ID: 954333390

View in Genome Browser
Species Human (GRCh38)
Location 3:49902638-49902660
Sequence GGCCACCCGCAGCACAGGGT AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 193}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954333386_954333390 -6 Left 954333386 3:49902621-49902643 CCCACTGGAGCGGAGTGGGCCAC 0: 1
1: 0
2: 1
3: 7
4: 62
Right 954333390 3:49902638-49902660 GGCCACCCGCAGCACAGGGTAGG 0: 1
1: 0
2: 0
3: 11
4: 193
954333387_954333390 -7 Left 954333387 3:49902622-49902644 CCACTGGAGCGGAGTGGGCCACC 0: 1
1: 0
2: 1
3: 5
4: 87
Right 954333390 3:49902638-49902660 GGCCACCCGCAGCACAGGGTAGG 0: 1
1: 0
2: 0
3: 11
4: 193
954333378_954333390 29 Left 954333378 3:49902586-49902608 CCTCGGCGATGCTCAGCTCAGTG 0: 1
1: 0
2: 0
3: 12
4: 113
Right 954333390 3:49902638-49902660 GGCCACCCGCAGCACAGGGTAGG 0: 1
1: 0
2: 0
3: 11
4: 193
954333377_954333390 30 Left 954333377 3:49902585-49902607 CCCTCGGCGATGCTCAGCTCAGT 0: 1
1: 0
2: 0
3: 2
4: 59
Right 954333390 3:49902638-49902660 GGCCACCCGCAGCACAGGGTAGG 0: 1
1: 0
2: 0
3: 11
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954333390 Original CRISPR GGCCACCCGCAGCACAGGGT AGG Exonic
900152123 1:1183287-1183309 GGCCACCTGCAGGACAGAGGGGG - Intronic
900520378 1:3102480-3102502 GCCCACCTGCAGCTCAGGGATGG - Intronic
900644855 1:3704397-3704419 GGCCACTGGCCACACAGGGTGGG - Intronic
900993912 1:6110120-6110142 GGCCACCACCAGGCCAGGGTGGG - Intronic
901645545 1:10715114-10715136 GGCCAACCGGAGGCCAGGGTGGG - Intronic
903653604 1:24935457-24935479 ACCCACCTGCAGAACAGGGTGGG - Intronic
904046301 1:27610957-27610979 AGCAACCCCCAGCACAGGGCAGG + Intergenic
905941419 1:41866393-41866415 GGTGACCTGCAGCTCAGGGTCGG + Intronic
907711281 1:56884318-56884340 AGCCAGCTGAAGCACAGGGTGGG + Intronic
915622742 1:157095805-157095827 GGCCCCCAGCAGCTCAGGGGTGG + Intronic
915638589 1:157203833-157203855 TGCCATCCCCAGCACATGGTAGG + Intergenic
918002242 1:180508744-180508766 GGCCAGCAGCTGCAGAGGGTGGG + Intergenic
922765918 1:228156750-228156772 GGCAACCGCCAGCAGAGGGTGGG + Intronic
923540729 1:234886270-234886292 AGCCAGCCCCAGCTCAGGGTGGG + Intergenic
924626934 1:245703431-245703453 CGGCACCTGCAGCACAGGGGAGG + Intronic
1063115514 10:3068904-3068926 GGCCGCGCACTGCACAGGGTTGG + Intronic
1066067700 10:31774330-31774352 GGCCACCCAAAGCACTTGGTGGG + Intergenic
1066357162 10:34695824-34695846 GGCCAGGCCCTGCACAGGGTAGG + Intronic
1068860813 10:61846086-61846108 GGCCAACACCAGCACAGGGCTGG + Intergenic
1071843068 10:89493051-89493073 GGCCACCTGCAGCTCACTGTTGG - Intronic
1073002697 10:100297278-100297300 CTCCACCCCCACCACAGGGTAGG + Intronic
1074445643 10:113519122-113519144 GGACACCGGCAGCACAGGGCTGG + Intergenic
1077035316 11:491607-491629 GGACAAGCGCAGCAGAGGGTGGG - Intergenic
1077440458 11:2566421-2566443 GGTCACCCGCAGCTTAGGGGAGG - Intronic
1077490465 11:2858613-2858635 GGCCTCCTGCAGCCCAGAGTGGG + Intergenic
1078571467 11:12461669-12461691 GGACAGCCGCATCACATGGTTGG + Intronic
1079192781 11:18294928-18294950 GGCCACAGGCTGCACAAGGTTGG + Intronic
1079383521 11:19959187-19959209 GGCCACCCCCAGACCAAGGTGGG + Intronic
1079571978 11:21953796-21953818 AGCCACCTGGAGCAGAGGGTGGG - Intergenic
1080418880 11:32092822-32092844 GGCCCCCAGGAGCACAGGGATGG - Intronic
1081649702 11:44815588-44815610 AGCAATCCCCAGCACAGGGTAGG - Intronic
1083545063 11:63543195-63543217 GGCCACACACAGCCCAGGGTTGG - Intronic
1083841528 11:65307605-65307627 GGCCACCAGCAGCTCTGGGCTGG + Intergenic
1084679888 11:70660818-70660840 GGCCTCCTGCAGCACAGGTGCGG + Intronic
1085158854 11:74322556-74322578 GGCCACCCTCATCACAAAGTGGG - Intergenic
1085454882 11:76660147-76660169 GGCCACCTCCAGCCCAGGATTGG + Exonic
1089845561 11:121455365-121455387 GGACACTGGCAGCACAGGTTAGG + Intronic
1090927506 11:131261317-131261339 GACAACCTGAAGCACAGGGTGGG - Intergenic
1091375387 12:21816-21838 GACCACGCGCAGAACAGGCTGGG - Intergenic
1094473730 12:30825541-30825563 AGCCACCTCCCGCACAGGGTGGG + Intergenic
1096071056 12:48775772-48775794 GGACACCCTCAGCACAGTGTTGG - Intronic
1096219756 12:49821589-49821611 GGCCACCCCCAACACTAGGTGGG + Intronic
1096490656 12:52011003-52011025 GGGGACCCTCAGCCCAGGGTTGG - Intronic
1096576715 12:52557478-52557500 GGCCCCCCTCAGCACTTGGTAGG - Intergenic
1102035676 12:109769338-109769360 GGCAGGCCGCAGAACAGGGTGGG + Exonic
1103326469 12:120124658-120124680 GTCCTCCCGCATCACAGTGTTGG + Intergenic
1103328520 12:120137712-120137734 GGCCACCCGCAGCCCTGAGGTGG - Exonic
1103703136 12:122858298-122858320 TGCCACCCGCTGCTCAGGGCTGG - Intronic
1104466331 12:128993849-128993871 GGCCATCTGCAGCTCAGGCTGGG - Intergenic
1105417124 13:20223205-20223227 GGCCACCAGCAGCGCTGGGGTGG + Exonic
1107699183 13:43030789-43030811 GGCCAAGCACAGCACGGGGTAGG + Intronic
1110144797 13:72177685-72177707 GGGCATCCCCAGCCCAGGGTGGG - Intergenic
1110896649 13:80761070-80761092 GGCCCCCAGCAGCTGAGGGTGGG - Intergenic
1113647708 13:112010936-112010958 GGCTGCCAGCTGCACAGGGTGGG - Intergenic
1113811245 13:113143906-113143928 GGCCACCAGCAGCAGCGGGGAGG + Exonic
1118607737 14:67515567-67515589 TGCCTCCCGCAGCCCGGGGTCGG + Intronic
1119978428 14:79052160-79052182 GGCCACCATCAGAACAGGGATGG - Intronic
1121054021 14:90838392-90838414 AGCAACACCCAGCACAGGGTGGG + Intergenic
1122882716 14:104697224-104697246 GGCCTTCCACAGCACAGTGTGGG - Intronic
1127867136 15:63042341-63042363 GGCCTCCGGCAGCTCAGGGCGGG + Intergenic
1128468864 15:67935282-67935304 GGCCTCCCACAGAACAGAGTTGG - Intergenic
1129488856 15:75904079-75904101 GGCCACCCGCAGCAACGCCTTGG - Exonic
1131543938 15:93299839-93299861 GGCCTTACGCATCACAGGGTGGG - Intergenic
1132064379 15:98718544-98718566 GGGCACAAGCAGCTCAGGGTGGG - Intronic
1134521810 16:14922260-14922282 AGGCAGCCGCAGCCCAGGGTTGG - Intronic
1134709480 16:16320911-16320933 AGGCAGCCGCAGCCCAGGGTTGG - Intergenic
1134716693 16:16360940-16360962 AGGCAGCCGCAGCCCAGGGTTGG - Intergenic
1134950123 16:18347734-18347756 AGGCAGCCGCAGCCCAGGGTTGG + Intergenic
1134958057 16:18391219-18391241 AGGCAGCCGCAGCCCAGGGTTGG + Intergenic
1136775516 16:32869752-32869774 GGCCACCCTCAGCTCTGGGAGGG - Intergenic
1136895101 16:33991760-33991782 GGCCACCCTCAGCTCTGGGAGGG + Intergenic
1138530429 16:57631563-57631585 GGCCACCCCCAGCATGGGGACGG - Intronic
1141410638 16:83830507-83830529 GGCCACCTTCAGATCAGGGTTGG - Intergenic
1142168503 16:88606926-88606948 GTCTACCCGAAGCAGAGGGTTGG + Intronic
1142174713 16:88639759-88639781 GGCCTCCAGGAGGACAGGGTAGG + Intronic
1142234089 16:88913240-88913262 AGACACACGCAGGACAGGGTTGG + Intronic
1203077934 16_KI270728v1_random:1131861-1131883 GGCCACCCTCAGCTCTGGGAGGG - Intergenic
1142983191 17:3683166-3683188 CTCCACCCACAGCACAGGGCAGG + Intronic
1144149411 17:12428842-12428864 GGCCAGCTGCAGCAGAGGATAGG - Intergenic
1145884395 17:28372152-28372174 GGCCACCCGCAGCCCACCATGGG - Exonic
1146679048 17:34793915-34793937 CGGCACCTGCAGCACAGGTTGGG + Intergenic
1146922503 17:36722866-36722888 CGCCCCCAACAGCACAGGGTGGG - Intergenic
1149560490 17:57604808-57604830 GGCCAGCCGCAGGCTAGGGTCGG + Intronic
1150631808 17:66885254-66885276 GGCCACCCACAGTCCAGGGATGG - Exonic
1151489647 17:74425158-74425180 GGCCACCAGCAGAATAGGGATGG + Intronic
1151575711 17:74951742-74951764 TGGCACCCGCTGCCCAGGGTGGG - Intronic
1152727892 17:81956640-81956662 GCCCACTCACAGCGCAGGGTCGG + Exonic
1152880084 17:82809471-82809493 GAGCACACGCGGCACAGGGTAGG - Intronic
1157325214 18:46664194-46664216 AGCCACCCCCATCGCAGGGTTGG + Intergenic
1160444444 18:78915918-78915940 GGCCACCTGAACCACAGGGTGGG + Intergenic
1160575991 18:79854047-79854069 GGCCGCCTGCAGAACGGGGTTGG - Intergenic
1160980732 19:1815510-1815532 GGCCACACTCAGCGCAGTGTGGG - Exonic
1161354077 19:3809488-3809510 GGCCTCCCACAGCACTGTGTGGG + Intronic
1161680700 19:5678381-5678403 GGCCCCAGGGAGCACAGGGTTGG - Intronic
1162528702 19:11222900-11222922 GGCCACCTGCAGGAGAGGGGTGG + Exonic
1162615493 19:11797695-11797717 GGCCACCTGCAGTAGAGGGCAGG - Intronic
1163130899 19:15272346-15272368 TGTCACCCGGAGCACACGGTGGG - Intronic
1163613998 19:18315962-18315984 GGCCAGCCTCAGCACAGGGGCGG - Intronic
1165300034 19:34963044-34963066 GGCCAGCCGCAGCACTGGCCTGG + Intronic
1167574608 19:50312112-50312134 GCCCACCCGCAGGGCAGGGAGGG - Intronic
925336199 2:3101005-3101027 GGCCAGCCCCAGCAAATGGTGGG + Intergenic
927738378 2:25544099-25544121 AGGCACCCGCAGCCCAGCGTGGG + Intronic
928001094 2:27523550-27523572 GGGCATCCGCAGCCCAGGGTAGG + Exonic
931809944 2:65845123-65845145 GGCCACCCCCAGCACAGACAAGG - Intergenic
932488523 2:72103592-72103614 GCCCACTCTCAGCAGAGGGTAGG - Intergenic
933536746 2:83584940-83584962 CCCCACCCCCAGCACAGGGAGGG - Intergenic
933809980 2:86027124-86027146 GGCCTCCTGCAGCACAGGTGAGG + Exonic
935707379 2:105868913-105868935 GGCCCCTCGCAGCCCAGGTTTGG + Intronic
936252057 2:110874600-110874622 GGCCTCCTTCAGCACAGGGGAGG + Intronic
937317883 2:120943580-120943602 GGCCAGCGGCAGCAGCGGGTGGG - Intronic
937361478 2:121232872-121232894 TGCCACCGGCAACCCAGGGTGGG + Intronic
937425753 2:121797173-121797195 TGCCACCCAGAGCACAAGGTTGG + Intergenic
937868594 2:126771784-126771806 GGCCACAGGGAGCACAGAGTAGG + Intergenic
942408636 2:175683239-175683261 TGCCACCCCCATCACAGGGAAGG + Intergenic
944159602 2:196644402-196644424 AGCCACCAACAGCACTGGGTGGG - Intronic
947539421 2:230964695-230964717 GGCCTCCCGCTGCACTGTGTGGG - Intergenic
947821578 2:233075096-233075118 CTCCACACTCAGCACAGGGTGGG + Intronic
948429952 2:237912733-237912755 GGCCACCCACCGCCCAGGCTGGG + Intergenic
1169285534 20:4304257-4304279 GACCTCCCCCAGCACAGGGCAGG - Intergenic
1172091292 20:32434729-32434751 GGCCACCCTGAGCCCAGGGGAGG + Exonic
1175186333 20:57181719-57181741 GGCCACCCACATCCCAGGGCTGG + Intronic
1178707302 21:34886717-34886739 GGGCCCCCGCAGCCCCGGGTCGG - Intronic
1179680511 21:43017768-43017790 GGGCACCTGCAGCAGTGGGTGGG - Intronic
1179909099 21:44438628-44438650 AGCCAGCCGCAGCACAGGCCGGG + Intronic
1180157474 21:45984517-45984539 GGCCAACCCCAGCCCAGGCTGGG - Intronic
1180975471 22:19845560-19845582 AACCACCCCCAGCACAGGGCTGG - Intronic
1183000233 22:34850842-34850864 GTCCACCTGGAGCACAGGCTGGG + Intergenic
1183090476 22:35518843-35518865 GGCCACCCTCAGCCCCAGGTGGG + Intergenic
1184537825 22:45099625-45099647 GGCCTCCCCCAGCACAGAGAAGG - Intergenic
1184801401 22:46762697-46762719 GGCCACCCGGGGCACAGGAAAGG + Exonic
1184900738 22:47444991-47445013 AGCCACAGACAGCACAGGGTGGG + Intergenic
1185027960 22:48426286-48426308 GTACCCCCGCTGCACAGGGTCGG + Intergenic
1185316775 22:50182754-50182776 GGCCAGCTCCAGCACAGGGCAGG - Intergenic
950469772 3:13177419-13177441 GGCCAGGCGCAGCACAGAGCAGG + Intergenic
951341209 3:21489722-21489744 GGCAACCTGTAGCACAGGATGGG - Intronic
954333390 3:49902638-49902660 GGCCACCCGCAGCACAGGGTAGG + Exonic
954881137 3:53836640-53836662 GGCCAAGCTCAGCACATGGTGGG - Intronic
962588216 3:136862814-136862836 GTCCACCCGCAGCACCGCGCAGG - Intronic
963127379 3:141827945-141827967 GGGCACCCTCAGCAAAGGGGCGG - Intergenic
966734693 3:183179481-183179503 GGCGACCCGCAGCACCGAGGAGG - Exonic
966860654 3:184229639-184229661 GGCCACCCGGAGCGCAGAGGCGG + Intronic
967833960 3:193945294-193945316 AGCCACCCGCAGGAGAGGGGAGG - Intergenic
968801475 4:2745984-2746006 GGCCCCCAGCTGCCCAGGGTGGG + Intronic
968895289 4:3397339-3397361 GGCCATCCTGACCACAGGGTGGG - Intronic
969279226 4:6158437-6158459 GGCCACCCACAGCACAGGCCTGG + Intronic
973651808 4:53004302-53004324 GGCCACACGGAGGACATGGTAGG + Intronic
975403307 4:73962182-73962204 GGCTTCACACAGCACAGGGTGGG - Intergenic
979649091 4:123108114-123108136 GGACGCCCGCTGCACTGGGTAGG - Intronic
981348369 4:143700460-143700482 GGGCACCCGGAGTCCAGGGTTGG + Exonic
983494541 4:168428184-168428206 GGCCACCCTCAGCCCAGAGGAGG + Intronic
986639457 5:9858026-9858048 GACCACCCCCAGCACTGGGATGG - Intergenic
987543115 5:19280315-19280337 GGACACCAGCAGAAAAGGGTAGG - Intergenic
991639439 5:68738562-68738584 GGCTGCCCGAAGCACAGGGCTGG - Intergenic
994043503 5:95284265-95284287 GGCGACGAGCAGCACAGGTTGGG + Exonic
994627246 5:102235565-102235587 GGCCACACACAGCCCAGGGCTGG - Exonic
997633647 5:135388969-135388991 GGCCACCCCAAGTACAGGATTGG - Exonic
999782003 5:154857584-154857606 GGCCACACGCTGCCCAGGGCCGG + Intronic
1002415966 5:179121223-179121245 GGACACGCTCAGCAAAGGGTCGG + Intronic
1002779800 6:357432-357454 GACCACCAGGAGCACAGGTTGGG + Intergenic
1006931115 6:37689057-37689079 GGGCAGCTGCAGCACAGAGTGGG - Intronic
1007414418 6:41683582-41683604 GGTCACCCCCAGAACAGGGGTGG + Intergenic
1008497049 6:52144455-52144477 TACCACCCGGAGCACAGGTTTGG + Intergenic
1013194629 6:107834255-107834277 TGTCACCAGCAGCACAGGGTTGG - Intergenic
1014535718 6:122610817-122610839 GGCCACCTGCAGGGCAGAGTGGG - Intronic
1018679511 6:166252715-166252737 GGCCTCCCGGAGCAAAGGCTAGG + Intergenic
1018864606 6:167737050-167737072 GGGCACCCTCAGAACACGGTCGG - Intergenic
1018998984 6:168731110-168731132 GGTTACCCACAGCACAGGGCCGG + Intergenic
1019324489 7:431632-431654 GGCCACAGGGAGCAGAGGGTCGG - Intergenic
1019354022 7:569710-569732 GGGCACTCGCAGCCCAGGGGAGG + Intronic
1019734445 7:2643953-2643975 GTCCCACCGGAGCACAGGGTCGG + Intronic
1023980745 7:45068650-45068672 GGCCACACCCAGCACAGTGCTGG + Intronic
1025726184 7:64063723-64063745 TGCTACCCCCAGCCCAGGGTGGG - Intronic
1026806684 7:73433650-73433672 GGCCACGCGGAGCACGGGGTGGG - Intergenic
1027698313 7:81437404-81437426 GGCCAGCTGCAGCTCCGGGTGGG - Intergenic
1029489344 7:100861831-100861853 GGCCAACCGCAGCAGAGGCAGGG - Exonic
1032062794 7:128739086-128739108 CGCCACCCGCAGTACGGGGCTGG + Intergenic
1035266770 7:157693557-157693579 AGCGACCCGGAGCACAGGGGCGG + Intronic
1037977698 8:23224947-23224969 GGCCACACCCAGCAAAGTGTGGG - Exonic
1039048008 8:33467620-33467642 GGCCATCTGCTGCACAGAGTGGG + Intronic
1040072863 8:43202389-43202411 GGCGACCCCCAGCACAAGATTGG + Exonic
1040465580 8:47691890-47691912 GCCCAGGAGCAGCACAGGGTTGG - Intronic
1046794516 8:118356479-118356501 GCCCACCTGCAGCTCAGGGAGGG + Intronic
1048329177 8:133460708-133460730 GGGCTCCCGCAGCACAGAGGAGG + Intronic
1049307022 8:141909404-141909426 GTTCACCCACAGCACAGGGAGGG + Intergenic
1049425707 8:142537065-142537087 GGCCACGCCCAGCTCATGGTAGG + Exonic
1051513843 9:17907408-17907430 GGCCGCCCGCAGCCGAGTGTCGG + Intergenic
1053161096 9:35813910-35813932 GAGCACCAGCAGCAAAGGGTAGG + Intronic
1055131356 9:72778777-72778799 GCCCACTTGCAGCACAGGCTTGG + Intronic
1055315225 9:75028073-75028095 GGCCACGCGCAGCACCGAGGAGG - Exonic
1056732353 9:89177649-89177671 GGACCCCCGCTGCCCAGGGTTGG + Intronic
1057550873 9:96050117-96050139 GGCCTCACGCTGCCCAGGGTAGG - Intergenic
1059281394 9:113136949-113136971 GGCCAGCTGCAGCCCAGGGCGGG + Intergenic
1059912427 9:119059968-119059990 GGCCACCTTCAGCACAGTATCGG + Intergenic
1061482364 9:130903386-130903408 GGCCTGCCGGGGCACAGGGTGGG + Exonic
1062229597 9:135474362-135474384 GGGCACCCCCAGGACAGGATGGG - Intergenic
1062340199 9:136090773-136090795 GGCCACCCCCAGCCCAGGGCCGG + Intronic
1062354833 9:136156984-136157006 GACCACCCCCAGCTCAGAGTCGG - Intergenic
1190000588 X:46682741-46682763 GGCCACCAGGAGGACAAGGTGGG + Intronic
1192082432 X:68061279-68061301 TGCCGCCAGCAGCCCAGGGTAGG + Intronic
1195103001 X:101574153-101574175 GGCTACCCCCAGCACTGGGCTGG - Intergenic
1199699164 X:150363680-150363702 GGCCGCCCGCAGCGCCAGGTGGG - Intronic
1200246721 X:154530447-154530469 TTCCACCCGCAGCACAGGTGAGG - Intergenic
1201797912 Y:17921481-17921503 AGCTACCTGCAGCACAGGATTGG - Intergenic
1201803641 Y:17984476-17984498 AGCTACCTGCAGCACAGGATTGG + Intergenic
1202018318 Y:20435147-20435169 GGCCACCCTGAGCACTGGGTGGG - Intergenic