:120602418-120602440 ATATGAGGACCCACCTGAAGAGG + Intronic
1091095323 11:132815676-132815698 CTTTGGGGACCCTCCTATGGGGG - Intronic
1114962495 14:27911220-27911242 TCATGAGGACAGTACTAAGGAGG - Intergenic
1115307908 14:31951203-31951225 GTATGAGGAGCCTCCCACGGAGG - Intergenic
1128813480 15:70588234-70588256 TTATGGGGACCAGTCTAAGGTGG - Intergenic
1141860877 16:86715345-86715367 TGATGGGGACACTTCTAAGGGGG + Intergenic
1146498235 17:33342195-33342217 TTATGAGGAGCCTCCTGGGAGGG - Intronic
1152301401 17:79497065-79497087 TCATGAGAGCCCTCCTAAGGTGG + Intronic
1155312397 18:24536646-24536668 TGTTGAGGTCCCTCCTTAGGAGG + Intergenic
1157460923 18:47892827-47892849 TTAAAAGGACTTTCCTAAGGTGG - Intronic
1168094824 19:54108385-54108407 TCATGAGGAACCTGCTCAGGGGG + Exonic
925471661 2:4168780-4168802 TTATGAGGACCAACCCCAGGAGG - Intergenic
934910717 2:98251858-98251880 TGCTGAGGAGCCTCGTAAGGCGG - Intronic
937696572 2:124814971-124814993 TTTAGAGGCCCCACCTAAGGTGG - Intronic
937726861 2:125176639-125176661 TTATGAGGACAGTACCAAGGGGG - Intergenic
944586761 2:201179560-201179582 TTCTGAGGACCCTCATAGGTTGG + Intergenic
1169883110 20:10368613-10368635 TGATGAGGAGCCTTCTAAGTAGG - Intergenic
1172522830 20:35579306-35579328 TCATGAGGATCCTCCTGAGGAGG - Intergenic
1183851772 22:40595457-40595479 TTATGATAACCCACCTACGGTGG - Intronic
1184964401 22:47959326-47959348 TTATGAGGACTCCCTAAAGGGGG - Intergenic
949869113 3:8571701-8571723 TTTCTAAGACCCTCCTAAGGCGG - Intergenic
949900762 3:8813048-8813070 GTATAAAGACCCTCCTAAGATGG + Intronic
954327659 3:49872421-49872443 TTATGAGGACCCTCCTAAGGAGG + Intergenic
959882046 3:111454964-111454986 TTATGAGAATTCTCCTAAGTAGG + Intronic
962963681 3:140334570-140334592 TTATGAGGAGCCACATGAGGAGG + Intronic
967873987 3:194253920-194253942 AAATGAGGCCCCTCCCAAGGGGG - Intergenic
977783986 4:101011571-101011593 TAATGGGGACCCTCCTAATTGGG + Intergenic
990032523 5:51278829-51278851 GTCTGAGGACACTCCTGAGGAGG - Intergenic
992092254 5:73327549-73327571 GTATTAGGATCCTCCTAAGTAGG + Intergenic
992469008 5:77036587-77036609 TAATGATGAGCCTTCTAAGGAGG - Exonic
995337210 5:111013407-111013429 TTATCAGGATTCTCCTTAGGAGG - Intergenic
1004566018 6:16798470-16798492 TTATGAGGCCACTTCCAAGGGGG + Intergenic
1009524019 6:64720301-64720323 TCATAAGGACCCTCATAAGAAGG - Intronic
1013780017 6:113718787-113718809 TTATGAGGACACCACTAAGATGG + Intergenic
1020366475 7:7386098-7386120 TTATCAGGACCCATCTAATGTGG - Intronic
1025967246 7:66285537-66285559 TGATGAGGAGTCTCCTAAAGGGG - Intronic
1027221698 7:76218223-76218245 CTCTGAGGACCCTCCCAAGCTGG - Intronic
1034330931 7:150281683-150281705 ATCTGCGGACCCTCCTCAGGCGG - Intronic
1034687396 7:152984955-152984977 TTATGAGGACACTAGTCAGGCGG + Intergenic
1040340456 8:46437881-46437903 ATATGGGGAACCTGCTAAGGAGG - Intergenic
1046566048 8:115902816-115902838 TTCTGTGGACCCTCATAAGAAGG - Intergenic
1056477808 9:86969624-86969646 TTATCAGGATCCACCTAAGAAGG - Intergenic
1057480320 9:95440365-95440387 TTATGAAGAAACTCATAAGGAGG + Intergenic
1058045128 9:100350422-100350444 ATATGAGGTCCTTCCTAATGTGG + Intronic
1058880522 9:109282169-109282191 TTATAAGAAACCTCCAAAGGAGG + Intronic
1061026683 9:128054419-128054441 TTCTGAAGACCCTCCTCAGCAGG + Intergenic
1186472657 X:9833513-9833535 TTATGAGGTCCCTAATTAGGAGG - Intronic
1187883347 X:23866016-23866038 CTAGGATGACCATCCTAAGGAGG - Intronic
1194537144 X:95119369-95119391 TTAGGAGGACCCTTCCCAGGAGG + Intergenic
1195930052 X:110065394-110065416 TATTGAGGACCTTTCTAAGGTGG + Intronic
1198245628 X:134828580-134828602 TTATGAGGACCCACACAAGAGGG - Intronic