ID: 954328603

View in Genome Browser
Species Human (GRCh38)
Location 3:49877257-49877279
Sequence CCTGGGGACCCGATGGATCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 82}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954328584_954328603 24 Left 954328584 3:49877210-49877232 CCCTCTGAGGCCACTCCCCAGCT 0: 1
1: 0
2: 1
3: 37
4: 332
Right 954328603 3:49877257-49877279 CCTGGGGACCCGATGGATCAGGG 0: 1
1: 0
2: 0
3: 8
4: 82
954328598_954328603 -7 Left 954328598 3:49877241-49877263 CCGGCTGAGGGGTGGTCCTGGGG 0: 1
1: 0
2: 4
3: 38
4: 328
Right 954328603 3:49877257-49877279 CCTGGGGACCCGATGGATCAGGG 0: 1
1: 0
2: 0
3: 8
4: 82
954328591_954328603 7 Left 954328591 3:49877227-49877249 CCAGCTGCTGGCTGCCGGCTGAG 0: 1
1: 0
2: 6
3: 32
4: 329
Right 954328603 3:49877257-49877279 CCTGGGGACCCGATGGATCAGGG 0: 1
1: 0
2: 0
3: 8
4: 82
954328590_954328603 8 Left 954328590 3:49877226-49877248 CCCAGCTGCTGGCTGCCGGCTGA 0: 1
1: 0
2: 1
3: 25
4: 229
Right 954328603 3:49877257-49877279 CCTGGGGACCCGATGGATCAGGG 0: 1
1: 0
2: 0
3: 8
4: 82
954328587_954328603 14 Left 954328587 3:49877220-49877242 CCACTCCCCAGCTGCTGGCTGCC 0: 1
1: 1
2: 14
3: 123
4: 893
Right 954328603 3:49877257-49877279 CCTGGGGACCCGATGGATCAGGG 0: 1
1: 0
2: 0
3: 8
4: 82
954328585_954328603 23 Left 954328585 3:49877211-49877233 CCTCTGAGGCCACTCCCCAGCTG 0: 1
1: 0
2: 5
3: 37
4: 374
Right 954328603 3:49877257-49877279 CCTGGGGACCCGATGGATCAGGG 0: 1
1: 0
2: 0
3: 8
4: 82
954328589_954328603 9 Left 954328589 3:49877225-49877247 CCCCAGCTGCTGGCTGCCGGCTG 0: 1
1: 0
2: 6
3: 51
4: 376
Right 954328603 3:49877257-49877279 CCTGGGGACCCGATGGATCAGGG 0: 1
1: 0
2: 0
3: 8
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954328603 Original CRISPR CCTGGGGACCCGATGGATCA GGG Intergenic
902278741 1:15359078-15359100 CCTGGGGACCTGATGGCATAGGG + Intronic
902845272 1:19105649-19105671 CCCGGGGAATCCATGGATCAGGG - Intronic
903316463 1:22511786-22511808 CCTGGGGAACAGAATGATCAAGG + Exonic
907659268 1:56376977-56376999 CCTGGGTCCCCCATGGTTCAGGG + Intergenic
915516470 1:156415708-156415730 CCTGGGGACCCTCTGGGTAAAGG - Intronic
915963121 1:160283556-160283578 TCTGGGGCCCCGAAGCATCAGGG + Exonic
917017950 1:170555804-170555826 CCTGGGGCCACTCTGGATCAGGG + Intergenic
920067078 1:203276683-203276705 CCTGGAGACCTGAGGGACCAAGG + Intergenic
921064243 1:211611524-211611546 CCTGGGGACCCAGCGGACCATGG - Intergenic
923713256 1:236403824-236403846 CCTGGTGAACTGATGCATCAGGG - Intronic
1074497294 10:113991351-113991373 CCTGGGGCCCAGAGAGATCAAGG - Intergenic
1075418392 10:122282469-122282491 CCAGGAGACCCCATGGGTCAGGG - Intronic
1075799153 10:125142042-125142064 CCTGGGGAGCCCAGGGAGCATGG + Intronic
1076047725 10:127307991-127308013 CCAGGAGACCCCATGGTTCAAGG - Intronic
1081772220 11:45657066-45657088 CCTTGGGACCCCATTCATCATGG - Intronic
1084174741 11:67417412-67417434 ACTCGGGACCCGATGGATCCAGG - Exonic
1084785183 11:71437982-71438004 CCTGGGGCCCCCATGGACCTCGG + Intronic
1084972609 11:72780173-72780195 CCAGGGGACCAGATGGGGCAGGG - Intronic
1089384873 11:118060842-118060864 CCTGGGGATCCAAAGGATGAGGG - Intergenic
1095910651 12:47423567-47423589 TCTGGGGTCCCAATTGATCATGG - Intergenic
1096491585 12:52015637-52015659 CCTGGGGGCCCGCTGGGTCATGG - Exonic
1099072336 12:78060945-78060967 TCTGGGGCCCTGATGGAGCAAGG - Intronic
1102116056 12:110403719-110403741 CGTGTGGACCCGATGGACCCCGG - Exonic
1108064511 13:46563948-46563970 CCTGAGAACCCTATGGATGAGGG - Intronic
1108595344 13:51944238-51944260 CCTGGGGACGCCATGGGTAATGG + Exonic
1113419814 13:110162379-110162401 CCTGGGGGCCCCATGGATCCTGG + Exonic
1119181861 14:72610783-72610805 GCTGGGGACCTGAGGGCTCAGGG + Intergenic
1121278423 14:92683274-92683296 GCTGGGGACCCGAGAGACCAGGG + Intronic
1123061364 14:105596186-105596208 CCTGTGGCCCCGATGGCTCTGGG + Intergenic
1123085818 14:105717097-105717119 CCTGTGGCCCCGATGGCTCTGGG + Intergenic
1125501422 15:40242156-40242178 CCTGGGGTCCTGAGGGCTCAGGG + Intronic
1127095893 15:55512072-55512094 CTTGGGGACGAGATGGTTCATGG - Intergenic
1128235014 15:66061167-66061189 CCTGGGGACCTTTTGGATCAGGG + Intronic
1139346055 16:66304589-66304611 CCTGGGGTCCCCATGGAGCTTGG - Intergenic
1142182132 16:88676467-88676489 CCTTGGGCTCCGCTGGATCAAGG - Intergenic
1143120374 17:4602940-4602962 AGTGGGGACCATATGGATCATGG + Intronic
1144708350 17:17384559-17384581 CCTGGTGACCCCATGGACCATGG - Intergenic
1146884225 17:36460143-36460165 CCTGGGGACCCCATAAATGAAGG - Intergenic
1148074659 17:44928426-44928448 CCAGGGGTCCCGATGGCCCATGG - Exonic
1148846927 17:50534858-50534880 CCTGGGGACCAGTTGGGGCACGG + Intronic
1150248270 17:63691873-63691895 CCTGGGGACTCCATGTATCCTGG - Intronic
1153972055 18:10235886-10235908 CCTGGGGACCATGTGGACCAAGG - Intergenic
1157723683 18:49945786-49945808 CCTGGGGGCTCCATGGACCAGGG + Intronic
1160831317 19:1106026-1106048 CCTGGGGACAGGATGGCTCGGGG + Intronic
1163953972 19:20616929-20616951 CCTGGGCACAAGATGGGTCACGG + Intronic
1165454774 19:35904045-35904067 CCTGGGGACCCCCTGCTTCAGGG - Intronic
1166386866 19:42387306-42387328 GCTGGGGACCCGCGGGAGCAGGG - Intronic
1167436460 19:49481320-49481342 ACTGGGGACCTGAAGGAGCAAGG + Intronic
925388396 2:3479289-3479311 CCTGGGGTCCTGCTGGACCATGG - Exonic
932733766 2:74239670-74239692 CCTGGGGACGGGCTGGTTCAAGG + Intronic
935942375 2:108254197-108254219 CCTGGGGAGGAGATGGAGCAGGG - Intronic
936918218 2:117661585-117661607 CCTGGGGACCCGAGGGAAGAGGG + Intergenic
944655672 2:201874533-201874555 CCTGGGTACCGGATGAATCCTGG - Intronic
1169928692 20:10808925-10808947 CCTAAGGACCTGATGCATCAGGG + Intergenic
1171391499 20:24804340-24804362 CCTGGAGACCCAGTGGAGCAGGG + Intergenic
1175260756 20:57672732-57672754 CCTGGGAGCCCGATGGTGCAAGG - Intronic
1175520435 20:59599344-59599366 CCTGGGGAGCTGATGGGCCAAGG - Intronic
1176177314 20:63734904-63734926 CCTGGGAACCCGATGGCTGCGGG - Intronic
1180950786 22:19719580-19719602 CCTGGGGACAGGATGGAACAGGG - Exonic
1184138886 22:42566129-42566151 CCTGGGGTCCAGCTGGAGCAGGG - Intronic
1184496186 22:44843014-44843036 CCTGTGGACTCTAAGGATCAGGG + Intronic
953632291 3:44629304-44629326 CCTGGGGTCCAGATGTCTCATGG - Exonic
954328603 3:49877257-49877279 CCTGGGGACCCGATGGATCAGGG + Intergenic
954635970 3:52071107-52071129 CGTGGGGGCCCCATGGGTCACGG + Intergenic
958881884 3:99681424-99681446 CCTTTGGACCCTATGGAACAAGG - Intronic
961383096 3:126508560-126508582 CCTGGGGGCCCAATGGGACAAGG + Intronic
968480310 4:830297-830319 CCTGGGTCCCTGGTGGATCAGGG - Intergenic
969149988 4:5161085-5161107 CCTGGGAACCCGAGGTATAATGG - Intronic
969290963 4:6239775-6239797 CCTGGGGTCACCTTGGATCAGGG + Intergenic
972655390 4:41059136-41059158 CTTGGGGACCTGATGCTTCATGG - Intronic
978953387 4:114588969-114588991 CCTGGGCACAGGATGGGTCATGG - Intergenic
991926605 5:71711826-71711848 CCTGGGGACAGGATGGAGGAAGG + Intergenic
997120112 5:131164951-131164973 GCTGGGGGCCCGCTGGACCAGGG + Intronic
998103607 5:139454713-139454735 CCTGGGGACCCTCCGGCTCATGG + Intronic
1001483385 5:172103491-172103513 CCTGGAGGCCGGATGTATCAGGG + Intronic
1003157850 6:3611467-3611489 CCTGAGGACCTGGTGGATGAGGG - Intergenic
1015811950 6:137169627-137169649 CCTGGGCACAAGATGGGTCATGG + Intronic
1021841657 7:24726128-24726150 CCTGGGGAGCTGATGGATGCTGG - Intronic
1033610707 7:142961248-142961270 CATGGGGACCCCAAGGGTCAGGG + Intronic
1038389343 8:27180481-27180503 CCTGGGGACCTGAAGGACCCAGG + Intergenic
1045432042 8:102123792-102123814 CCGGGGCACCCGCTGGATCCCGG - Intronic
1045692595 8:104774908-104774930 CCTGGGGACCAGAAGTATGAAGG - Intronic
1049859749 8:144890360-144890382 CCTGGGGACTCCGAGGATCACGG + Exonic
1051716675 9:19991938-19991960 CTTGGGGACTGGATGGATGAGGG + Intergenic
1053345984 9:37378610-37378632 ACTGGGGTCCCGATTCATCATGG - Intergenic
1059398413 9:114053464-114053486 CCTGGGGACCACATGGCTCAAGG - Exonic
1060211291 9:121712088-121712110 CCAGGGGAGCCGATGGTTCCTGG + Intronic
1060742245 9:126106951-126106973 CCTGGGGACAAGGTGGCTCAGGG + Intergenic
1061242669 9:129383499-129383521 GTGGGGGACCCGATGGATCCTGG + Intergenic
1186106434 X:6212480-6212502 CCAGAGGACCCCATTGATCAGGG - Intronic
1190343409 X:49315423-49315445 CCTGGGCACAGGATGGGTCATGG + Intronic