ID: 954330819

View in Genome Browser
Species Human (GRCh38)
Location 3:49889381-49889403
Sequence GGGTTAGAACAGAGAGAACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 227}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954330819_954330822 0 Left 954330819 3:49889381-49889403 CCTGGTTCTCTCTGTTCTAACCC 0: 1
1: 0
2: 1
3: 14
4: 227
Right 954330822 3:49889404-49889426 AGCAGACCTAGCCACAGCTCAGG 0: 1
1: 0
2: 1
3: 16
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954330819 Original CRISPR GGGTTAGAACAGAGAGAACC AGG (reversed) Intronic
901735554 1:11310100-11310122 GGGTGATACAAGAGAGAACCAGG - Intergenic
902512806 1:16975395-16975417 GGGATAGCCCAGACAGAACCTGG + Intronic
904305392 1:29585545-29585567 GGGTTGGAAGACAGAGCACCAGG - Intergenic
904886420 1:33742077-33742099 GGGTTAGGAAAGACAGAACTAGG + Intronic
907182730 1:52585047-52585069 AGGCTATAACAGAGAGATCCAGG + Intergenic
907841624 1:58163554-58163576 GGGTCAGAACAGGGGGAATCTGG + Intronic
907993457 1:59605735-59605757 TGTTTAGTAAAGAGAGAACCGGG + Intronic
909044913 1:70698390-70698412 AGGTGAGAAGAGAGAGAAGCTGG - Intergenic
910606606 1:89092163-89092185 TGGTTAGACCAGAGTGAACTTGG - Intergenic
912082274 1:105951696-105951718 GTGGTAGTACAGAGAGGACCAGG + Intergenic
912525176 1:110277613-110277635 GGTTTAGAACAGCGTGTACCAGG - Intronic
913107783 1:115630463-115630485 GGATTAGAAGGTAGAGAACCTGG - Intergenic
913320049 1:117581784-117581806 GGGTTAGTGCAGAGTGAAGCTGG + Intergenic
913387697 1:118277772-118277794 GGGTTAGAGCAGAGGGAAGAAGG + Intergenic
915118489 1:153614584-153614606 GGGGGAGAACAGAGAGGAGCTGG - Exonic
915859513 1:159429376-159429398 CAGTTAGGACAGAGAGACCCTGG + Intergenic
918480944 1:184975708-184975730 GGGCTGGAACAGAGAGAACAAGG - Intergenic
918597998 1:186315752-186315774 GAGTGAGAACAGAGAGTAGCAGG - Intronic
920959541 1:210652176-210652198 GGATTGGAAGAGAGAGAACAGGG + Intronic
922137875 1:222850331-222850353 GGGTTTAAAAAGAGAGAACAAGG - Intergenic
924264358 1:242266814-242266836 GCCTTAGAAAAGAGAGAAGCTGG + Intronic
1063802960 10:9602457-9602479 GGGTTAAAACAAAAAGAACCTGG + Intergenic
1064972979 10:21084809-21084831 GCACTAGCACAGAGAGAACCCGG + Intronic
1065962178 10:30742622-30742644 GTGGTTGAACACAGAGAACCAGG - Intergenic
1069041645 10:63701790-63701812 GGGTTAGATCAGAGATGACCTGG - Intergenic
1069910046 10:71753476-71753498 GGGATAGGACAGAGAGGACCAGG - Intronic
1071056775 10:81520511-81520533 GTGAGAGAACAGAGAGAAACCGG + Intergenic
1072449973 10:95532129-95532151 GGGTTGGGACTGAGGGAACCTGG - Intronic
1072903969 10:99433675-99433697 GGGTCAGAAGAGAAAGAGCCTGG + Intergenic
1074136368 10:110630389-110630411 GGGTTCCCACAAAGAGAACCTGG - Intergenic
1077842909 11:5994366-5994388 TGGGAAGAACAGAGAGAAGCTGG - Intergenic
1079032296 11:16994678-16994700 GGGATAGCACAGGCAGAACCAGG - Intronic
1080699530 11:34632684-34632706 GGGCAAGAGCAGAGAGAGCCGGG - Intronic
1082030511 11:47600134-47600156 GGGTTTCAAGAGAGAGATCCAGG - Intergenic
1082188558 11:49213742-49213764 TGGCAAGAACAGAGAGAAACTGG - Intergenic
1083261965 11:61528128-61528150 GGGTTGCAGCCGAGAGAACCTGG - Exonic
1084196351 11:67525160-67525182 GGGCTAGCACAGAGGGACCCTGG - Intergenic
1084196368 11:67525203-67525225 GGGCTAGCACAGAGGGACCCTGG - Intergenic
1086677964 11:89632955-89632977 TGGCAAGAACAGAGAGAAACTGG + Intergenic
1087508776 11:99062600-99062622 GGGATAGGACAGAGATACCCAGG + Intronic
1087590235 11:100177893-100177915 AGGTCAGAAGAGAGAGAACTTGG - Intronic
1089571294 11:119412309-119412331 GAGTTAAAACAGAGAGGACTGGG - Intergenic
1090073288 11:123562238-123562260 GGGCCAGAAAAGAGAGAAGCAGG - Intronic
1091492435 12:944633-944655 GGGGTAGAAGGGAGAGAGCCTGG + Intronic
1094793319 12:33939813-33939835 GGGTTACAAAAGAGAGAAATAGG - Intergenic
1095104593 12:38216571-38216593 GGGTTACAAAAGAGAGAAATAGG - Intergenic
1095614204 12:44169324-44169346 TGGTGAGAACATAGAGAAACTGG - Intronic
1095886124 12:47190342-47190364 GGGTTAGAACAGATGGAACTTGG - Intronic
1096504740 12:52085654-52085676 GGGTTAGCACAGAGTCAAACAGG - Intergenic
1097330037 12:58323117-58323139 TGGCTGGAACAGAGAGAACGAGG - Intergenic
1097391809 12:59024355-59024377 GGTTTAAACCAGAGAGAACAAGG - Intergenic
1098052595 12:66470301-66470323 GGACTGGAACAGAGAGAAGCAGG - Intronic
1098329404 12:69337048-69337070 GGGTCAGAAGAGAGAAAACCTGG + Intergenic
1101593799 12:106145703-106145725 GGTTTAGAACAGAGAAAACAAGG - Intergenic
1102312995 12:111861767-111861789 GGGTTGGAACAGAGACCACAGGG - Intronic
1102454236 12:113061578-113061600 CGGGTTGAACAGAGAGAATCTGG + Intronic
1102784905 12:115596482-115596504 AGATAAGAACAGAGAGAACGGGG + Intergenic
1103281345 12:119760304-119760326 GGATTAGAAAAGAGACAAACAGG + Intronic
1106239716 13:27901446-27901468 GGGAAAGAAGAGAGAGAAGCAGG - Intergenic
1106990172 13:35409352-35409374 GTGGGAGAACAGAGAGAATCAGG + Intronic
1107349573 13:39500069-39500091 GGGTCAAGACAGAGAGAAACTGG - Intronic
1107409629 13:40146517-40146539 GGGTGAGAAAAGAGAGCATCAGG + Intergenic
1107451529 13:40514553-40514575 GGGCTGGAACAGAGAGAAGAAGG + Intergenic
1113411160 13:110091116-110091138 GGGTTAGAACACAGCTGACCAGG + Intergenic
1113411171 13:110091225-110091247 GGGTTAGAACACAGCTGACCAGG + Intergenic
1115627290 14:35206479-35206501 GGGTTTGAACAGAGTAGACCTGG - Intronic
1115819351 14:37197644-37197666 GGATTAGAAGAGGGAGAACGCGG - Intergenic
1118446058 14:65852148-65852170 GGTTTAGAGTAGAGAGAAGCAGG + Intergenic
1121906399 14:97750227-97750249 GGATTGGAACAAAGGGAACCAGG + Exonic
1122141665 14:99666612-99666634 GGGTTGGAACAGAGGAGACCAGG + Intronic
1202934431 14_KI270725v1_random:72234-72256 AGGTTAAACCAGAGGGAACCAGG - Intergenic
1124214277 15:27793698-27793720 GGTTAAGAACAGAGATAACAGGG + Intronic
1124788237 15:32701731-32701753 GGATTAGAACAGAGAAACCTGGG + Intergenic
1129348244 15:74938035-74938057 GGCTGAGGACAGAGAGAAGCCGG + Exonic
1129357145 15:74998767-74998789 AGGTTAGGGCAGAGAGAATCTGG - Intronic
1130514916 15:84618951-84618973 GGGTCAGAACAGTGTGATCCAGG + Intronic
1130828200 15:87571399-87571421 TGGTTACAACACAGAGGACCTGG + Intergenic
1134330407 16:13245689-13245711 AGGTTGAATCAGAGAGAACCAGG - Intergenic
1140062780 16:71585885-71585907 GGGCTGGAACAGAGAGAAATGGG - Intergenic
1140081558 16:71752767-71752789 GTGTTAGAAAATAGAGAAACAGG - Intronic
1140783747 16:78319756-78319778 GGGGTAGCACAGAGAGACCTCGG - Intronic
1141784761 16:86191718-86191740 GGCTTAGAACAGAAAGGACACGG - Intergenic
1142338397 16:89505413-89505435 GGGCTAGAGCTGAGGGAACCTGG + Intronic
1143709143 17:8721874-8721896 GGGTGAGAACAGAGGCAAGCAGG - Intergenic
1145244383 17:21258675-21258697 TGGCTAGGACAGAGAGACCCTGG + Intergenic
1145758435 17:27409722-27409744 GGCTTGGGCCAGAGAGAACCTGG + Intergenic
1151768647 17:76145502-76145524 GTGTGAGAACGGAGAGAAGCAGG + Intronic
1152424983 17:80213909-80213931 GGCTTAGAACAGACAGACCGGGG + Intronic
1156269711 18:35519641-35519663 GGGGTAGAACAAAGGGAACCAGG - Intergenic
1156519799 18:37712730-37712752 ATGTGAGAACAGAGAGTACCTGG + Intergenic
1156818115 18:41336542-41336564 GGATTACAACATAGAGAAACAGG + Intergenic
1158407313 18:57171588-57171610 GAATTAGAAAAGGGAGAACCTGG + Intergenic
1158899524 18:61949810-61949832 GGGTGAGCACAGAGAGAAGTGGG - Intergenic
1160570873 18:79816793-79816815 GGGTTAGCAGAGAAAGAAACCGG + Intergenic
1161495089 19:4581985-4582007 GAGTTTGAACAGAGGGGACCAGG - Intergenic
1164820017 19:31242751-31242773 CAGTTCTAACAGAGAGAACCTGG + Intergenic
1166157846 19:40928106-40928128 GGGTTAGGACAGCAAGAAACAGG + Intergenic
925014091 2:508619-508641 GGGTTCACACAGAGAGACCCAGG + Intergenic
925198740 2:1949282-1949304 GGATTAGAAATGAGAAAACCTGG + Intronic
926350086 2:11986305-11986327 GGGCTAGAACAGAGAGAATGAGG - Intergenic
928138198 2:28704703-28704725 GGGTTTGGAGTGAGAGAACCTGG - Intergenic
928267733 2:29825916-29825938 GGGTTAGAACAGAGTGACTATGG + Intronic
928705230 2:33942131-33942153 GGGAGAGAACAGAGAGGATCAGG + Intergenic
934974022 2:98787727-98787749 GGCTTAGCTCAGAGAGACCCAGG - Intergenic
935781879 2:106515501-106515523 GGCTTAGAGCAGAAAGAACCTGG - Intergenic
938222032 2:129577825-129577847 GGGATAGAATAGAGAGGACAAGG - Intergenic
938681135 2:133691314-133691336 GGGTAAGAACAGAAAGATTCAGG - Intergenic
940579157 2:155554298-155554320 GGGGGAGAAAAGAGAGAACAGGG + Intergenic
941457123 2:165722186-165722208 GGGTTAGCACAGAGTGCACAGGG - Intergenic
942100182 2:172572770-172572792 GGGCTAGAAGAGAGAAAAACGGG - Intronic
942950423 2:181714784-181714806 GGATTAGAACAGATAGGACTGGG + Intergenic
943430177 2:187789892-187789914 AGCTTATAAGAGAGAGAACCAGG + Intergenic
943519573 2:188931574-188931596 GTGTTGTAAGAGAGAGAACCTGG + Intergenic
943755274 2:191550687-191550709 TGGGTAGAAGGGAGAGAACCAGG + Intergenic
946009409 2:216552976-216552998 AGGCCAGAACAGAGAGAAACAGG - Intronic
946688778 2:222295600-222295622 GGAATACAAAAGAGAGAACCCGG - Exonic
947010534 2:225561380-225561402 TGGCTGGAACAGAGTGAACCTGG + Intronic
948323746 2:237094051-237094073 GGGTTGGCAGAGAGTGAACCAGG - Intronic
1169394198 20:5215257-5215279 GGGTTGAAACAGACAGGACCAGG + Intergenic
1170284821 20:14695319-14695341 GGGTAAAGACAGAGAGAAACAGG - Intronic
1171191171 20:23160822-23160844 GGTTTAGAGCAGGGAGAAACTGG + Intergenic
1171210929 20:23316380-23316402 GAGGTAGAACACAGAGAAGCTGG - Intergenic
1172181049 20:33003778-33003800 GGGTGAGAAAAGAAATAACCAGG - Intronic
1172503036 20:35440492-35440514 GGGTTGAACCAGAGAGAGCCTGG - Intronic
1172641050 20:36440710-36440732 GGGTTTGCAAAGGGAGAACCAGG + Intronic
1173304602 20:41836239-41836261 GGGTAGGAACAGAGAGATTCGGG + Intergenic
1174451450 20:50623354-50623376 GGATTAGAGAACAGAGAACCTGG + Intronic
1174851480 20:53999581-53999603 GGGTTACAAAAGAGTGACCCAGG - Intronic
1175513831 20:59555285-59555307 GGGATATAGCAGAGAGAACTTGG + Intergenic
1175822387 20:61917375-61917397 GGGTAAGACGAGAAAGAACCTGG - Intronic
1177205424 21:18005154-18005176 GGGTTAGAACCCAGAGGATCTGG - Intronic
1177997434 21:28118468-28118490 GTGTTAGAACGGAGAGCAACAGG + Intergenic
1178678341 21:34649741-34649763 TGGTTAGAGCAGAGGGAGCCAGG + Intergenic
1179389889 21:40978237-40978259 TGTTTAGAAAAGAGAGTACCTGG + Intergenic
1182069670 22:27454784-27454806 TGGTTAGAACAAAGAGAATGAGG - Intergenic
1182978952 22:34649860-34649882 GGATTAGAACACAGAGCATCTGG - Intergenic
1183731665 22:39621876-39621898 GGATGAGGACAGAGAGAAGCTGG - Intronic
1185109536 22:48893409-48893431 GGGTGTGGACAGAGAGACCCGGG + Intergenic
949491120 3:4589925-4589947 TGGTTAGAGCTGAAAGAACCAGG - Intronic
950444621 3:13029360-13029382 GGGTTAATACAGATAGAACATGG + Intronic
950526609 3:13528235-13528257 GAGTAACCACAGAGAGAACCCGG + Intergenic
950662039 3:14472605-14472627 GGGTTATGACAGGGACAACCAGG + Intronic
951318161 3:21212705-21212727 GGGGTAGAAGAGAGAGCATCAGG - Intergenic
952930802 3:38359807-38359829 GTGTTAGGAAAGAGAAAACCAGG - Intronic
953689718 3:45107505-45107527 GGGTTAGAAAAGACACAACACGG - Intronic
953851237 3:46466963-46466985 TGGCAAGAACACAGAGAACCTGG + Intronic
953929994 3:47001105-47001127 GGGTGAGCACTGAGAAAACCTGG - Exonic
954330819 3:49889381-49889403 GGGTTAGAACAGAGAGAACCAGG - Intronic
960497509 3:118393502-118393524 TGGTGAGAATACAGAGAACCTGG + Intergenic
960502656 3:118455577-118455599 GGGAGAGAACAGAGAAAAGCAGG - Intergenic
961904547 3:130249067-130249089 GGATGGGAACAGAGAGAACATGG - Intergenic
961954547 3:130788056-130788078 GGGTAGGAGTAGAGAGAACCTGG - Intergenic
962880392 3:139571566-139571588 GGGTCTGAACAGAGAGAAAGAGG + Intronic
964848374 3:161068261-161068283 TGGTTAGAAGAGACAGAGCCAGG + Intronic
966619981 3:181953070-181953092 GGGTAAGAACAGATAGCACAGGG + Intergenic
967960130 3:194913698-194913720 GGGTGGGCACAGAGAGGACCAGG + Intergenic
969677796 4:8624276-8624298 GGGTTAGAAACCAGAAAACCGGG + Intergenic
969678751 4:8629917-8629939 GGGTTAGAAACCAGAAAACCGGG + Intergenic
969679707 4:8635559-8635581 GGGTTAGAAACCAGAAAACCGGG + Intergenic
970161732 4:13195932-13195954 GGGCTAGAACAGAGTGTTCCAGG - Intergenic
978409992 4:108416051-108416073 AGGTTGGAACAGAGAAAAACTGG + Intergenic
978625532 4:110680647-110680669 GAGTTAGAACAGAGGGGAGCAGG + Intergenic
981918728 4:150063455-150063477 TGGTCAGAACAAAGAGAATCAGG - Intergenic
988548558 5:32179588-32179610 GGGTTAAAACAGAAAGACTCTGG - Intergenic
990535998 5:56723108-56723130 GGCTAAGAACAGAGATAATCAGG - Intergenic
990894695 5:60686116-60686138 GGCTTTGCACAGAGACAACCTGG - Intronic
997011865 5:129888016-129888038 GGGTTAGAGCAGAGGCTACCAGG + Intergenic
997824459 5:137093840-137093862 AGGTCAGATCATAGAGAACCTGG + Intronic
998173106 5:139883811-139883833 GGGGCAGAACAGGGAGAACAGGG + Intronic
998235486 5:140395147-140395169 GGGTTAGAACAAGGAGATACTGG - Intergenic
999661556 5:153869089-153869111 GCATTAGAACAGAGAGAATTTGG - Intergenic
999662500 5:153880423-153880445 AGGACAGAACAGAGAAAACCTGG + Intergenic
1001535804 5:172497078-172497100 GGGTTGGAGAACAGAGAACCTGG + Intergenic
1002539838 5:179899156-179899178 GGGTGAGAACAGAGAGTGGCGGG + Intronic
1002838070 6:882331-882353 AGGACAGAACAGAGAGAGCCAGG + Intergenic
1003138552 6:3453069-3453091 GGGTTAGAACACACAGGGCCTGG + Intronic
1003205829 6:4010337-4010359 GAGTGAGAACAGAGAAATCCAGG + Intergenic
1005434453 6:25793334-25793356 GGGATAGAACAGTGAGAGCTGGG + Intronic
1006766927 6:36514531-36514553 GGATAAGAACAGTGAGATCCAGG + Intronic
1006774743 6:36583566-36583588 TGGATAGAACAGAAAGAAACAGG + Intergenic
1006881454 6:37343595-37343617 GGGGTACAACAGAGAGAGCTTGG + Intergenic
1007996708 6:46315546-46315568 GGGTTAGAGCAGAGTGAAAGGGG + Intronic
1008927972 6:56907179-56907201 TGGTTAGAACAAACAAAACCAGG - Intronic
1009274973 6:61664017-61664039 GGGTTAAAATAGAAATAACCGGG + Intergenic
1011281941 6:85686501-85686523 GGGAAAAAACAGAGAGAACAGGG + Intergenic
1011549772 6:88520489-88520511 GGGTAAGAGAAGACAGAACCTGG + Intergenic
1012116500 6:95304941-95304963 GGGATAGAACAGTAGGAACCGGG - Intergenic
1012601454 6:101102590-101102612 GGGTGGGAACAGAGTGAAGCTGG - Intergenic
1013614874 6:111833509-111833531 GAGTGAAAACAGAGAGAAACGGG + Intronic
1014258105 6:119184507-119184529 AGGATAGAACACAGAGAATCAGG + Intronic
1015171973 6:130264228-130264250 GGGATAGAACACAGAGAGCTTGG - Intronic
1017883817 6:158581990-158582012 GTGTGAGAACAGAGAGAAGGGGG - Intronic
1020444606 7:8256099-8256121 GAGGTAGAATGGAGAGAACCTGG - Intronic
1020712362 7:11623799-11623821 AGGTTAGAACAAACAGAGCCTGG + Intronic
1021642076 7:22747916-22747938 GGGTAAGAATGGAGAGAACGAGG + Intergenic
1022234983 7:28452719-28452741 GGGTGAGAAGAGAGAGAGGCTGG - Intronic
1023138819 7:37080781-37080803 GGGCTGAAGCAGAGAGAACCAGG - Intronic
1026489403 7:70849830-70849852 GGGTGAGAAGAGAGAGAAGGGGG - Intergenic
1028271593 7:88797530-88797552 GGATTAAACCAGAGAGAACATGG + Intronic
1029515250 7:101019686-101019708 GGGTTAGAAAAGAGACAAAGGGG + Intergenic
1029690927 7:102180856-102180878 GGCTGAGGACAGACAGAACCAGG - Intronic
1030148578 7:106380477-106380499 GGGAGAAAACAGAGAGAACCTGG + Intergenic
1031027628 7:116697374-116697396 GGCTTAGAACAGAGAGATCCTGG - Intronic
1032500692 7:132397588-132397610 AGACAAGAACAGAGAGAACCAGG + Intronic
1032979524 7:137265597-137265619 GGGATATAGCAGAGAGAGCCTGG + Intronic
1033670784 7:143490826-143490848 GGGAGAGAGCAGAGAGGACCTGG + Intergenic
1034491036 7:151393108-151393130 GGGTATGAAGAGAGAGCACCCGG - Intronic
1035254852 7:157619748-157619770 AGGTCAGAACAGTGAGAAGCTGG - Intronic
1036832304 8:12030436-12030458 TGGTTAGAACAGAGGGAAGTAGG - Intergenic
1037200772 8:16249774-16249796 GGGTGAGAACTGACTGAACCAGG - Intronic
1039468835 8:37801409-37801431 GGCTTATGACAGGGAGAACCTGG + Intronic
1041165649 8:55090000-55090022 GGTTTACAACAAAGAGATCCAGG - Intergenic
1041227183 8:55712324-55712346 GGGATATAGCAGAGAGAACTTGG - Intronic
1042101234 8:65277682-65277704 GGGTGAGGACGGAGAGAAACTGG + Intergenic
1043400198 8:79877084-79877106 GGGTTAGTGCAGAGAGGACAAGG - Intergenic
1043549491 8:81353950-81353972 GGGTTAGAAAAGAGGGAAAGAGG - Intergenic
1044097809 8:88089693-88089715 GGGTTAGAAAAGAAAGCACTAGG + Intronic
1044130534 8:88518143-88518165 TGGTTAGAACAGAGTGAGCAAGG - Intergenic
1047164463 8:122421510-122421532 AGGGTAGAACACAGAGCACCAGG + Intergenic
1047803952 8:128339283-128339305 GAGTTAGGACAGAGAAAAGCAGG + Intergenic
1048605716 8:135966672-135966694 GCATCAGAACAGAGGGAACCTGG + Intergenic
1048613554 8:136050092-136050114 GGGTTGGAAGAAAGGGAACCTGG - Intergenic
1048905354 8:139082426-139082448 GAGTCAGAACAGAAAGAACATGG + Intergenic
1049205400 8:141361253-141361275 GGGACAGAACAGAGGGAACGAGG + Intronic
1052364617 9:27598018-27598040 GGACAGGAACAGAGAGAACCAGG - Intergenic
1053071187 9:35103002-35103024 GGGTCAGGACAGAGATTACCTGG - Intronic
1054916673 9:70500867-70500889 TGGCTAGAACTGAGAGAAGCAGG + Intergenic
1057320862 9:94011265-94011287 AGGCTAGATCAGAGTGAACCGGG + Intergenic
1060752725 9:126184131-126184153 GGGCTTGAAGAGAGAAAACCAGG + Intergenic
1061145958 9:128798596-128798618 GGGTTAGATCTGAGAGACTCTGG + Intronic
1185642197 X:1594517-1594539 GTGTCAGAACCAAGAGAACCCGG + Intronic
1186368106 X:8917254-8917276 GGGTAAGAAAAGAAAGAAACAGG - Intergenic
1187987033 X:24825279-24825301 GTCTTAGAACAGGTAGAACCTGG + Intronic
1188872488 X:35390065-35390087 GGGCTAGAACAAAGGGAACAAGG + Intergenic
1191033628 X:56002232-56002254 GGGTTAGCAAAGAGAATACCAGG - Intergenic
1192680050 X:73242664-73242686 GGCTCAGAACAGAGAGACACAGG + Intergenic
1194024611 X:88736173-88736195 GGCATGGAACAGAGAGAACCTGG + Intergenic
1194499818 X:94668132-94668154 GGGTCAGAACAAAAAGAACCTGG - Intergenic
1195785084 X:108510629-108510651 GAATTAGAACAGAGAGAAAAGGG + Intronic
1198237378 X:134747994-134748016 GTGATAGCACAGAGAGAACCTGG - Intronic
1199392736 X:147299835-147299857 TGGTTAGAACAGGGTGAACAAGG - Intergenic
1199612290 X:149628811-149628833 GTGTGAGAAGAAAGAGAACCAGG + Intronic
1199649377 X:149938339-149938361 CGGTGAGAAGAGAGAGCACCCGG + Exonic