ID: 954331953

View in Genome Browser
Species Human (GRCh38)
Location 3:49895924-49895946
Sequence TGGACCTCCCTGGGAAACAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 400
Summary {0: 1, 1: 0, 2: 1, 3: 40, 4: 358}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954331953_954331966 25 Left 954331953 3:49895924-49895946 CCCGTGTTTCCCAGGGAGGTCCA 0: 1
1: 0
2: 1
3: 40
4: 358
Right 954331966 3:49895972-49895994 CACCATCCTGGCCAAGCTGCAGG 0: 1
1: 0
2: 0
3: 67
4: 637
954331953_954331967 26 Left 954331953 3:49895924-49895946 CCCGTGTTTCCCAGGGAGGTCCA 0: 1
1: 0
2: 1
3: 40
4: 358
Right 954331967 3:49895973-49895995 ACCATCCTGGCCAAGCTGCAGGG 0: 1
1: 0
2: 3
3: 114
4: 381
954331953_954331960 0 Left 954331953 3:49895924-49895946 CCCGTGTTTCCCAGGGAGGTCCA 0: 1
1: 0
2: 1
3: 40
4: 358
Right 954331960 3:49895947-49895969 GCTGGGCTGCCTACCTGCAATGG 0: 1
1: 0
2: 1
3: 13
4: 154
954331953_954331969 30 Left 954331953 3:49895924-49895946 CCCGTGTTTCCCAGGGAGGTCCA 0: 1
1: 0
2: 1
3: 40
4: 358
Right 954331969 3:49895977-49895999 TCCTGGCCAAGCTGCAGGGATGG 0: 1
1: 2
2: 1
3: 44
4: 406
954331953_954331962 2 Left 954331953 3:49895924-49895946 CCCGTGTTTCCCAGGGAGGTCCA 0: 1
1: 0
2: 1
3: 40
4: 358
Right 954331962 3:49895949-49895971 TGGGCTGCCTACCTGCAATGGGG 0: 1
1: 0
2: 0
3: 13
4: 154
954331953_954331961 1 Left 954331953 3:49895924-49895946 CCCGTGTTTCCCAGGGAGGTCCA 0: 1
1: 0
2: 1
3: 40
4: 358
Right 954331961 3:49895948-49895970 CTGGGCTGCCTACCTGCAATGGG 0: 1
1: 0
2: 0
3: 9
4: 128
954331953_954331965 13 Left 954331953 3:49895924-49895946 CCCGTGTTTCCCAGGGAGGTCCA 0: 1
1: 0
2: 1
3: 40
4: 358
Right 954331965 3:49895960-49895982 CCTGCAATGGGGCACCATCCTGG 0: 1
1: 0
2: 0
3: 9
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954331953 Original CRISPR TGGACCTCCCTGGGAAACAC GGG (reversed) Intronic
901721951 1:11205937-11205959 ATCACCTCCCTGGGATACACTGG + Intronic
901802009 1:11713687-11713709 AGGACCAGCCTGGGCAACACGGG + Intronic
903178354 1:21593462-21593484 TGGACCTCCATGGCCAACCCTGG - Intergenic
903413392 1:23165473-23165495 GAGACCAGCCTGGGAAACACAGG + Intronic
904051127 1:27639537-27639559 TGTACCTGCCTGGAAAACCCAGG + Intergenic
904414876 1:30354252-30354274 GAGACCACCCTGGGAAACACAGG - Intergenic
904760124 1:32797170-32797192 GAGACCTGCCTGGGCAACACAGG + Intronic
904849106 1:33443769-33443791 GGGCCCTCCCTGGGAAATGCTGG - Intergenic
905031646 1:34887938-34887960 AGGGCCTCCCTGGTAAACACAGG + Intronic
907022962 1:51086775-51086797 TGCACATCCCAGGAAAACACAGG - Intergenic
911090480 1:94013396-94013418 TGGGCCCCACTGGGGAACACAGG - Intronic
911641051 1:100289340-100289362 AGGACCAGCCTGGGCAACACAGG - Intronic
915045633 1:153012402-153012424 TGTAACTGCCTGGGAAACAAAGG - Intergenic
915160293 1:153914732-153914754 AAGACCTGCCTGGGCAACACAGG + Intronic
916483117 1:165233253-165233275 AAGACCAGCCTGGGAAACACAGG + Intronic
916577324 1:166079422-166079444 TGGACTGCCCTTGGAAAGACAGG - Intronic
918326833 1:183418104-183418126 TCGATCGCCCTGGAAAACACAGG + Intronic
918381556 1:183960839-183960861 TTGACTTCCCTGGGCCACACTGG - Intronic
918450347 1:184651461-184651483 TTGACTTCCCTGGGCTACACTGG - Intergenic
920925145 1:210334212-210334234 TGATCCAGCCTGGGAAACACAGG - Intronic
921420124 1:214937556-214937578 GGGACCAGCCTGGGCAACACAGG - Intergenic
922759621 1:228119241-228119263 TGGAGCTCCTTGGGAAAAACAGG - Intergenic
922806005 1:228389842-228389864 GGGACCAGCCTGGGCAACACAGG + Intergenic
923049385 1:230380210-230380232 TGGACTTCCCTTGTAATCACAGG + Intronic
924300481 1:242632816-242632838 TGGTCCTCCTTGGGAATCCCCGG + Intergenic
924405934 1:243745737-243745759 TTGACTTCCCTGGGACACATTGG - Intronic
924483303 1:244455754-244455776 TGGGACTCCTTGGGAAAAACAGG + Intronic
924858791 1:247900185-247900207 TGAACCTCGCTGGGAAAAAGAGG - Intergenic
924940152 1:248807556-248807578 AAGACCACCCTGGGCAACACAGG + Intergenic
1062972879 10:1662029-1662051 TGGACCTCCCTGGGGACTCCTGG - Intronic
1063227216 10:4026940-4026962 TGGCCCTCGCTGGGAAAGACGGG + Intergenic
1063356002 10:5398835-5398857 TTGACCTCCCTGGGACACATTGG - Intronic
1063825926 10:9897350-9897372 TGGACATCCCAAGGAAGCACAGG + Intergenic
1063874563 10:10459974-10459996 GAGACCTGCCTGGGCAACACAGG + Intergenic
1064156067 10:12904265-12904287 GAGACCAGCCTGGGAAACACAGG + Intronic
1064895054 10:20226370-20226392 TTGGCCTCCCTGGGCCACACTGG - Intronic
1065200715 10:23310482-23310504 TGGACCCTCCTGGGAACCAAAGG - Intronic
1065337960 10:24674189-24674211 GAGACCTGCCTGGGCAACACAGG + Intronic
1065946529 10:30610037-30610059 TTGACTTCCCTGGGCCACACTGG + Intergenic
1066295892 10:34054307-34054329 GAGACCACCCTGGGCAACACTGG + Intergenic
1066348754 10:34616738-34616760 GGGACCAACCTGGGCAACACAGG + Intronic
1067483298 10:46620700-46620722 AAGACCAGCCTGGGAAACACAGG - Intergenic
1069623554 10:69852783-69852805 TGGACCTCGCTGGGCAAAACTGG + Intronic
1070141604 10:73742199-73742221 GAGACCACCCTGGGCAACACAGG + Intergenic
1070181226 10:74016028-74016050 AAGACCAGCCTGGGAAACACAGG - Intronic
1070244064 10:74713501-74713523 GGGACCAGCCTGGGAAACATAGG - Intergenic
1070271131 10:74956119-74956141 AGGACCAACCTGGGCAACACGGG - Intronic
1070808860 10:79287185-79287207 GTGACCTCCCTGGGAGACAGAGG + Intronic
1071876785 10:89851150-89851172 TGGAGAGACCTGGGAAACACTGG + Intergenic
1072163023 10:92785807-92785829 GAGACCTGCCTGGGCAACACAGG + Intergenic
1072284111 10:93896193-93896215 GAGACCACCCTGGGCAACACGGG - Intronic
1072457718 10:95591338-95591360 TGGACCTCCTTGGGACACCCTGG - Intergenic
1072952075 10:99856574-99856596 TTGGCCTCCCTGGGCCACACTGG + Intergenic
1072958001 10:99903954-99903976 TGGACCAGCCTGGGCAACATGGG - Intronic
1074352015 10:112747101-112747123 TGGACCTCACTGTGTAACAGTGG - Intronic
1076335983 10:129706672-129706694 TGGACCCCCGTGGGAAGCCCTGG - Intronic
1076538122 10:131195916-131195938 TGGAGCTCCTTGGAGAACACAGG + Intronic
1076648705 10:131972340-131972362 AAGACCACCCTGGGCAACACAGG + Intronic
1076746592 10:132517680-132517702 TGGTCATCCCTGGGAAGCGCAGG - Intergenic
1076785398 10:132747208-132747230 CGGACCTCCTTGGGACACAGGGG + Intronic
1077443443 11:2579233-2579255 TGTTCCTCCCTGAGAAACACTGG - Intronic
1077976647 11:7253705-7253727 TAAACCTCCCTGGAAACCACTGG - Intronic
1078859168 11:15231314-15231336 TTGACTTCCCTGGGCCACACTGG + Intronic
1079168504 11:18069327-18069349 TGGCCCTCCCTGGGAGAAATGGG - Intergenic
1080057350 11:27919962-27919984 GGGACCAGCCTGGGAAACATAGG - Intergenic
1080058414 11:27931643-27931665 TGGGACACCCTGGGAAAAACAGG - Intergenic
1080810677 11:35701295-35701317 TGGGACTCCTTGGGAAAAACAGG - Intronic
1083001541 11:59296851-59296873 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1083311183 11:61784528-61784550 TGCCCCTCCCTGGGACACAGAGG - Intronic
1085088391 11:73688929-73688951 CAGACCACCCTGGGCAACACAGG + Intronic
1085626249 11:78075786-78075808 AAGACCAGCCTGGGAAACACAGG - Intronic
1085919292 11:80932513-80932535 CAGACCAGCCTGGGAAACACAGG + Intergenic
1086082004 11:82913442-82913464 AAGACCAGCCTGGGAAACACAGG - Intronic
1089928410 11:122283388-122283410 TTGACTTCCCCGGGACACACTGG + Intergenic
1090253235 11:125265389-125265411 CAAACCTCCCTGGCAAACACCGG + Intronic
1091285116 11:134404598-134404620 TGCACCTTCCTGGGAATCACGGG + Intronic
1092195502 12:6547514-6547536 AAGACCTGCCTGGGAAACACAGG + Intronic
1092220691 12:6711074-6711096 TGGACCAGCCTGGGCAACATAGG + Intergenic
1094239899 12:28210568-28210590 TGGGACTCCTTGGGAAAAACAGG - Intronic
1094348302 12:29496327-29496349 TGTATCTCCATCGGAAACACTGG + Intronic
1096834341 12:54339547-54339569 AAGACCAGCCTGGGAAACACAGG - Intronic
1097742648 12:63262210-63262232 TGGGCTTCCCTGGGCCACACTGG - Intergenic
1097939394 12:65287325-65287347 AAGACCTACCTGGGAAACATAGG - Intronic
1098903344 12:76135471-76135493 TTGACTTCCCTGGGCCACACTGG - Intergenic
1099996266 12:89782775-89782797 AAGACCAGCCTGGGAAACACAGG - Intergenic
1100553198 12:95666868-95666890 TTGACTTCCCTGGGCCACACTGG + Intronic
1101144363 12:101827435-101827457 TGGACAAGCCTGGGAAACAAAGG - Intronic
1101605253 12:106243570-106243592 TGGATCTGCCAGGGCAACACAGG + Intronic
1101694721 12:107114309-107114331 GAGACCACCCTGGGAAACATAGG - Intergenic
1101988773 12:109467758-109467780 TGGTGCTGCCTGGAAAACACAGG - Intronic
1102264539 12:111472063-111472085 GGGACCACCCTGGGCAACATGGG + Intronic
1103000768 12:117383832-117383854 GGGACCAGCCTGGGAAACATAGG - Intronic
1103151655 12:118645358-118645380 AGGACCTCCCTGAGATCCACGGG - Intergenic
1103802000 12:123544239-123544261 AAGACCACCCTGGGAAACACAGG - Intergenic
1104608415 12:130206610-130206632 TGAACCTCACTGGGACAAACTGG - Intergenic
1104812721 12:131628404-131628426 TTGTCCTTCCTGGGAAAAACAGG + Intergenic
1104840270 12:131820925-131820947 AAGACCAGCCTGGGAAACACAGG + Intergenic
1105381563 13:19892140-19892162 GAGACCCGCCTGGGAAACACAGG - Intergenic
1106752396 13:32788475-32788497 GAGACCTGCCTGGGAAACACAGG - Intergenic
1107088493 13:36450625-36450647 TGGCCCACCCAGGGAACCACAGG - Intergenic
1108125660 13:47239870-47239892 AGGACCAGCCTGGGCAACACAGG - Intergenic
1108763764 13:53601869-53601891 GAGACCACCCTGGGCAACACAGG + Intergenic
1111099665 13:83567257-83567279 TGGACACCCATGAGAAACACTGG - Intergenic
1111453174 13:88445982-88446004 TAGACCAGCCTGGGAAACATAGG - Intergenic
1112020703 13:95368688-95368710 AAGACCAGCCTGGGAAACACAGG - Intergenic
1112478994 13:99756679-99756701 TTGGCTTCCCTGGGCAACACTGG - Intronic
1112781968 13:102910804-102910826 AGGACCAGCCTGGGCAACACAGG + Intergenic
1113511109 13:110855423-110855445 TGGAGCTCCCAATGAAACACCGG - Intergenic
1115534866 14:34363477-34363499 AGAACCTTCCTGGGAATCACTGG + Intronic
1115822902 14:37231285-37231307 GAGACCAGCCTGGGAAACACAGG - Intronic
1116437117 14:44908409-44908431 AGGAGTTCCCTGGGCAACACAGG + Intergenic
1116981340 14:51174288-51174310 TGGACCTTCCTGGGGAACATAGG - Intergenic
1117555120 14:56876149-56876171 AAGACCACCCTGGGCAACACAGG - Intergenic
1117814179 14:59580309-59580331 AAGACCAGCCTGGGAAACACAGG - Intergenic
1118110591 14:62714081-62714103 GAGACCACCCTGGGTAACACAGG + Intronic
1118353684 14:64993034-64993056 GGGACCAGCCTGGGCAACACAGG - Intronic
1119151969 14:72368955-72368977 TTGACTTCCCTGGGCCACACTGG + Intronic
1121796873 14:96742580-96742602 TGAAACTCCCTGGGGAACAGGGG - Intergenic
1122732127 14:103808368-103808390 TGGGCTTCCCTGGGCCACACTGG + Intronic
1122752028 14:103943548-103943570 CGGACCAGCCTGGGCAACACAGG - Intronic
1125800608 15:42443430-42443452 GGGACTATCCTGGGAAACACTGG + Intronic
1128093498 15:64935031-64935053 TGGATCTCCCTGGGTTACCCAGG - Intronic
1128710962 15:69871656-69871678 TGCAGCTCTCTGGAAAACACTGG - Intergenic
1132898457 16:2239920-2239942 AAGACCTCCCTGGGACCCACAGG + Exonic
1133293835 16:4740362-4740384 GGGTCCTCCCTGGGACCCACAGG + Exonic
1133946697 16:10354939-10354961 GAGACCAGCCTGGGAAACACAGG + Intronic
1134462197 16:14439170-14439192 GGGACCAGCCTGGGCAACACAGG + Intronic
1137669379 16:50270636-50270658 TGGACCTCCCTGGGGGAGCCTGG + Intronic
1138966175 16:62086612-62086634 TGGACTTATCTGGGAACCACTGG - Intergenic
1139564805 16:67767560-67767582 GAGACCTGCCTGGGCAACACAGG + Intronic
1139642433 16:68302206-68302228 AGGAGGCCCCTGGGAAACACTGG + Intronic
1141575173 16:84958987-84959009 TGGCCCTCCCTGGAACACCCAGG + Intergenic
1142318397 16:89364578-89364600 TTGACCTCCCTGGGCCACACTGG + Intronic
1142841714 17:2636918-2636940 AAGACCAGCCTGGGAAACACAGG - Intronic
1143256380 17:5560919-5560941 GGTCCCTCCCTGGGAAACAATGG - Intronic
1144182293 17:12763476-12763498 TGAATCTCCCTGGGAAACCATGG + Exonic
1144632781 17:16882460-16882482 AGGAACTCACAGGGAAACACTGG - Intergenic
1145043505 17:19594375-19594397 TGGAGCTTCCTGGGAATCTCTGG - Intergenic
1146020124 17:29270766-29270788 GGGACCAGCCTGGGAAACATAGG + Intronic
1147236478 17:39061436-39061458 GAGACCAGCCTGGGAAACACAGG - Intergenic
1147246850 17:39127340-39127362 GGGACCATCCTGGGAAACCCGGG + Intronic
1147263696 17:39223098-39223120 TGGTGCCCCCTGGGAATCACTGG - Intronic
1148039999 17:44699254-44699276 GAGACCAGCCTGGGAAACACAGG - Intergenic
1149905060 17:60518701-60518723 TAGACCTGCCTGGGCAACATAGG - Intronic
1150446796 17:65232557-65232579 AGGACCAGCCTGGGCAACACAGG - Intergenic
1155072677 18:22329980-22330002 TGGGTCTCCGTGGGAAACACAGG + Intergenic
1157556099 18:48613764-48613786 GGGTCCTCTCTGGGAAGCACAGG + Intronic
1157644541 18:49253957-49253979 TGGACCTCTATGGGGATCACAGG - Intronic
1158044676 18:53141872-53141894 TGTACTTCCCTGAGAAAGACTGG - Intronic
1158454630 18:57595208-57595230 GAGACCAGCCTGGGAAACACAGG + Intergenic
1158520526 18:58168857-58168879 GGAACCTCCCTTGGAAACAAAGG - Intronic
1159931946 18:74321502-74321524 GAGACCAGCCTGGGAAACACAGG - Intronic
1160879688 19:1313722-1313744 GGGGCCTCCCCGGGGAACACAGG - Intergenic
1162724013 19:12679094-12679116 AAGACCAGCCTGGGAAACACAGG + Intronic
1163125414 19:15241734-15241756 CTGTCCTCCCTGGGAAATACTGG - Intronic
1164860981 19:31562038-31562060 GAGACCTCCCTGTGAGACACAGG - Intergenic
1165134938 19:33661829-33661851 GAGACCACCCTGGGCAACACAGG + Intronic
1165211817 19:34241932-34241954 GGGACCAGCCTGGGCAACACAGG + Intergenic
1166402564 19:42494204-42494226 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1166621207 19:44302558-44302580 AAGACCAGCCTGGGAAACACAGG + Intronic
1166900910 19:46062081-46062103 TGGAACTCCTTGGGAAAAACAGG - Intronic
1167435406 19:49475883-49475905 AAGACCACCCTGGGAAACACAGG - Intronic
1167747266 19:51359255-51359277 CAGACCAGCCTGGGAAACACGGG - Intronic
1168020520 19:53605866-53605888 AAGACCACCCTGGGCAACACAGG - Intergenic
1168027610 19:53654353-53654375 TGGGACTCCTTGGGAAAAACAGG + Intergenic
925148941 2:1601482-1601504 TGAACACCCCTGGGAAAAACGGG + Intergenic
925696668 2:6587310-6587332 TAGACTAGCCTGGGAAACACAGG - Intergenic
926630952 2:15135785-15135807 TTGGCTTCCCTGGGACACACTGG + Intergenic
927194022 2:20535465-20535487 AGGACCACCCTGGGCAACACAGG + Intergenic
927713155 2:25338197-25338219 TGGACAACCCTGGGAAGAACTGG + Intronic
927924073 2:26997433-26997455 TGGGCTTCCCTGGGTCACACGGG - Intronic
930807658 2:55507431-55507453 GGGACCCTCCTGGGCAACACGGG - Intergenic
932227854 2:70057200-70057222 TAGACCAGCCTGGGCAACACAGG + Intergenic
933668406 2:84983843-84983865 AGGACCTGCCTGGGCAACATAGG - Intronic
935134713 2:100289902-100289924 GAGACCAGCCTGGGAAACACAGG + Intronic
935150917 2:100434854-100434876 TGGACCTACTTGAGTAACACTGG - Intergenic
935312617 2:101800295-101800317 GAGACCAACCTGGGAAACACAGG - Intronic
935686650 2:105689359-105689381 AGGAGCTCTCTGGGAAAGACTGG - Intergenic
937517907 2:122676613-122676635 TGGGCTTCCCTGGGCCACACTGG - Intergenic
939121866 2:138126819-138126841 TGGACCTACCTGGCTAACCCAGG - Intergenic
939755326 2:146102581-146102603 TGGACATCCCTGAGAGACACGGG + Intergenic
939910077 2:147970929-147970951 AGGACCAGCCTGGGAAACATGGG + Intronic
939921778 2:148124375-148124397 AAGACCTGCCTGGGCAACACAGG + Intronic
940264115 2:151818474-151818496 GAGACCGGCCTGGGAAACACAGG - Intronic
940321584 2:152383180-152383202 TTTACCTCCCTTGGAAACACTGG + Intronic
941639588 2:167972750-167972772 TGGGACTCCTTGGGAAAAACAGG + Intronic
941691447 2:168504207-168504229 AAGACCAGCCTGGGAAACACAGG + Intronic
942273045 2:174296624-174296646 GGGACCAGCCTGGGAAACACAGG + Intergenic
942568310 2:177288458-177288480 TAGACCAGCCTGGGCAACACAGG + Intronic
942767008 2:179469207-179469229 TGGGCTTCCCTGGGCCACACTGG + Intronic
943326927 2:186510937-186510959 TTGACTTCCCTGGGCCACACTGG - Intergenic
944941095 2:204628065-204628087 TTGGCTTCCCTGGAAAACACTGG - Intronic
946509063 2:220334862-220334884 TGGACCTCCCTGGGGCCAACAGG - Intergenic
946879182 2:224160412-224160434 TGGATACCCCTGGGAAACTCTGG + Intergenic
948242828 2:236452596-236452618 TGGCCCTCCTTGGGAAACTGAGG + Intronic
948469699 2:238169104-238169126 TGAACCTTCCTGGGAAACTAGGG + Intergenic
948770103 2:240247517-240247539 GGGTCCTACCTGGGAAGCACTGG + Intergenic
948786739 2:240356597-240356619 GGGACCTCCCAGGGTAAGACAGG + Intergenic
948937917 2:241180308-241180330 TGGGCTTCCCTGGGCCACACTGG + Intronic
1168836357 20:880383-880405 CAGACCAGCCTGGGAAACACAGG + Intronic
1169493418 20:6090553-6090575 AGGACCAGCCTGGGCAACACAGG + Intronic
1170837880 20:19900587-19900609 GAGACCACCCTGGGCAACACAGG + Intronic
1170877524 20:20264690-20264712 GAGACCAGCCTGGGAAACACGGG + Intronic
1171268520 20:23794094-23794116 TGCACCTCCCTCTGCAACACAGG - Intergenic
1172697260 20:36831379-36831401 TGGGCACCCCTGGGAAACCCTGG - Intronic
1173576663 20:44116382-44116404 CGGACCTGCCAGGGCAACACAGG + Exonic
1174003189 20:47389747-47389769 AGGACCAGCCTGGGCAACACAGG - Intergenic
1174414172 20:50356383-50356405 TGGGCCTCCCTGGGAAGATCTGG + Intergenic
1174556408 20:51398449-51398471 GGGACCTCCCTGAGAATCTCAGG - Intronic
1175026690 20:55910094-55910116 TGGACTTACCTGGAAAACCCAGG - Intergenic
1175517414 20:59578062-59578084 TGGCCCTCCCTGGGGAAGAAGGG - Intronic
1175717351 20:61263987-61264009 TGGGCCTCCCTGAGTAACCCAGG + Intronic
1175914974 20:62422067-62422089 TGGCCATCCCTGGGAAGCTCTGG + Intronic
1176132643 20:63502800-63502822 TGGGCCTCCCTGGTAGACTCAGG - Intergenic
1176606005 21:8831656-8831678 AGGACCACCCTGGGCAACATAGG + Intergenic
1177104109 21:16933306-16933328 TTGGCTTCCCTGGGACACACTGG - Intergenic
1178088220 21:29134317-29134339 GAGACCACCCTGGGCAACACAGG + Intronic
1178626467 21:34222856-34222878 TGAGACTCCCTGAGAAACACTGG - Intergenic
1181330471 22:22086940-22086962 TTGGCCTCCCTGGGCACCACTGG + Intergenic
1182344181 22:29648787-29648809 GGGACCTGCCTGGGCAACAAGGG - Intronic
1183832288 22:40424706-40424728 TGCTCCTCCCTGGGAGACCCGGG + Intronic
1183945360 22:41322829-41322851 GAGACCTGCCTGGGCAACACAGG - Intronic
1184097651 22:42325269-42325291 TGTTCCTCCCTGGGAAGCCCAGG + Intronic
1185098327 22:48823621-48823643 TGGGCTTCCCTGGGCCACACTGG + Intronic
950047862 3:9961352-9961374 TTGGCCTCCCTGGGCCACACTGG - Intergenic
951710940 3:25584472-25584494 TGGCTCTTTCTGGGAAACACTGG - Intronic
951925912 3:27908600-27908622 AAGACCTCCCTAGGAAACCCAGG + Intergenic
952881139 3:37986986-37987008 TGCACCTGCCTGGGAAAGACTGG + Intergenic
953186184 3:40640513-40640535 TTAATTTCCCTGGGAAACACTGG + Intergenic
953435610 3:42874954-42874976 TGGGCCTCCCAGGGGAACACGGG - Exonic
954331953 3:49895924-49895946 TGGACCTCCCTGGGAAACACGGG - Intronic
955315884 3:57938700-57938722 GGGACCAGCCTGGGCAACACAGG - Intergenic
955575634 3:60359734-60359756 TGGACCTGTCTGGAATACACTGG - Intronic
956607260 3:71085347-71085369 GGGACCAGCCTGGGTAACACAGG - Intronic
956677583 3:71750718-71750740 TAGACCAGCCTGGGAAACATAGG + Intronic
957570682 3:81944585-81944607 TAGACCACCCTGGGAAACAAAGG - Intergenic
960096400 3:113694612-113694634 TTGACCTCCCTGGGGCACACAGG + Intronic
961070651 3:123921665-123921687 TTGGCCTCCCTGGGCCACACTGG + Intronic
961595805 3:128015332-128015354 TGGGACTCCTTGGGAAAAACAGG + Intergenic
961944377 3:130670940-130670962 TTGACTTCCCTGGGCGACACTGG - Intronic
962473047 3:135730976-135730998 TGTACTTCCCAGGGAAACATGGG + Intergenic
962531966 3:136290558-136290580 TGAACCAGCCTGGGAAACACAGG - Intronic
962852594 3:139319063-139319085 TGGACCTGCCTGGGGAAGGCTGG + Intronic
963542939 3:146617500-146617522 TGTATCATCCTGGGAAACACGGG - Intergenic
965112982 3:164451120-164451142 TATACCTCCCTGTGAAACCCAGG - Intergenic
965667438 3:171110467-171110489 GTGATCTCCCTGGAAAACACTGG + Intronic
965964106 3:174466354-174466376 TTGGCTTCCCTGGGACACACTGG - Intronic
967197115 3:187038122-187038144 TGGACCAACCTGGGAAGAACAGG - Intronic
968053855 3:195675943-195675965 AAGACCACCCTGGGCAACACAGG - Intergenic
968102036 3:195973210-195973232 AAGACCACCCTGGGCAACACAGG + Intergenic
1202738016 3_GL000221v1_random:26296-26318 CAGAGCTCCCTGGGAAACATAGG - Intergenic
968679942 4:1910889-1910911 CAGAGCTCCCTGGGAAACAAAGG - Intronic
969558907 4:7933236-7933258 TGGACCTCCCTGGTTAGCCCAGG - Intronic
969571884 4:8013906-8013928 GGGCCCTCTCTTGGAAACACGGG - Intronic
970189946 4:13505570-13505592 GAGACCACCCTGGGAAACATAGG + Intergenic
970378692 4:15483733-15483755 TGGAGCACACTGGAAAACACTGG - Intronic
971008491 4:22403533-22403555 GAGACCACCCTGGGCAACACAGG + Intronic
971357380 4:25907340-25907362 TGGACCTCCCAGAGAGACGCTGG + Intronic
971756435 4:30714543-30714565 TTCACTTCCCTGGGAAATACGGG - Intergenic
972420778 4:38884186-38884208 CAGACCTGCCTGGGCAACACAGG - Intronic
973636197 4:52863386-52863408 AGAACCTCCCTGGGAAGCGCTGG - Intronic
975660618 4:76685282-76685304 TTGGCTTCCCTGGGACACACTGG + Intronic
976426270 4:84906852-84906874 TGGGCTTCCCTGGGCCACACTGG - Intronic
976639991 4:87328096-87328118 GAGACCAGCCTGGGAAACACAGG + Intergenic
977745441 4:100541563-100541585 TAGACCTGCCTGGGCAACATAGG + Intronic
981923006 4:150107573-150107595 AAGACCAGCCTGGGAAACACAGG - Intronic
983728351 4:170959657-170959679 TTGACTTCCCTGGGTCACACTGG + Intergenic
985060202 4:186070585-186070607 GGGACCAGCCTGGGCAACACAGG - Intronic
986689700 5:10304159-10304181 AAGACCTGCCTGGGCAACACAGG + Intronic
987957606 5:24761575-24761597 TGCATTTACCTGGGAAACACTGG + Intergenic
987970323 5:24934831-24934853 TTGACTTCCCTGGGACACATTGG - Intergenic
988678270 5:33456996-33457018 GAGACCAGCCTGGGAAACACAGG - Intronic
990051806 5:51511435-51511457 TTGGCTTCCCTGGGAAACAGTGG - Intergenic
990909886 5:60843262-60843284 TGGAGCTCCCTGGGGAACTCGGG - Intronic
992208927 5:74458478-74458500 AGAAATTCCCTGGGAAACACTGG + Intergenic
992688497 5:79220589-79220611 GAGACCAGCCTGGGAAACACAGG - Intronic
992820404 5:80490185-80490207 TGGATCAGCCTGGGCAACACAGG + Intronic
993337487 5:86679024-86679046 GAGACCAGCCTGGGAAACACAGG - Intergenic
997134870 5:131314438-131314460 AAGACCAGCCTGGGAAACACAGG - Intronic
997313945 5:132916043-132916065 AGGACCAGCCTGGGCAACACTGG + Intronic
997852939 5:137348710-137348732 TGGACTACCCTTGGCAACACAGG - Intronic
998061715 5:139123947-139123969 AAGACCAGCCTGGGAAACACAGG - Intronic
998301472 5:141025616-141025638 AGGACCAGCCTGGGAAACATGGG + Intergenic
998524283 5:142828145-142828167 TGGACCTCCCTGGGAGCCGCTGG + Intronic
998838570 5:146228810-146228832 GAGACCAGCCTGGGAAACACAGG - Intronic
999149430 5:149417027-149417049 TGGGCCTCCCAGGAAAGCACTGG - Intergenic
1000727744 5:164792819-164792841 GTGACCACCCTGGGAAACATGGG + Intergenic
1000926996 5:167205987-167206009 TGGGCCTACCTGGGAAACGCAGG + Intergenic
1002148629 5:177207641-177207663 TAGCCCAGCCTGGGAAACACAGG - Intronic
1003013668 6:2450680-2450702 CGGACCTCCGTGGGACACCCGGG + Intergenic
1003492925 6:6639686-6639708 TGGACCCCCCTGGGCCACACAGG + Intronic
1005288859 6:24358410-24358432 TAGACCAGCCTGGGAAACACAGG + Intergenic
1006766043 6:36508133-36508155 GAGACCAGCCTGGGAAACACAGG - Intronic
1006874430 6:37282905-37282927 CGAACCTCCCTGGGAACCCCTGG - Exonic
1008424234 6:51338211-51338233 TTGACTTCCCTGGAACACACTGG + Intergenic
1008727582 6:54441221-54441243 TGGACCTCCCTGGGCCAGAAGGG - Intergenic
1008877449 6:56345054-56345076 TGGACCTCTGTGGGATGCACAGG + Intronic
1008937428 6:57007088-57007110 GAGACCACCCTGGGCAACACAGG + Intronic
1009716783 6:67408063-67408085 TGGAACTCCTTGGGAAAAACAGG + Intergenic
1010084936 6:71906012-71906034 TGGAGCTTTCTGGGACACACTGG - Intronic
1010104069 6:72147530-72147552 TGGGACTCCTTGGGAAACAGAGG - Intronic
1011641038 6:89416337-89416359 TTGACTTCCCTGGGCCACACTGG - Intergenic
1011733391 6:90289554-90289576 TTGGCTTCCCTGGGACACACTGG + Intronic
1013739895 6:113270270-113270292 TTGACTTCCCTGGGAAACATTGG - Intergenic
1014749123 6:125235327-125235349 TGGGCTTCCCTGGGCCACACTGG + Intronic
1014999962 6:128202465-128202487 TGACCCTCCCTGGGAATCCCGGG - Intronic
1015377524 6:132527684-132527706 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1015955253 6:138591629-138591651 AAGACCAGCCTGGGAAACACAGG - Intronic
1017860109 6:158389248-158389270 GAGACCACCCTGGGAAACATGGG + Intronic
1019462953 7:1170951-1170973 AGGGGGTCCCTGGGAAACACAGG + Intergenic
1020098339 7:5380713-5380735 TGGACCTCACGGGGAAACTGAGG + Intronic
1020350549 7:7214286-7214308 TGGAACTCCTTGGGAAAAACAGG - Intronic
1020478364 7:8626136-8626158 TGGACTTCACTGGCAAACAAAGG + Intronic
1020537487 7:9419425-9419447 AAGACCAGCCTGGGAAACACAGG + Intergenic
1021154241 7:17190314-17190336 TTGGCTTCCCTGGGAAACACTGG - Intergenic
1021223396 7:18000162-18000184 AAGACCAGCCTGGGAAACACAGG + Intergenic
1021607555 7:22423827-22423849 AAGACCAGCCTGGGAAACACAGG + Intronic
1021658860 7:22898549-22898571 TGGACCAGCCTGGGTAACATGGG - Intergenic
1022041836 7:26588524-26588546 TGCACCTCCATGTGACACACTGG + Intergenic
1023561270 7:41475599-41475621 AGGAGCTCCCTGAGAACCACAGG - Intergenic
1023806751 7:43877888-43877910 TGGACCCCCCTGAGAAGCACAGG - Exonic
1024997090 7:55280174-55280196 CTGACCTCCCTGGGCAGCACAGG - Intergenic
1025140511 7:56459687-56459709 TAGACCAGCCTGGGCAACACGGG + Intergenic
1028915588 7:96255484-96255506 AAGACCAGCCTGGGAAACACAGG + Intronic
1029811058 7:103049652-103049674 TGGGACTCCTTGGGAAAAACAGG - Intronic
1030308688 7:108046964-108046986 AAGACCTGCCTGGGAAACACAGG - Intronic
1030521600 7:110604641-110604663 AAGACCTACCTGGGCAACACAGG + Intergenic
1031039775 7:116827188-116827210 AAGACCAGCCTGGGAAACACAGG - Intronic
1034505571 7:151487102-151487124 AAGACCACCCTGGGCAACACAGG + Intronic
1034885605 7:154796051-154796073 TGGAGCTCTCTGGGCAACCCTGG - Intronic
1034893470 7:154860100-154860122 TGGACCCACCTGGGCACCACTGG - Intronic
1035178088 7:157067791-157067813 AAGACCAACCTGGGAAACACAGG + Intergenic
1035306385 7:157935747-157935769 TGGAGCTCCCTGGGAGGCATCGG + Intronic
1035733197 8:1866952-1866974 TGCATCTCCCTGGGAATCACAGG - Intronic
1035866405 8:3087562-3087584 TAGGCTTCCCTGGGACACACTGG + Intronic
1036600926 8:10259668-10259690 TAGACCGTCCTGGGAAACCCAGG + Intronic
1037425062 8:18746489-18746511 TGGACCTCCCTTGGCCACGCTGG - Intronic
1037696112 8:21225545-21225567 TGGATCGCCCTGGGAAGCAAAGG + Intergenic
1038540930 8:28389511-28389533 AAGACCAGCCTGGGAAACACAGG + Intronic
1038574849 8:28696094-28696116 TTGACCAGCCTGGGCAACACAGG - Intronic
1039501892 8:38024337-38024359 TTGGCCTCCCTGGGCCACACTGG + Intergenic
1039906407 8:41789718-41789740 GGAACCTCGCTGGGAAACATAGG + Intronic
1040121734 8:43691364-43691386 GAGACCTTCTTGGGAAACACGGG + Intergenic
1042669434 8:71245613-71245635 TTGACTTCCCTGGGCCACACTGG - Intronic
1042822030 8:72939697-72939719 TGGACCTTCCTGGGAGACCAAGG - Intergenic
1042856211 8:73270704-73270726 GAGACCAGCCTGGGAAACACAGG + Intergenic
1043549515 8:81354047-81354069 GGGTTTTCCCTGGGAAACACAGG + Intergenic
1043921559 8:85989362-85989384 AAGACCACCCTGGGCAACACAGG - Intronic
1044979268 8:97698937-97698959 AGGACCAGCCTGGGCAACACAGG + Intronic
1046577351 8:116047351-116047373 TGCACCTGACTGGAAAACACTGG + Intergenic
1048200323 8:132368451-132368473 GAGACCAGCCTGGGAAACACAGG + Intronic
1052973005 9:34389134-34389156 AAGACCACCCTGGGAAACACAGG - Intronic
1053582209 9:39417194-39417216 AGGACCTGGCTGGAAAACACTGG - Intergenic
1053846625 9:42244526-42244548 AGGACCTGGCTGGAAAACACTGG - Intergenic
1054103787 9:60975933-60975955 AGGACCTGGCTGGAAAACACTGG - Intergenic
1054195786 9:62031029-62031051 TGGCCTTCCCTGTGAAACTCAGG + Intergenic
1054582565 9:66930913-66930935 AGGACCTGGCTGGAAAACACTGG + Intronic
1054642622 9:67557661-67557683 TGGCCTTCCCTGTGAAACTCAGG - Intergenic
1055132487 9:72792322-72792344 AGGACCTTGCTGGGAAACAATGG + Exonic
1056494399 9:87141752-87141774 TTGACCTCCCTGGGAAACAATGG + Intergenic
1057518332 9:95739845-95739867 GAGACCAGCCTGGGAAACACAGG + Intergenic
1057566112 9:96167371-96167393 AGGACCTGGCTGGGAGACACTGG + Intergenic
1058163242 9:101593232-101593254 TGGATCTCCCCTGGAACCACAGG + Exonic
1058355754 9:104081966-104081988 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1059295456 9:113266171-113266193 TAGACCAGCCTGGGCAACACAGG - Intronic
1059476456 9:114551613-114551635 GAGACCAGCCTGGGAAACACAGG - Intergenic
1059705002 9:116814442-116814464 TGGAATTCCATGGGAAACTCTGG + Intronic
1062305503 9:135904479-135904501 GAGACCAGCCTGGGAAACACAGG + Intronic
1203692315 Un_GL000214v1:55876-55898 CAGAGCTCCCTGGGAAACATAGG + Intergenic
1203556500 Un_KI270744v1:2768-2790 CAGAGCTCCCTGGGAAACATAGG + Intergenic
1203643980 Un_KI270751v1:48315-48337 CAGAGCTCCCTGGGAAACATAGG - Intergenic
1186367922 X:8914640-8914662 AGGACTTCCCTGGGAAACATTGG + Intergenic
1186877431 X:13830044-13830066 TGGACTTCACTTGAAAACACAGG - Intronic
1186963495 X:14762344-14762366 TAGACCAGCCTGGGAAACATAGG - Intergenic
1187758893 X:22558291-22558313 AGGACCTCCCTTGGAAAGATGGG + Intergenic
1189679001 X:43494680-43494702 GAGACCAGCCTGGGAAACACAGG - Intergenic
1190372513 X:49756490-49756512 ATGACCTCCCAGGGAAACAACGG + Intergenic
1191617244 X:63182421-63182443 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1191619054 X:63196502-63196524 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1192032114 X:67524913-67524935 TGGAACTCCCTCAGAAACCCTGG - Intergenic
1192476291 X:71446108-71446130 GGGACCAGCCTGGGAAACATGGG - Intronic
1193344319 X:80387838-80387860 TGGACCTGCCTGGGGAATATGGG - Intronic
1193356308 X:80523548-80523570 AGGACATCCCTGGAAAACAGAGG + Intergenic
1193530426 X:82648727-82648749 TGGACTGCCCTGGGAGACAGAGG - Intergenic
1193737643 X:85178446-85178468 AAGACCTGCCTGGGAAACATAGG - Intergenic
1194131474 X:90087737-90087759 TGGGACTCCATGGGAAAAACAGG - Intergenic
1194546450 X:95240317-95240339 TGAACCTCCCTGGAATACAGGGG + Intergenic
1195080269 X:101363953-101363975 AAGGCCTGCCTGGGAAACACAGG - Intronic
1195535963 X:106009544-106009566 GAGACCAACCTGGGAAACACAGG - Intergenic
1196371735 X:114986722-114986744 TGGACCTCCCTTAAAAATACAGG - Intergenic
1197738431 X:129870558-129870580 AAGACCACCCTGGGCAACACGGG - Intergenic
1198073483 X:133172209-133172231 TGGCCCTCCCTAGAAAGCACTGG - Intergenic
1199117905 X:144014315-144014337 TGGTCCTCCCTTTGACACACAGG + Intergenic
1200091667 X:153638860-153638882 TGGACGTCCCTGGGCCACGCGGG + Intergenic
1200700495 Y:6398067-6398089 AGGAGCTCTCTGGGAAATACAGG + Intergenic
1200922216 Y:8623337-8623359 AGGGCAACCCTGGGAAACACAGG - Intergenic
1200922589 Y:8626679-8626701 TGGAGCTCTCTGGGAAAGGCAGG - Intergenic
1201033617 Y:9766631-9766653 AGGAGCTCTCTGGGAAATACAGG - Intergenic
1202175308 Y:22093539-22093561 TGTTCCTCTCTGGGAAATACAGG + Intronic
1202216054 Y:22492844-22492866 TGTTCCTCTCTGGGAAATACAGG - Intronic