ID: 954327892

View in Genome Browser
Species Human (GRCh38)
Location 3:49873481-49873503
Sequence GGGCCCTGGTGCCACTGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 363
Summary {0: 1, 1: 0, 2: 1, 3: 37, 4: 324}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954327892_954327898 1 Left 954327892 3:49873481-49873503 CCAGCACAGTGGCACCAGGGCCC 0: 1
1: 0
2: 1
3: 37
4: 324
Right 954327898 3:49873505-49873527 GCTCCTGTCTCAGGCGCTCAGGG 0: 1
1: 0
2: 2
3: 15
4: 287
954327892_954327894 -8 Left 954327892 3:49873481-49873503 CCAGCACAGTGGCACCAGGGCCC 0: 1
1: 0
2: 1
3: 37
4: 324
Right 954327894 3:49873496-49873518 CAGGGCCCAGCTCCTGTCTCAGG 0: 1
1: 0
2: 8
3: 41
4: 431
954327892_954327897 0 Left 954327892 3:49873481-49873503 CCAGCACAGTGGCACCAGGGCCC 0: 1
1: 0
2: 1
3: 37
4: 324
Right 954327897 3:49873504-49873526 AGCTCCTGTCTCAGGCGCTCAGG 0: 1
1: 0
2: 1
3: 16
4: 205
954327892_954327900 16 Left 954327892 3:49873481-49873503 CCAGCACAGTGGCACCAGGGCCC 0: 1
1: 0
2: 1
3: 37
4: 324
Right 954327900 3:49873520-49873542 GCTCAGGGAAGCCACTCATGAGG 0: 1
1: 0
2: 1
3: 17
4: 169
954327892_954327901 17 Left 954327892 3:49873481-49873503 CCAGCACAGTGGCACCAGGGCCC 0: 1
1: 0
2: 1
3: 37
4: 324
Right 954327901 3:49873521-49873543 CTCAGGGAAGCCACTCATGAGGG 0: 1
1: 0
2: 0
3: 28
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954327892 Original CRISPR GGGCCCTGGTGCCACTGTGC TGG (reversed) Intergenic
900077570 1:830175-830197 GGGCACTGATCCCACTGTGAAGG - Intergenic
900512194 1:3066073-3066095 AGGCCCTGGGGCCCCTGCGCTGG - Intergenic
900666766 1:3820801-3820823 CGGTGCAGGTGCCACTGTGCTGG + Intronic
901012493 1:6209576-6209598 GGGACCTGGTGACACAGGGCTGG + Intronic
901066822 1:6498193-6498215 GCCTCCTGGTGCCAGTGTGCAGG - Intronic
902348263 1:15835117-15835139 GGACCCTGTTGCCCCTGGGCGGG - Intergenic
902606207 1:17570754-17570776 GGGCCATGGTGGTACTGTGGAGG + Intronic
902685809 1:18076908-18076930 GGGCCCTGAAGCCAGTATGCTGG + Intergenic
903008783 1:20315976-20315998 TGGCCCTGATGCCACTGAGTGGG + Intronic
903840242 1:26233896-26233918 GGGCCCTGCTGGGCCTGTGCAGG - Intergenic
904587697 1:31589041-31589063 GGGTCCCGGGGCCACTGAGCGGG - Intergenic
911950937 1:104172664-104172686 GGGACCTGGTGCTACAGAGCAGG - Intergenic
912697082 1:111849621-111849643 GGCCACTGGTACAACTGTGCAGG + Intronic
913061329 1:115211125-115211147 GGGCCCTGGTGGCTCACTGCAGG + Intergenic
913326202 1:117630782-117630804 TGGACCTGGGGCCACGGTGCTGG + Intergenic
913538600 1:119797574-119797596 GGGTCCTGGTGTCACTATGATGG + Intronic
914081318 1:144413606-144413628 GTGCCCTGGTGCCCCGGCGCAGG + Intergenic
914096032 1:144544998-144545020 GTGCCCTGGTGCCCCTGCACAGG - Intergenic
914302491 1:146388967-146388989 GTGCCCTGGTGCCCCTGCACAGG + Intergenic
914530952 1:148523631-148523653 GTGCCCTGGTGCCCCGGCGCAGG + Intergenic
916730655 1:167563833-167563855 GGGCCCTGATGCAGCTGTGCAGG + Intergenic
916991563 1:170250746-170250768 GGGACCTGGTGCCATGGAGCAGG + Intergenic
918093430 1:181316440-181316462 TGGCCCTGGGGCCAATGTCCTGG + Intergenic
918095798 1:181333126-181333148 GGGCCCAGACGCCACTGAGCAGG + Intergenic
920009707 1:202858994-202859016 TGGGCATGGTGCCACTGGGCTGG + Intergenic
920174196 1:204089946-204089968 GGGCCATGGTGCCAGAGGGCAGG + Intronic
924669657 1:246110649-246110671 TTGCCCTGGTGACACTGTGCAGG - Intronic
1062828436 10:588539-588561 GGGCCCTGGTGTCACTTTCCCGG - Intronic
1063300338 10:4844941-4844963 GGGACCTGGTGCCATGGAGCAGG + Intronic
1063814374 10:9755993-9756015 GGGCGCTGGTACAACTGTGGTGG + Intergenic
1064354883 10:14607407-14607429 GACCCCTGGAGCCACTGTGGGGG + Intronic
1064706807 10:18081451-18081473 GGGCCTTGAGGCCACTGTTCTGG - Intergenic
1065552572 10:26883997-26884019 GGTCCCAGGTGCCACTGAGGAGG - Intergenic
1065600482 10:27362914-27362936 GGTCCCAGGTGCCACTGAGTAGG + Intergenic
1066135201 10:32438874-32438896 GGGCCCTGGCGCAACTGTGGTGG + Intergenic
1067215849 10:44302120-44302142 CAGCCCAGGTGCCTCTGTGCTGG + Intergenic
1067684280 10:48457644-48457666 GTGCCCAGGGGACACTGTGCTGG + Intronic
1068211383 10:53924512-53924534 GGGACCAGGTGCCACAGAGCAGG - Intronic
1071262310 10:83931821-83931843 TGGCACAGGTGCCACTGTCCTGG + Intergenic
1072817509 10:98524084-98524106 GGGGCCTTGTGCAACTGTACTGG - Intronic
1074183692 10:111083729-111083751 GGGCCTAGGTGCCACTGCCCAGG - Intergenic
1075584914 10:123650682-123650704 GGGCCCTGGCTCCCCTGGGCTGG - Intergenic
1076171981 10:128327084-128327106 GGGCCCTTCTTCCCCTGTGCTGG + Intergenic
1076843348 10:133057270-133057292 GGGCCGTGGGGCCCCTGTGCTGG - Intergenic
1077404991 11:2378816-2378838 GGCCCCTGGAGCCAGTGTGTGGG + Intronic
1079238016 11:18703250-18703272 TGGCTCTGGTGACACTGTGCCGG + Exonic
1079257894 11:18848434-18848456 TGGCCCTGCTGCCACTTTGGGGG - Intergenic
1079566815 11:21892477-21892499 GGGCCCTATTGCCACTGTTCAGG + Intergenic
1080089247 11:28325133-28325155 TTGCCCTGCTGACACTGTGCAGG - Intronic
1080402903 11:31954001-31954023 GGGCCTTGCTGCCTCTGTCCTGG - Intronic
1080639517 11:34150585-34150607 AGGCCCTGCTGCCACTTTGGTGG + Intergenic
1083148395 11:60774954-60774976 GGAGGCTGGTGCCACGGTGCAGG + Intronic
1083330568 11:61896546-61896568 AGGCCTTGGTGCCACTCAGCTGG - Intergenic
1083340403 11:61955448-61955470 GGTCCCTGGAGCCCCTGCGCGGG + Intronic
1083738882 11:64697310-64697332 GGAATCTGGTGCCACTGTGCAGG - Intronic
1084004470 11:66315713-66315735 GGACCCTGGGGGCACTGAGCGGG + Exonic
1084209378 11:67614045-67614067 GGGCCCTGGTGCTTCTGAACAGG + Intergenic
1084858835 11:72005208-72005230 GAGGCCTGGGGTCACTGTGCAGG - Intronic
1085886898 11:80532764-80532786 GGGACCGGGTGCCACAGAGCAGG + Intergenic
1086493378 11:87377861-87377883 GGCCCCTGGTCCCATTGTGTAGG + Intergenic
1087791756 11:102413432-102413454 GGACCCTGCTGCCACCGTCCTGG + Intronic
1088801587 11:113312174-113312196 GGGCTCTGGAGCCATTTTGCTGG - Intergenic
1089201225 11:116725796-116725818 GGGCGATGGAGCCACTCTGCAGG - Intergenic
1092105815 12:5921138-5921160 GGGCCCAGGTGACATTGAGCTGG - Exonic
1092117272 12:6018506-6018528 GGGCCCTAATGCCAACGTGCAGG - Exonic
1092902884 12:13076278-13076300 TGTCCCTGGTGCCTCTTTGCTGG + Intronic
1095098926 12:38161993-38162015 GGGCCCTGGGCCCACGGTCCTGG + Intergenic
1095166847 12:38983141-38983163 GGGCCCTTGAGCCACTGCTCGGG - Intergenic
1095642433 12:44500721-44500743 GGGCCTCGGTGCCACGGAGCAGG - Intergenic
1096526344 12:52212449-52212471 GGGCCCTGGTCCCACTACGCAGG - Intergenic
1096530812 12:52241722-52241744 GGGCCTGGGTCCCACTGTTCTGG + Intronic
1100743446 12:97620144-97620166 GGGCCCAGGTGCTACAGAGCGGG + Intergenic
1105532711 13:21234679-21234701 ATGCCCTGGCGCCTCTGTGCTGG - Intergenic
1106092047 13:26604984-26605006 GGACCCTGGCGCCTCTGTCCAGG - Intronic
1106402303 13:29442156-29442178 GGCCCCTGATGACACTGTGGGGG + Intronic
1108229078 13:48318748-48318770 GGGCCTTGGGGCCACTGGTCTGG + Intronic
1110804193 13:79736039-79736061 TGTCCCTGCTGCCACTGGGCTGG - Intergenic
1112552661 13:100436108-100436130 GGGCCCTTGAGCCACTGCTCAGG - Intronic
1113968129 13:114166327-114166349 GAGCCCTGGGGCCTCTGTCCAGG - Intergenic
1113971537 13:114195097-114195119 GGGCTGTGGGGCCACTGGGCGGG - Intergenic
1114590822 14:23863222-23863244 TCCCCCTGGTGCCACTGTCCAGG + Intergenic
1114657051 14:24322592-24322614 GGGCCCTGGTGGGGCTGAGCTGG + Intronic
1114670800 14:24409969-24409991 GGGCCAAGGTGCCACTGGACTGG - Exonic
1115648865 14:35388899-35388921 AGGCCGTGGTGCCAATGGGCAGG - Intergenic
1118389951 14:65287570-65287592 GGGCCCAGGGGCCTCTGAGCTGG + Intergenic
1118613874 14:67562234-67562256 GGGCCTGGGAGCCACTGTCCTGG - Exonic
1119052523 14:71384006-71384028 GGGCTCAGGTGGCACTTTGCTGG + Intronic
1120169741 14:81236414-81236436 GGGACCGGGTGCCACAGAGCAGG - Intergenic
1122786226 14:104164427-104164449 GCGTCCTGGTGTCCCTGTGCTGG + Intronic
1122798377 14:104217660-104217682 TGGTCCGGGTGGCACTGTGCTGG + Intergenic
1122878963 14:104681490-104681512 GGGCGCTGGTGCCCGTGTGCCGG - Intergenic
1123060518 14:105592252-105592274 GGGCCTTGGGGCCACAGGGCGGG + Intergenic
1123084997 14:105713223-105713245 GGGCCTTGGGGCCACAGGGCGGG + Intergenic
1124662582 15:31562394-31562416 GGTACCTGGTGCCTCTGAGCTGG + Intronic
1124890371 15:33726577-33726599 GGGCCTGGGGGCCACTGTGCTGG - Intronic
1129660051 15:77548431-77548453 GGGTCCTGGGGCCGCAGTGCTGG - Intergenic
1129661637 15:77556118-77556140 GGTCCCTGGTGCAGCTGAGCAGG + Intergenic
1130843410 15:87722955-87722977 TGGCCATGGTGGCTCTGTGCAGG + Intergenic
1131122422 15:89830805-89830827 GGGCTGGGGTGCCACTGTACAGG + Exonic
1131874468 15:96790081-96790103 GGTCTCTGGTGCCACAGTGAAGG + Intergenic
1132498625 16:275239-275261 GGGCCCTGGGGTCACTGGGCTGG - Intronic
1132686209 16:1163221-1163243 GTGCCCTGGTGCCCGTCTGCAGG + Intronic
1132733720 16:1375498-1375520 GGGCCCTGCTGCCTCTGTGACGG - Intronic
1132838055 16:1964568-1964590 GGGCCCTGGTGGCCCTGGGATGG - Exonic
1132871776 16:2118601-2118623 GGGCCCTGCAGACACTGGGCAGG - Intronic
1133103801 16:3494410-3494432 GGGGCATGGTGCCACTGTGGAGG + Intronic
1133267740 16:4594841-4594863 GGGCCCTGGTTCTGCTGGGCAGG + Intronic
1134520751 16:14918294-14918316 GGGCCCTGCAGACACTGGGCAGG + Intronic
1134550824 16:15137679-15137701 GGGCCCTGCAGACACTGGGCAGG - Intronic
1134708423 16:16316945-16316967 GGGCCCTGCAGACACTGGGCAGG + Intergenic
1134715638 16:16356978-16357000 GGGCCCTGCAGACACTGGGCAGG + Intergenic
1134915240 16:18063801-18063823 CCTCCCTGTTGCCACTGTGCAGG - Intergenic
1134951179 16:18351700-18351722 GGGCCCTGCAGACACTGGGCAGG - Intergenic
1134959119 16:18395181-18395203 GGGCCCTGCAGACACTGGGCAGG - Intergenic
1135587170 16:23679888-23679910 GGGTCCAGATGCCGCTGTGCTGG + Intronic
1136666854 16:31819744-31819766 GGGCCCTGGTGACAGCGTCCTGG + Intergenic
1136810891 16:33175355-33175377 GGCCCCTGGTGCCTCTCTCCTGG + Intergenic
1136817367 16:33285435-33285457 GGCCCCTGGTGCCTCTCTCCTGG + Intronic
1136823931 16:33341964-33341986 GGCCCCTGGTGCCTCTCTCCTGG + Intergenic
1137017726 16:35393668-35393690 GGCCCCTGGTGCCTCTCTCCTGG - Intergenic
1137032014 16:35532522-35532544 GGCCCCTGGTGCCTCTCTCCTGG - Intergenic
1138166299 16:54804815-54804837 GGGCCCTGGGGCCAGACTGCTGG + Intergenic
1138653049 16:58472658-58472680 TGGCCCTGTGTCCACTGTGCTGG - Intronic
1139592607 16:67941935-67941957 GGGCCCTGGTGCCACTCCCTAGG + Intronic
1141715119 16:85722577-85722599 GGGCCCTGGGCCCACTCAGCGGG - Intronic
1141978777 16:87536371-87536393 GGGCCCTTGAGCCCCTATGCCGG - Intergenic
1142361617 16:89630358-89630380 CTGCCCTGGTGCCTCTGTGCTGG - Exonic
1142398768 16:89848246-89848268 GGGCCCTGCTGTCACTGGTCGGG + Intronic
1142412662 16:89924233-89924255 GGGCGTTGGTGCAGCTGTGCAGG + Intronic
1203059367 16_KI270728v1_random:955371-955393 GGCCCCTGGTGCCTCTCTCCTGG - Intergenic
1142866538 17:2794778-2794800 GGCACCTGCTGCCACTGTGAAGG - Intronic
1143109255 17:4544264-4544286 GGGCACTGTTGGCACTGTGTCGG + Intronic
1143529972 17:7497042-7497064 GAGCCCTGGAGCCACTGACCTGG - Exonic
1143553531 17:7646410-7646432 TGGGCCTTGCGCCACTGTGCAGG - Intergenic
1143896543 17:10141061-10141083 GGGCCCTGGAGCCACTTCCCTGG - Intronic
1145907537 17:28524582-28524604 GGGCCCTGGTGACGCAATGCGGG - Exonic
1147817276 17:43219217-43219239 GGGCCCTGGTGCTAAGGTGGTGG - Exonic
1147851838 17:43449665-43449687 GTGCCCTGGTGCCAGTGCTCAGG + Intergenic
1147871202 17:43588820-43588842 TGACCCTGGTGGCACTGTGAAGG - Intergenic
1148062860 17:44848590-44848612 GGGCCCTTGAGCCACACTGCTGG - Intronic
1148132516 17:45270649-45270671 GGCCCCTGTTCCCGCTGTGCTGG + Intronic
1148331944 17:46818540-46818562 GGACCCTGGTGCCACCGAGCAGG + Exonic
1148667926 17:49388519-49388541 GGGCAGGGGTGCCAGTGTGCTGG + Intronic
1148790712 17:50171099-50171121 GGGACCTGCTGCCACTCTGGGGG + Intronic
1150105503 17:62459693-62459715 GGGCCCTTCTGCAACTGAGCAGG - Intronic
1151658785 17:75507998-75508020 GGGCCCTGGTGCCTCTCCGCAGG - Intronic
1152072601 17:78141196-78141218 AGGCCCTGGAGCCACTGAGAGGG - Exonic
1152133105 17:78489089-78489111 GAGCCTGGGTGCCTCTGTGCCGG - Intronic
1152571926 17:81124697-81124719 CGGCCCTGGTGGCACCGTGAGGG - Intronic
1152618105 17:81346924-81346946 GGGCCCTGGTGCGGGTGTCCTGG - Intergenic
1152754465 17:82081462-82081484 GGGCGCAGGTGTCACTGTGGTGG - Intronic
1154199635 18:12290278-12290300 GGGCCCTGATGCAACCCTGCAGG - Intergenic
1155492999 18:26418146-26418168 GACACCTGGTGCCACTGGGCAGG + Intergenic
1155493214 18:26419758-26419780 GGGGCCCGGTGTCACTGTACGGG - Intergenic
1156575808 18:38313742-38313764 GAGAGCTGCTGCCACTGTGCTGG - Intergenic
1157464140 18:47930360-47930382 GGGACCTGGCGCCACCTTGCAGG - Exonic
1157471580 18:47992941-47992963 GAGACCTGCTGCCACTGTGTGGG + Intergenic
1158224023 18:55182027-55182049 GGCCCTGGGTGGCACTGTGCTGG - Intergenic
1158312412 18:56172210-56172232 TGGCCCTGCTACCACTGTCCAGG + Intergenic
1160040739 18:75343447-75343469 TGGCCCAGTGGCCACTGTGCGGG + Intergenic
1160751109 19:735142-735164 GGGCCCAGGTGCCTGTGTCCTGG + Intronic
1160751124 19:735191-735213 GGGCCCAGGTGCCTGTGTCCTGG + Intronic
1160751206 19:735473-735495 GGGCCCAGGTGCCTGTGTCCGGG + Intronic
1160751252 19:735627-735649 GGGCCCAGGTGCCTGTGTCCGGG + Intronic
1160751299 19:735781-735803 GGGCCCAGGTGCCTGTGTCCGGG + Intronic
1161113710 19:2484918-2484940 GTGCCCTGGGGCCACTCTGGGGG - Intergenic
1161221516 19:3120238-3120260 GGGCCCTGCTGTCCCTGGGCAGG + Intronic
1161233679 19:3187763-3187785 GCGCCCTGGGGCCACAGTGGTGG + Intronic
1161267118 19:3369540-3369562 GGGCCCGGGTGGCACAGAGCGGG - Intronic
1161558643 19:4958323-4958345 GGGGCCTGGTAACACTGTCCTGG + Intronic
1162575969 19:11499059-11499081 GGGGCCTGGTGACACAGTTCTGG - Intronic
1163032547 19:14553900-14553922 GGGCCCTGGTTGCACTGACCAGG + Intronic
1166158293 19:40932239-40932261 GGGGCCTGGTAGCACTTTGCAGG - Intergenic
1167001147 19:46746337-46746359 GGGCCCTGGCCCCACTGGGGCGG - Exonic
1167439539 19:49500381-49500403 GGGCCCCGGTACCACTGAACAGG - Intergenic
1168317116 19:55489218-55489240 GGGCCCAGGGGCCAGTGAGCAGG + Intronic
925145005 2:1575491-1575513 GGCCCCTGGGGTCTCTGTGCAGG + Intergenic
925397296 2:3544282-3544304 GGACCCAGCTGCCAATGTGCAGG + Intronic
925456435 2:4020479-4020501 TTGCCCTGTTGACACTGTGCAGG + Intergenic
926084110 2:10010288-10010310 GGGGCCTTGTGCCCCTGAGCAGG + Intergenic
926305338 2:11633989-11634011 TGGCCCTGGGGGGACTGTGCGGG + Intronic
927488181 2:23503603-23503625 TGGCCATGGTGCCTCTGTTCTGG - Intronic
928177224 2:29042810-29042832 TTGCCCTGCTGACACTGTGCAGG - Intronic
930002690 2:46871645-46871667 GGGCCCTGGGGCCCATCTGCTGG + Intergenic
930146882 2:48016652-48016674 GGGCCATGGTGGCAGTTTGCGGG - Intergenic
932174302 2:69585492-69585514 GGCCCCTGGTTCCAATGGGCTGG + Intronic
932773213 2:74513266-74513288 GGGCCCTGGCGCCTCTGAGCCGG - Intergenic
933153343 2:78941251-78941273 TGGCCCTGGTGACACTCTTCAGG + Intergenic
933773580 2:85758754-85758776 GGGCTCTGGTGCAGCTGCGCTGG - Intronic
934527004 2:95058262-95058284 GGGCCCGGGAGCCACTCTGCTGG - Intergenic
935737159 2:106115382-106115404 AGGCCCTGCTGACACTGAGCTGG + Intronic
935997561 2:108790428-108790450 GTGGCCTGTTGCTACTGTGCTGG - Intronic
936068490 2:109349741-109349763 GGGCCCTGGAGCCTCTGGGTAGG + Intronic
936243521 2:110807637-110807659 GGACCCTGCTGGCTCTGTGCGGG - Intronic
936526077 2:113242350-113242372 AGTCCCTGCTGACACTGTGCAGG + Intronic
938936713 2:136133622-136133644 GGGCCGAGATGCCATTGTGCAGG - Intergenic
941429762 2:165399744-165399766 GAGCCTTGGTGCCATCGTGCAGG - Intergenic
941806733 2:169717392-169717414 ATGCCCTGTTGACACTGTGCAGG - Intronic
942009450 2:171745232-171745254 GGGAGCTGGTGCCATTGTGTTGG + Intronic
944864812 2:203849928-203849950 GGGCCCTGGTGCAATTGTGGTGG - Intergenic
945048450 2:205801802-205801824 CTGCACTGGTGCCACTGTGTAGG - Intergenic
947764058 2:232624486-232624508 AGGCCCTGGAGCCCCTGTGTTGG - Intronic
947932272 2:233973881-233973903 GAGCCCTGGAGCCACGGTGCGGG + Intronic
947984444 2:234436785-234436807 GAGCCCTGGAGTCCCTGTGCTGG + Intergenic
948256528 2:236572657-236572679 GGGCTCTGGTTACACTGGGCCGG + Intronic
948825590 2:240572191-240572213 TGGCCCTGATGACACAGTGCAGG + Intronic
1169486969 20:6042017-6042039 GGGCCTTGGAGACACTCTGCTGG + Exonic
1170573375 20:17645226-17645248 TGGCCATGCTGCCCCTGTGCAGG - Intronic
1171020900 20:21583215-21583237 GGTCCCTGGTGCCAGGGTGATGG + Intergenic
1171384572 20:24761579-24761601 GGGCCAAGGTGCCACTGTTGCGG - Intergenic
1171411524 20:24951379-24951401 AGGCCCTTCTGCCACTGTGCTGG + Intronic
1171823590 20:29876114-29876136 GGGCCCAGGGCCCACTGTCCTGG - Intergenic
1172127501 20:32633672-32633694 GGGCTCTGGAGCCCCTGTCCAGG - Intergenic
1172487281 20:35305913-35305935 GGGCCCTAGGGCAGCTGTGCAGG + Intronic
1172512655 20:35511497-35511519 GGCCCCTGAGGCCACTGTCCTGG + Exonic
1172649635 20:36493584-36493606 GGGCCCTGGGACCAGTCTGCAGG - Intronic
1172983451 20:38962521-38962543 GGGCGCTGCCGCCTCTGTGCGGG + Intronic
1174099793 20:48118502-48118524 GAGCACTGGTGCCAGGGTGCAGG + Intergenic
1174355995 20:49998234-49998256 GATCCCTGGGGCCACTGTGATGG + Intergenic
1175844091 20:62049598-62049620 GGGCCGTGGTGCTTCTCTGCAGG - Intronic
1176868572 21:14070439-14070461 GGGCCCTGGGCCCACGGTCCTGG - Intergenic
1179302717 21:40126984-40127006 GGGCCCTGGAGCCTCACTGCTGG + Intronic
1179477376 21:41656226-41656248 GGGCCCTGGAGCCATTTTTCAGG - Intergenic
1180089203 21:45525162-45525184 GGGCCCAGGTCTCACTGGGCAGG - Intronic
1180149634 21:45940988-45941010 GGGCCCTGGAACCCCTGTCCCGG + Intronic
1180693884 22:17739717-17739739 GGGACGTGGTGCCTGTGTGCGGG - Intronic
1180857352 22:19056926-19056948 GGGCCCTTGTGTCACTTTGTTGG - Intronic
1180921500 22:19523842-19523864 TGGCGCTCGTGCCACTCTGCTGG - Exonic
1183278973 22:36922236-36922258 TGGCCCTGCTGGCCCTGTGCTGG + Exonic
1183284535 22:36953673-36953695 TGGCCCTGCTGGCCCTGTGCTGG - Intergenic
1183623762 22:38989553-38989575 GGACCCAGGTGCCATTGTCCAGG - Exonic
1184032090 22:41901084-41901106 GGGCACTGCTGCCACTGTTGGGG + Intronic
1184147526 22:42620059-42620081 GGGTCCTGGTGACAGTTTGCTGG - Intronic
1184362099 22:44024698-44024720 GGGACCTCGGGCCACCGTGCGGG + Intronic
1184746569 22:46459569-46459591 GGACCCTGCTGGCACTGTGGAGG - Intronic
1185101324 22:48842441-48842463 GGGCCCAGGTGGCACCGTGTGGG + Intronic
1185146445 22:49139662-49139684 GGGCCCAGGAGACACTGTGTAGG + Intergenic
1185175954 22:49326793-49326815 GGGCCCTGATGCAACAGGGCTGG + Intergenic
1185215926 22:49600005-49600027 GGGTCCGAGTGCCACTGGGCGGG - Intronic
950119324 3:10471183-10471205 GCGCGCTGGAGACACTGTGCTGG - Intronic
950204800 3:11071246-11071268 GGGACCGGGTGCCACAGAGCAGG + Intergenic
952956669 3:38562073-38562095 GGGCCCTGGTGCCAGTGGCCTGG + Intronic
953904915 3:46863742-46863764 GGGCCCTGCTGCCTCTCTGCAGG + Intronic
954105628 3:48408413-48408435 GGGCCCTCGTGTGACTCTGCAGG - Intronic
954292248 3:49655820-49655842 GGGCTGTGGTGGCACTGTACTGG - Exonic
954293983 3:49664072-49664094 GGGCCCTAAAGCCCCTGTGCTGG - Intronic
954327892 3:49873481-49873503 GGGCCCTGGTGCCACTGTGCTGG - Intergenic
954630308 3:52044446-52044468 GGGGCCTGGTGCCAGTGGTCTGG + Intergenic
954855969 3:53643708-53643730 GGCCCCAGGTGCCACGGTACGGG - Intronic
955001215 3:54929417-54929439 GGCCCTTCGTGCCACTCTGCAGG + Intronic
955558609 3:60164307-60164329 GGGCCCTGCTGCCATTTTGGTGG - Intronic
956459279 3:69454762-69454784 GGGACCTGGTGCCACGGAGCAGG - Intronic
961456931 3:127028986-127029008 CGGCCCTGGCGCCACTCTGGGGG - Exonic
961653700 3:128429955-128429977 GGCTGCTGGTGCCCCTGTGCAGG + Intergenic
961743373 3:129047312-129047334 GGGCCCTGCTGCCGCTGAGCAGG + Intergenic
967946402 3:194807597-194807619 TGGCTCTGGCGTCACTGTGCTGG - Intergenic
968600165 4:1504980-1505002 GGGCACTGGTGTCACTGTGGGGG + Intergenic
968869938 4:3236659-3236681 GGGCCGTGGTGCCTGTGAGCAGG + Intronic
969094304 4:4720239-4720261 GGGGCCTGGTGCAACTGCTCAGG + Intergenic
973996831 4:56467304-56467326 GCGTCCTGGTCCCACGGTGCGGG - Exonic
977885214 4:102245372-102245394 GGGACCTGGTGCCACAGAGCAGG - Intergenic
978000284 4:103548846-103548868 GGGCACTGTTACCACTGGGCAGG + Intergenic
980595379 4:134948177-134948199 GGGACCGGGTGCCACAGAGCAGG + Intergenic
981108695 4:140910906-140910928 GAGCCCTGGTGTCAGTGTGTGGG + Intronic
981390966 4:144191102-144191124 GGGTCCTGGTGCCACCCTTCGGG + Intergenic
981526108 4:145708256-145708278 GGAACCTAGTGCCACTGTGCAGG - Intronic
982963747 4:161875570-161875592 GGGCCCTTGAGCCACTGGTCGGG + Intronic
984644534 4:182205445-182205467 AGGCCCTGAGGCCAGTGTGCTGG - Intronic
984862539 4:184253275-184253297 GGGACCCGGTGCCCCTGAGCAGG - Intergenic
984882825 4:184425482-184425504 GGGCCTCGGGGCCACAGTGCAGG + Intronic
985566106 5:618530-618552 TGGGCCTGGGGCCACTGCGCTGG + Intronic
985772931 5:1824482-1824504 GGGCACAGGGGCCACGGTGCAGG - Intergenic
986919080 5:12662238-12662260 GGGACCGGGTGCCACGGAGCAGG - Intergenic
988500200 5:31777450-31777472 GGGCCCAGGCGCCACGGAGCAGG - Intronic
990042522 5:51390507-51390529 GGGGCCTGATGCCTCTGTGGAGG - Intronic
990665666 5:58069163-58069185 GGGACCGGGTGCCACAGAGCAGG + Intergenic
993098816 5:83511434-83511456 TGGGCCTGGTGCTCCTGTGCAGG + Intronic
996478647 5:123949215-123949237 GGGACCGGGTGCCACGGAGCAGG + Intergenic
997375557 5:133394685-133394707 GGGACCTGGTGCCACGGAGCAGG - Intronic
999364305 5:151011859-151011881 TGGCCCTGCTGCCACTGATCTGG + Intergenic
1001101585 5:168818810-168818832 GGGCCTTCCTGCCACTGTGTGGG + Intronic
1001155774 5:169271491-169271513 GTGGCCTGGGGCCACGGTGCTGG + Intronic
1001471948 5:172020732-172020754 GGGCCCTGCTGGCACATTGCTGG + Intergenic
1002473666 5:179452172-179452194 GGGCCCTGGTGCTTCTGTTCTGG - Intergenic
1002796077 6:471854-471876 GGGCTATGGTGCTGCTGTGCAGG + Intergenic
1003071641 6:2949696-2949718 GGCCCCTCTGGCCACTGTGCTGG - Intronic
1003267826 6:4581958-4581980 GGGCCCTGGTGGCTTTGTCCTGG - Intergenic
1005522547 6:26613527-26613549 GGTCCCTAGTGCCCATGTGCTGG - Intergenic
1005562957 6:27060112-27060134 TTGCCCTGTTGACACTGTGCAGG - Intergenic
1005661495 6:28003235-28003257 TTGCCCTGTTGACACTGTGCAGG + Intergenic
1005734355 6:28731773-28731795 GGGCTCTGGTGCAACGGTGTAGG - Intergenic
1005980355 6:30831613-30831635 GGGACCTGGTGCCCCTGAGTTGG + Intergenic
1007835583 6:44671517-44671539 GGACCCTGTTCCCACTGGGCAGG - Intergenic
1012494695 6:99821426-99821448 TTGCCCTGTTGACACTGTGCAGG + Intergenic
1016097146 6:140052212-140052234 GCTCCCTGGTGCCTCTGAGCTGG + Intergenic
1016183059 6:141170870-141170892 GGGCACAGGTGAGACTGTGCAGG + Intergenic
1016914194 6:149229597-149229619 GTGCCCTGCTGACTCTGTGCAGG - Intronic
1018685084 6:166298050-166298072 GGGCCATGGGTCCCCTGTGCTGG - Intergenic
1019051939 6:169190280-169190302 GGGCCCGGGAGACACTGGGCAGG - Intergenic
1019412183 7:911468-911490 GGGCGCTGGGGCCCCTGTGTGGG - Intronic
1019422547 7:957814-957836 GGTCCCTGGTGCAGCCGTGCGGG - Intronic
1019889275 7:3933005-3933027 GGCAGCTGGTGCCACCGTGCTGG + Intronic
1020091410 7:5344401-5344423 GGGCCCTGGTGCCTCTTTCCAGG + Intronic
1024363762 7:48497893-48497915 GTGCCCTGCTGCCACTGGGGTGG + Intronic
1024557804 7:50618427-50618449 GTGCACTTGTGCCACTGGGCTGG - Intronic
1025234340 7:57223892-57223914 GAGCACTGGTGCCAGGGTGCAGG - Intergenic
1027012337 7:74756898-74756920 ACGCCATTGTGCCACTGTGCAGG - Intronic
1029112025 7:98217458-98217480 GGGCCCTGGTGGCATTGGCCCGG + Exonic
1029423934 7:100485258-100485280 CGGGCCTGGTGGCACTGAGCAGG + Exonic
1032087417 7:128891341-128891363 GGGACCTGGTGGCACTGGGTGGG - Intronic
1032463935 7:132131811-132131833 GGACCCTGATGCCAGTCTGCAGG - Intronic
1032552691 7:132799915-132799937 GGCCTTTGGTGCCACTGTGTGGG - Intronic
1034478408 7:151302082-151302104 TGCCCTTGGTGCCACTGTACTGG + Intergenic
1034684027 7:152954068-152954090 GGGCCCTTGAGCCCCTATGCTGG - Intergenic
1035021006 7:155800428-155800450 AGGCCATGGTGCAACTCTGCTGG - Exonic
1035528054 8:329461-329483 GGGCACTGATCCCACTGTGAAGG + Intergenic
1036297655 8:7549788-7549810 GGGCCCTGGTGCCTGAATGCAGG + Intergenic
1036298959 8:7557436-7557458 GGGCCCTGGTGCCTGAATGCAGG + Intergenic
1036300264 8:7565086-7565108 GGGCCCTGGTGCCTGAATGCAGG + Intergenic
1036301572 8:7572731-7572753 GGGCCCTGGTGCCTGACTGCAGG + Intergenic
1036324917 8:7771230-7771252 GGGCCCTGGTGCCTGAATGCAGG - Intergenic
1036422834 8:8613924-8613946 TGGCTCTGGTGCCATTGTGGAGG - Intergenic
1036586130 8:10125458-10125480 TGGCCCTGGTACCACTGCACAGG - Intronic
1036846406 8:12173497-12173519 GGGCCCTGGTGCCTGACTGCAGG + Intergenic
1036867769 8:12415816-12415838 GGGCCCTGGTGCCTGACTGCAGG + Intergenic
1037558989 8:20055060-20055082 GGGACCTGGTGCCATGGAGCAGG - Intergenic
1037811659 8:22089982-22090004 GGGCCTGGGTGGCCCTGTGCGGG + Intronic
1037835624 8:22213308-22213330 GGGCCCTGGGGCCACACTGGTGG - Intergenic
1038584554 8:28777298-28777320 GGGCCACGGAACCACTGTGCTGG - Intronic
1039470432 8:37809983-37810005 GGGCACTGGTGTCAGTGTGCAGG - Intronic
1041299238 8:56393726-56393748 TGGCCCTGGTGTAACTGTGGTGG - Intergenic
1041871038 8:62634641-62634663 GGGCCCTGGTGGGGCTCTGCAGG + Intronic
1045429119 8:102096758-102096780 GGGCTCTTGAGCCCCTGTGCTGG + Intronic
1048866553 8:138765668-138765690 TTGCCCTGTTGACACTGTGCAGG + Intronic
1049237965 8:141522140-141522162 GGGCCCTGGTGCCACTGGGGTGG + Intergenic
1049381588 8:142319100-142319122 GGGCCCGGCTGCCACTGTTCTGG - Intronic
1053004326 9:34594084-34594106 GGGCCCTGGAGACACTGGGCTGG - Intergenic
1053274999 9:36776576-36776598 GTGCCCTGCTGCCACTGCCCTGG + Intergenic
1056243019 9:84668445-84668467 GGGCTCTGGTGCCCCCGCGCGGG - Intergenic
1057189177 9:93076903-93076925 GGGCCCTGGGGCCAAAGAGCAGG + Intronic
1058816428 9:108686782-108686804 TGGCCCTGGTTCCTCTGTTCAGG - Intergenic
1059350709 9:113662899-113662921 TGGCCCTGATGCCAGTGTCCTGG + Intergenic
1059664265 9:116431118-116431140 GGGCCCAGATGCCACTTTTCCGG + Intronic
1059666334 9:116449777-116449799 GTGCCCTGAGGCCACTGTGGTGG + Intronic
1060956463 9:127644515-127644537 GGATCCTGGTGCCTCTGTCCTGG + Intronic
1061238801 9:129357551-129357573 ATGCCCATGTGCCACTGTGCAGG + Intergenic
1062027429 9:134346995-134347017 GGGCCCAGCTGTCACTGTGGAGG + Intronic
1062043728 9:134415706-134415728 GTGCCCTCCTGCCAGTGTGCTGG - Intronic
1062595884 9:137299006-137299028 GGGCCCTGGGGGCCCTGTACCGG - Intergenic
1203376661 Un_KI270442v1:382630-382652 GGGCCCAGGGCCCACTGTCCTGG - Intergenic
1186865503 X:13717139-13717161 CTTACCTGGTGCCACTGTGCAGG - Intronic
1187896647 X:23988115-23988137 TGGCCATGGTGTGACTGTGCTGG - Exonic
1188444045 X:30238224-30238246 AGGCCCAGAAGCCACTGTGCTGG + Intergenic
1190464012 X:50707929-50707951 GGGCCCTGGACCCACCCTGCAGG + Intronic
1195160462 X:102165832-102165854 AGGCACTGGTGCAACTGTGGTGG - Intergenic
1196093726 X:111775970-111775992 AGCCCCAGGTGCCACTTTGCTGG - Exonic
1197793799 X:130280345-130280367 GGGCCCTTGAGCCACTGCTCAGG + Intergenic
1199824938 X:151489451-151489473 GGCCCCTGGTGCAAGTGTGCAGG - Intergenic
1199997725 X:153036877-153036899 GGGCACTGGTGTAACTGTGATGG - Intergenic
1200074372 X:153543917-153543939 GGGCCCTGGGGCCAGTGCGCGGG + Intronic
1200235459 X:154465867-154465889 GGGCCCTGTTGGCAGTGGGCAGG - Intronic
1200236292 X:154469372-154469394 CGGCCCTGGCGCCACTCTGTGGG - Exonic
1201232595 Y:11879585-11879607 GGGACCAGGTGCCACAGAGCAGG + Intergenic