ID: 954335149

View in Genome Browser
Species Human (GRCh38)
Location 3:49911929-49911951
Sequence CAGAGGATGGGGCAGCTTCT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 346
Summary {0: 1, 1: 0, 2: 4, 3: 44, 4: 297}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954335149_954335162 30 Left 954335149 3:49911929-49911951 CCCAGAAGCTGCCCCATCCTCTG 0: 1
1: 0
2: 4
3: 44
4: 297
Right 954335162 3:49911982-49912004 GGACGAACATGGCACCCTCCTGG 0: 1
1: 0
2: 0
3: 7
4: 91
954335149_954335156 -2 Left 954335149 3:49911929-49911951 CCCAGAAGCTGCCCCATCCTCTG 0: 1
1: 0
2: 4
3: 44
4: 297
Right 954335156 3:49911950-49911972 TGACTCAGTCAGGTCCTCGTAGG 0: 1
1: 0
2: 0
3: 2
4: 75
954335149_954335158 4 Left 954335149 3:49911929-49911951 CCCAGAAGCTGCCCCATCCTCTG 0: 1
1: 0
2: 4
3: 44
4: 297
Right 954335158 3:49911956-49911978 AGTCAGGTCCTCGTAGGAACGGG 0: 1
1: 0
2: 0
3: 1
4: 44
954335149_954335161 19 Left 954335149 3:49911929-49911951 CCCAGAAGCTGCCCCATCCTCTG 0: 1
1: 0
2: 4
3: 44
4: 297
Right 954335161 3:49911971-49911993 GGAACGGGCATGGACGAACATGG 0: 1
1: 0
2: 0
3: 7
4: 69
954335149_954335159 9 Left 954335149 3:49911929-49911951 CCCAGAAGCTGCCCCATCCTCTG 0: 1
1: 0
2: 4
3: 44
4: 297
Right 954335159 3:49911961-49911983 GGTCCTCGTAGGAACGGGCATGG 0: 1
1: 0
2: 1
3: 2
4: 50
954335149_954335157 3 Left 954335149 3:49911929-49911951 CCCAGAAGCTGCCCCATCCTCTG 0: 1
1: 0
2: 4
3: 44
4: 297
Right 954335157 3:49911955-49911977 CAGTCAGGTCCTCGTAGGAACGG 0: 1
1: 0
2: 0
3: 4
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954335149 Original CRISPR CAGAGGATGGGGCAGCTTCT GGG (reversed) Exonic
900130297 1:1084540-1084562 CTGAGGTTGAGGCAGCTCCTGGG - Intronic
900643873 1:3699980-3700002 CCAAGGATGGGGCCGCTTCCTGG - Intronic
901335267 1:8443806-8443828 CATAGGCTGTGGCAGCTTCCAGG + Intronic
902220229 1:14959865-14959887 GGGAGGATGGCGCACCTTCTGGG + Intronic
902568809 1:17333381-17333403 CAGAGGAGGGTGGAGCATCTGGG - Intronic
902692468 1:18118386-18118408 CAGAGGCTGGGGCAGCTGGAGGG + Intronic
902692728 1:18120172-18120194 CAGGGGATGGTGCAGCCCCTTGG + Intronic
904036426 1:27561457-27561479 CACAGGCTGGGGGAGCTGCTGGG + Intronic
905022703 1:34828704-34828726 CAGAGGATGGGGCAGCAGAAGGG - Intronic
905473350 1:38208889-38208911 CAGAGGCTGGGGAAGTTTGTTGG + Intergenic
906057274 1:42927062-42927084 CAGGGGATGGAACAGCTCCTCGG + Exonic
906686978 1:47769235-47769257 GAAAGGATGGGGCAGCAGCTAGG - Intronic
906716019 1:47969888-47969910 CACTGGAAGGGGCAGCTTCGAGG - Intronic
907050917 1:51329705-51329727 CAGGGCAGGGGGCAGCTGCTAGG - Intronic
907517678 1:55003118-55003140 CAGAGGAAGAGGCAGCTTCTAGG + Intronic
910508246 1:87975182-87975204 CAAGGCACGGGGCAGCTTCTTGG + Intergenic
913050411 1:115112657-115112679 CAGAGGTTGTAGCAGTTTCTCGG + Intergenic
915118631 1:153615238-153615260 CATGAGATGGGGCAGCTGCTGGG + Exonic
915464826 1:156090907-156090929 CTGAGGCTGGAGCCGCTTCTAGG - Intronic
915580239 1:156809012-156809034 GAGAAGAGGGGGCAGCCTCTGGG + Intronic
915723465 1:158001062-158001084 CCTAGGATGGGACAGCTTCCTGG - Intronic
917387266 1:174491037-174491059 TAGAGCATGAGGCAGGTTCTTGG - Intronic
917530571 1:175831393-175831415 TAGAAGATGGGCCAGCTCCTAGG - Intergenic
919772531 1:201171584-201171606 CAGAGGCCGCGGCAGCCTCTCGG + Intergenic
919843120 1:201623456-201623478 CTGATGAGGGGGCAGCTTCGTGG + Intronic
920029675 1:203028980-203029002 CTGTGGAAGGGGCTGCTTCTAGG + Intronic
920556206 1:206906847-206906869 CAGAGGATGGTGCAGCAACCAGG - Intronic
920653948 1:207860806-207860828 CAGATGATGGGGCAGTAGCTGGG + Intergenic
920681636 1:208077468-208077490 GAGTGGATGGTGCAGCTGCTGGG + Intronic
920706236 1:208252621-208252643 CAGAGGAGGGGGCGGCTGCCAGG - Intergenic
922195215 1:223353736-223353758 CAGAGGAAGGGGCAGCAGCAGGG + Intronic
922253936 1:223875106-223875128 CAGAGGATGCGGCAGCAACACGG + Intergenic
922568685 1:226618978-226619000 CAGAAGATGGGGTAGCTTCTGGG - Intergenic
922586127 1:226736407-226736429 GAGAGGCAGGGGCAGTTTCTGGG - Exonic
922695640 1:227729597-227729619 CAGCCGAAGGGGCAGCTCCTTGG - Intronic
1063286700 10:4696186-4696208 AAGAGGATGGGGCATCTCGTTGG - Intergenic
1064528606 10:16283990-16284012 CAGTGGTTGGGGAAGGTTCTGGG + Intergenic
1066659641 10:37727606-37727628 CACAGCATGGGGCAGTTTCGGGG + Intergenic
1067030941 10:42878625-42878647 CTGAGGATGGGGCTGCATCGGGG - Intergenic
1067134857 10:43598844-43598866 CAGAGGGTGGGGCTGCTGCTGGG + Intergenic
1067561671 10:47308909-47308931 CCAAGGTTGGGGCAGCTTCCTGG + Intronic
1069556511 10:69401923-69401945 CAGAGGGGGGTGCAGTTTCTTGG + Intergenic
1069630079 10:69892271-69892293 CAGTGGAGGGGACAGCATCTGGG - Intronic
1069889138 10:71642373-71642395 AAGAGGCCGGGCCAGCTTCTGGG - Intronic
1069957689 10:72061863-72061885 CAGAGCCTGGGGGAGCTTTTAGG - Exonic
1071636905 10:87265295-87265317 CAGAGGTTGGAACAGCTTCGAGG + Intergenic
1071658343 10:87472659-87472681 CAGAGGTTGGAACAGCTTCGAGG - Intergenic
1075253572 10:120905728-120905750 CAGAGTATGCAGCAGCTTCAGGG + Intronic
1075421246 10:122302128-122302150 CAGCAGATGCTGCAGCTTCTGGG + Intronic
1075485930 10:122822127-122822149 CAGTGGATGGGTCACCTTCTAGG + Intergenic
1075623905 10:123948153-123948175 AAGGGGATGGGGCAGCCTCCTGG - Intergenic
1075651875 10:124132635-124132657 CAGACAATGGGGCAGCACCTGGG - Intergenic
1076848585 10:133082048-133082070 CAGAGGCTGGTGGAGCTCCTGGG + Intronic
1077247496 11:1546743-1546765 CCGAGGCTGGGGCCGGTTCTCGG - Intergenic
1077918712 11:6627225-6627247 CAGTGGATGGTGCAGCTGCTGGG - Exonic
1078106755 11:8362748-8362770 CTGAGGAAGGGGCAGCTTCAGGG - Intergenic
1079368789 11:19832411-19832433 CAGAGTCTGAGGCAGCTGCTCGG - Intronic
1082265051 11:50109228-50109250 ATGAGGATGGAGCACCTTCTAGG - Intergenic
1083365460 11:62139243-62139265 CAGAGGAAGGGGCTGCATCGGGG + Intronic
1083426154 11:62587504-62587526 AAGAAGAAGGGGCAGCTTGTAGG - Intronic
1083642698 11:64153944-64153966 CAGAGGAGGGGGCAGCTGCAGGG - Intronic
1083656151 11:64230658-64230680 CAGAGGAAGGGGCAGGTCCAAGG + Exonic
1083679027 11:64342850-64342872 CAGAGGATGGGGCAGGTGTAGGG + Intronic
1084387388 11:68852647-68852669 GAGAGGAAGGGCCAGCTTCCGGG - Intergenic
1084679952 11:70661155-70661177 CCCAGAATGGGGCAGTTTCTAGG + Intronic
1084774681 11:71367691-71367713 AAGAGGCTGGGGCAGCAGCTCGG - Intergenic
1087141376 11:94768654-94768676 CACGGAAGGGGGCAGCTTCTGGG + Intronic
1087447167 11:98269547-98269569 CAGAGGATGGAGCAGTTTGGAGG - Intergenic
1090771751 11:129926723-129926745 CAGCTGATGGGGCTGCTTCAGGG + Intronic
1090823819 11:130369271-130369293 GAGAGGGTGTGGGAGCTTCTGGG - Intergenic
1092524352 12:9300739-9300761 CAGAAGCTGGGGCCGCTTCCTGG + Intergenic
1092542911 12:9431073-9431095 CAGAAGCTGGGGCCGCTTCCTGG - Intergenic
1092664825 12:10784307-10784329 GAGAGGCTGGGGCAGAATCTGGG + Intergenic
1092702574 12:11248466-11248488 AAGAGCAAGGGGCAGCTTCATGG - Intergenic
1093418359 12:18946777-18946799 AAGATGCTGGGGCAGCTTCGGGG - Intergenic
1094707864 12:32932232-32932254 CAAGGGATGGGGCTGCTTCTGGG + Intergenic
1094738600 12:33262625-33262647 CACAGGAAGGGGCAGCTGCTGGG + Intergenic
1095960753 12:47832979-47833001 CACAGAAAGGGGCAGCTTCTGGG - Intronic
1096034897 12:48457931-48457953 CAGAGGAGGGAGAAGCTGCTGGG - Intergenic
1097053581 12:56237642-56237664 CAGGGGCTGGGGCTGCTGCTGGG + Exonic
1097694359 12:62762358-62762380 CTGAGCATGGGGCTGCTCCTTGG - Intronic
1099068537 12:78015331-78015353 CAGAAGATGTGACAGCTACTAGG - Intronic
1099206281 12:79731180-79731202 CAGAGGTTGGGGCTGCTGCAGGG + Intergenic
1100585637 12:95976961-95976983 CAGATGAATGGGCAGCTTCCTGG - Intronic
1101441149 12:104705055-104705077 GAGAGGATGGGCCAGCTGTTTGG + Intronic
1101646103 12:106632257-106632279 CAGGCGCTGGGGCAGCATCTTGG + Intronic
1102198344 12:111040362-111040384 GAGAGAATGGGGCAGATCCTGGG - Intronic
1102910803 12:116712535-116712557 CAGAGGCGGGGAAAGCTTCTCGG + Exonic
1104832665 12:131764607-131764629 CACAGGGTGGGGCAACTGCTGGG - Exonic
1106235080 13:27854426-27854448 CAGAGCCTGGGACGGCTTCTGGG - Intergenic
1107592101 13:41919613-41919635 CAGGGGATGGAGCAGCTTCAGGG - Intronic
1109237503 13:59842904-59842926 AAGAGGTTGGGGGAGCTTCTGGG - Intronic
1111614409 13:90644695-90644717 CAGAGGTTGGAGCAGTTTCGAGG - Intergenic
1113121020 13:106924065-106924087 CAGAGGATGAGGCAGCTCTCTGG + Intergenic
1113674630 13:112198785-112198807 CAGAGGCTGGGGCAGCTCCCCGG + Intergenic
1113726045 13:112602808-112602830 CACATGATGGGGGAGTTTCTTGG - Intergenic
1116104186 14:40477693-40477715 CAGAGCAGGAGGCAGCTTCTGGG + Intergenic
1116485415 14:45443217-45443239 CAGAGGATGGAACAGTTTGTAGG + Intergenic
1116742568 14:48775733-48775755 CAGAGGTTGGAACAGTTTCTAGG + Intergenic
1117891818 14:60430325-60430347 CAGAGGCTGGGGTTGCTTCCAGG + Intronic
1119322456 14:73739913-73739935 CAGGGGAGGGGGCTGCTCCTTGG + Exonic
1119745080 14:77038290-77038312 AAGAGGAGGGGGCAGCCTCCAGG - Intergenic
1119789021 14:77332456-77332478 CAGAGATTGGGGTAGCTTCTGGG + Intergenic
1121494224 14:94380825-94380847 AAGAGGTGTGGGCAGCTTCTTGG + Intronic
1122079671 14:99257932-99257954 CAGCAGAGGGGGCTGCTTCTTGG - Intronic
1122474530 14:101997713-101997735 AAGTGGATGTGGCAGTTTCTGGG - Intronic
1122812713 14:104296950-104296972 CAGAGGCGGGGGCAGCCACTGGG + Intergenic
1122999910 14:105287837-105287859 GAGAGCAAGGGGCAGCTACTGGG + Intronic
1123666565 15:22613146-22613168 CAGGGGATGGGGCAGGTGGTTGG + Intergenic
1124320408 15:28707719-28707741 CAGGGGATGGGGCAGGTGGTTGG + Intronic
1124338618 15:28875744-28875766 CAGAAGATGGGGCAGGGACTGGG - Intergenic
1124482106 15:30087691-30087713 CAGGGGATGGGGCAGGTGGTTGG - Intronic
1124488564 15:30139791-30139813 CAGGGGATGGGGCAGGTGGTTGG - Intronic
1124543650 15:30608763-30608785 CAGGGGATGGGGCAGGTGGTTGG - Intronic
1124754964 15:32398531-32398553 CAGGGGATGGGGCAGGTGGTTGG + Intronic
1125511101 15:40292853-40292875 CACAGGGTGGGGCAGCTTCTGGG - Intronic
1125680983 15:41530050-41530072 AAGTGGATGTGGCAGCTGCTGGG - Intronic
1127276831 15:57453558-57453580 CAGAGAATGGGGAGGCTCCTTGG + Intronic
1128801945 15:70502554-70502576 CAGAAGATGGTGGAGCTGCTGGG - Intergenic
1128879557 15:71230863-71230885 CAGAGGAAGAGGCATCTTTTTGG - Intronic
1129029671 15:72609204-72609226 CAGGGGATGGGGCAGCTGGTTGG - Intergenic
1129037607 15:72660236-72660258 CAGGGGATGGGGCAGCTGGTTGG - Intronic
1129212280 15:74076989-74077011 CAGGGGATGGGGCAGCTGGTTGG + Intronic
1129398117 15:75264090-75264112 CAGGGGATGGGGCAGCTGGTTGG - Intronic
1129401728 15:75288371-75288393 CAGGGGATGGGGCAGCTGGTTGG - Intronic
1129475321 15:75781078-75781100 CAGGGGATGGGGCTGCTGGTTGG - Intergenic
1129729409 15:77921307-77921329 CAGGGGATGGGGCAGCTGGTTGG + Intergenic
1129839107 15:78732663-78732685 CAGGGGATGGGGCAGCTGGTCGG - Intergenic
1131029381 15:89173764-89173786 CAGAGGCTGGGGCAGTTTGCAGG - Intronic
1132520131 16:383326-383348 CAGAGGATGTGGGAGCCTCGTGG + Intronic
1133416256 16:5609442-5609464 CAGAGGAGAGGTCAGCTTCCAGG + Intergenic
1135594302 16:23729952-23729974 CACAGGATTGGGTAGCTTCCAGG - Intergenic
1136143842 16:28303931-28303953 CGTAGGAAGGGGCTGCTTCTTGG - Intronic
1136340667 16:29641002-29641024 CAGAGGGTGGGGGAGCCTCCAGG + Intergenic
1137634989 16:49978315-49978337 CAGATCATGGGGAACCTTCTAGG - Intergenic
1137706949 16:50542170-50542192 CAGGGGTTGGAGCAGCTTCTTGG - Intergenic
1138009186 16:53361988-53362010 CAGGGGATGGGGCAGGTGGTTGG + Intergenic
1138183371 16:54958318-54958340 CAGGCGATGGGGCAGCTCTTTGG - Intergenic
1139140109 16:64251861-64251883 GAGAGGATCTGGCAGCTTCTAGG - Intergenic
1140657210 16:77153058-77153080 CAGAGAAAGAGGCAGCTTCCAGG + Intergenic
1140767196 16:78171206-78171228 CACAGGATGCGGCAGTTTCCCGG - Intronic
1140781656 16:78302364-78302386 GAGAGGCTGAGGCAACTTCTGGG - Intronic
1141798025 16:86287471-86287493 CAGAGGCTGCGGCAGCTGGTGGG - Intergenic
1141879365 16:86847612-86847634 CTGAGAATGGGGCTCCTTCTGGG + Intergenic
1142204508 16:88776519-88776541 CAAAGGCTGGGGCAGCTAGTGGG - Intronic
1142358193 16:89613890-89613912 CAGGGGACGGGGCGGCTTCCTGG + Intronic
1142358209 16:89613945-89613967 CAGGGGACGAGGCAGCTTCCTGG + Intronic
1142714055 17:1738357-1738379 CAGCTGAGGGGGCAGCCTCTGGG + Exonic
1142910977 17:3090711-3090733 GGGTGGATGGGCCAGCTTCTGGG + Intergenic
1143304360 17:5934037-5934059 CTGAGTCTGGGGGAGCTTCTTGG + Intronic
1145911507 17:28546144-28546166 CAGAGGAGGGGGCTGCTTAATGG - Intronic
1145913187 17:28554393-28554415 CAGAGGATGTCACAGCTTCCTGG + Exonic
1149454209 17:56774473-56774495 CAGAGGGTGGGGAAGCTTGGTGG + Intergenic
1150251170 17:63705374-63705396 TAGTGGATGGTGCTGCTTCTAGG + Intronic
1150631739 17:66884943-66884965 CAGAGGATGGGCTCGCTGCTGGG - Intronic
1151336915 17:73445468-73445490 CTGAGCAGGGGGCAACTTCTGGG + Intronic
1151480722 17:74368869-74368891 CACAGGGTGGGGCATCCTCTGGG - Intronic
1152020614 17:77778551-77778573 AAGAGGAAGGGGCAGATCCTGGG - Intergenic
1152207451 17:78981710-78981732 CAGGGGAAGGGGCAGCGGCTCGG + Intergenic
1152235586 17:79136640-79136662 CAGAAGATGGGGAAGGTGCTGGG + Intronic
1152657709 17:81527678-81527700 CAGAGGAGGGGGCAGCCTCAGGG + Intergenic
1152915986 17:83036258-83036280 CAGAGAAGGGAGCAGCTGCTGGG + Intronic
1152994729 18:396012-396034 AAGAGCCTGGGGCAGCTCCTTGG - Intronic
1154940859 18:21111659-21111681 CTGCTGATGGGGGAGCTTCTGGG + Exonic
1155181585 18:23352877-23352899 CTGAGGAAGGGGCAGCATCTTGG + Intronic
1155250379 18:23948134-23948156 CACAGGATGGGGCAGGATTTGGG + Intronic
1155755347 18:29487804-29487826 CACAGGATGGTGTTGCTTCTGGG - Intergenic
1156149294 18:34223717-34223739 CAGTGGCTGGGGAAGCTTCTGGG - Intronic
1157287699 18:46388419-46388441 CACAGGATTGAGCAGCTGCTAGG - Intronic
1159180368 18:64894220-64894242 CAGAGGTTGGGGCAGTTTCAAGG - Intergenic
1159294899 18:66472368-66472390 AAGAGGATGAGGCAGCTCCCTGG + Intergenic
1159904100 18:74075089-74075111 CTGAGGATGGTGCAGCTGCATGG - Intronic
1159957490 18:74530127-74530149 CAGAGGAAGTGGGGGCTTCTGGG - Intergenic
1159957541 18:74530329-74530351 CAGATGCTGGGGCAGATGCTGGG - Intergenic
1160329332 18:77977669-77977691 CAGAAGCTGGGGTAGCTTCATGG - Intergenic
1160988554 19:1851378-1851400 AAAAGGATGGTGCTGCTTCTGGG + Intergenic
1161040547 19:2108826-2108848 CAGAGCAGGGGCCACCTTCTTGG + Intronic
1161273170 19:3401402-3401424 CAGAGGAGGGGGCAGAATCCAGG + Intronic
1161425091 19:4198673-4198695 CAGAGGTTGGGGCAGCTTTTGGG + Intronic
1162541047 19:11296119-11296141 CAGGGCAGGGGGCAGCTGCTGGG + Intronic
1162794935 19:13082062-13082084 GAGAGGTGGGGGCAGCATCTGGG + Intronic
1163263764 19:16206289-16206311 CAGAGGCTGGGGCTGCTGCCTGG - Intronic
1163514327 19:17754053-17754075 CACAGGATGGGGAAGCTCCCGGG - Intronic
1163605696 19:18274214-18274236 CAAATGATGGGTCAGCTCCTTGG - Intronic
1164502204 19:28829403-28829425 CAGAGGCTGGGCAAGCTCCTAGG + Intergenic
1165714931 19:38038166-38038188 GAGAGGAGGGGGCAGGTTCTGGG + Intronic
1168337903 19:55606565-55606587 AAGAGGATGAGGCACATTCTGGG - Intronic
925144245 2:1570279-1570301 CAGGTGGTGGGGCAGCTGCTGGG + Intergenic
925515404 2:4675326-4675348 AAGAGGATTGGGGAGCTCCTAGG - Intergenic
927319272 2:21723452-21723474 CAGAAGATGGGGCTGTTTCTTGG + Intergenic
929928324 2:46233070-46233092 CAGAGGATGGGCAAACTTCAAGG - Intergenic
929991873 2:46797069-46797091 CAGAACATGGGGCAGCCTCAGGG + Intergenic
932180540 2:69642956-69642978 CGGAGGAGGGGGCAGCACCTCGG - Exonic
933768165 2:85725192-85725214 CAGAGGAAGGGAGAGCATCTGGG + Intergenic
934663550 2:96155481-96155503 GGGAGCATGGAGCAGCTTCTGGG - Intergenic
935291665 2:101616190-101616212 GGGAGAATGAGGCAGCTTCTAGG - Intergenic
936088496 2:109486121-109486143 CAGAGAAGGGGTCAGCTCCTTGG - Intronic
936156410 2:110050094-110050116 CAGTGGATGGGCCAGATCCTGGG + Intergenic
936188280 2:110321350-110321372 CAGTGGATGGGCCAGATCCTGGG - Intergenic
936800388 2:116258660-116258682 CAGAGGTTGGGACAGTTTCAAGG - Intergenic
937256072 2:120556744-120556766 CTGAGGATGGGGCAGCCCCGAGG + Intergenic
937326295 2:120991416-120991438 GAGAGGCCAGGGCAGCTTCTGGG - Exonic
937988497 2:127649458-127649480 CTGATGATGGCACAGCTTCTGGG - Intronic
938072835 2:128317533-128317555 CAGAGGGTGGGGGAGCTGCCAGG - Intronic
938593743 2:132765844-132765866 GAAAGGATGGGGCAACTGCTAGG + Intronic
938659666 2:133472724-133472746 CAGAAGGTAGAGCAGCTTCTAGG - Intronic
942700832 2:178708042-178708064 CAGAGGCTGGGGCAATTTGTGGG - Intronic
943692227 2:190880958-190880980 AAGAGGAAAGGGCAGCTACTTGG - Exonic
948089473 2:235280552-235280574 CAGAGGATGGGGGTGGGTCTTGG - Intergenic
1169135679 20:3195658-3195680 GAGAGGATGGGGCAGGTGATTGG - Intronic
1172796020 20:37538263-37538285 CAGAGGCTGGTGCAGCTTGAAGG + Intergenic
1173552258 20:43940672-43940694 CAGAGGATGAGGCAGCTATCAGG + Intronic
1175443259 20:59005085-59005107 CAGAGGACTGGGCAGAGTCTAGG - Intronic
1175790211 20:61736040-61736062 CAGAGGATGCGGGACCTCCTGGG + Intronic
1176229240 20:64023214-64023236 CGGTGGGTGGGGCAGCATCTGGG + Intronic
1176387549 21:6146273-6146295 CAGAGGCTGGGGCTGCGGCTGGG + Intergenic
1178235194 21:30833697-30833719 AAGAGGGTTAGGCAGCTTCTTGG + Intergenic
1178794623 21:35732487-35732509 CAGAGGATGATGGAGCCTCTAGG - Intronic
1179735923 21:43391975-43391997 CAGAGGCTGGGGCTGCGGCTGGG - Intergenic
1180576022 22:16775276-16775298 ATGAGGATGAGGCAGCTCCTAGG - Intergenic
1180904148 22:19396735-19396757 AAGAGGCTGGGGCAGCTGCGGGG + Intronic
1180918668 22:19506957-19506979 CTGAGGATGGGGGCGCTTCGTGG + Intronic
1180969336 22:19806956-19806978 GAGAGGCTGGGGCAGCTGCCAGG - Intronic
1181799323 22:25334103-25334125 CAGAAGCTGGGGCAGCCTCCAGG - Intergenic
1182422999 22:30257595-30257617 CACAGGTTGGGGCAGGGTCTTGG + Intergenic
1182824572 22:33253751-33253773 CTGAGGATGGGGCTGCACCTCGG + Intronic
1183520646 22:38294455-38294477 GAGAGGATGGGGCAGCTACGGGG - Exonic
1183590624 22:38777418-38777440 TGGCGGATGGGGCAGCTTCTTGG - Intronic
1183737248 22:39650844-39650866 TAGGGGAGGGGACAGCTTCTGGG + Intronic
950495007 3:13328514-13328536 CAGGGCATGGGGCAGCTCCAGGG - Intronic
950900967 3:16497087-16497109 TAGAGGATGAGGGGGCTTCTAGG + Intronic
952421092 3:33132080-33132102 CAAAGGATGGTGGAGCCTCTGGG - Intronic
953166037 3:40465722-40465744 CAGAGGATGAGAAAGCTTCAGGG + Intergenic
954335149 3:49911929-49911951 CAGAGGATGGGGCAGCTTCTGGG - Exonic
954655250 3:52190579-52190601 ATGAGGCTGGGGCAGCTTCAAGG - Intergenic
954959741 3:54553656-54553678 CAAAAAATGGGTCAGCTTCTAGG - Intronic
955144057 3:56298726-56298748 AAGGGTATGGGGCATCTTCTAGG + Intronic
960991292 3:123313361-123313383 CAGAAGAGGGTGCAGCTTCCAGG + Intronic
961354829 3:126330957-126330979 CAGAGGATGGGGGAGCCTCATGG + Intergenic
961744866 3:129058193-129058215 CAGAGGAAGGGGCACCTGATGGG + Intergenic
964723103 3:159787448-159787470 CAGATGCTGGGGCAGCCTCTGGG - Intronic
965649393 3:170918366-170918388 CAGAGGCTGGGGCAGTTTGGAGG + Intergenic
966294342 3:178401712-178401734 CAGAGGATGGGGCTGCTGGAGGG + Intergenic
968600383 4:1505959-1505981 CTGGGGATGGGGCAGCTCCCTGG + Intergenic
968618805 4:1594311-1594333 CACAGGCTGGGGCAGGTGCTGGG - Intergenic
968741205 4:2332618-2332640 CACAGGAAGGAGCAGGTTCTGGG + Intronic
969411257 4:7029867-7029889 CAGAGGAGGGAGCAGGCTCTGGG + Intronic
969676022 4:8614819-8614841 CAGAGGCTGGGGGGGCTTCCTGG + Intronic
969707296 4:8818934-8818956 TAGAGGGTGGGGCAGCCTCTTGG + Intergenic
970546081 4:17131767-17131789 CAGAGAATGGGGAAGGTGCTAGG - Intergenic
971266337 4:25099341-25099363 CAGAGGATGAAGCAGCCTCTTGG + Intergenic
971340296 4:25762598-25762620 CAGAATATGGGGCAGCTATTAGG + Intronic
975377053 4:73658174-73658196 CAAAAGATGGGGCAGCCTCAGGG - Intergenic
976544349 4:86317343-86317365 CAGAGTAATGGGCATCTTCTAGG - Intronic
977574750 4:98663877-98663899 CAGAGGATGAGGGAGAGTCTTGG - Intergenic
981016770 4:139981744-139981766 GAGAGGATGGGCCAGCTATTTGG + Intronic
981492710 4:145357212-145357234 CAGAGGCTGGGGCAGGTAGTAGG + Intergenic
981761272 4:148197963-148197985 TTGAGGTTGGGGCAGCTTTTTGG + Intronic
982745451 4:159101511-159101533 CAGAGGATGGGGAAGGCTGTGGG + Intergenic
983511212 4:168611183-168611205 CAGAGTATGGCGCAGGCTCTTGG - Intronic
987015798 5:13818056-13818078 CAGTGAATGAGGCATCTTCTAGG - Intronic
987659465 5:20854219-20854241 CAGAGGATGGAGCAGTTTGTAGG + Intergenic
988473295 5:31561301-31561323 AAGAGGATGGGGCATCTTTTGGG + Intergenic
988764185 5:34351428-34351450 CAGAGGATGAAGCAGTTTGTAGG - Intergenic
990709739 5:58566945-58566967 GCCAGGAGGGGGCAGCTTCTTGG - Intergenic
990767249 5:59198504-59198526 CAGAGCATGTGGCACCTCCTTGG - Intronic
992462127 5:76971013-76971035 AAAAGGATGGGGCAGCTTTCTGG + Intronic
992758180 5:79928950-79928972 CAGGGGATAGGGCTGCATCTGGG - Intergenic
993383242 5:87232377-87232399 CAGAGTTTGGAACAGCTTCTGGG + Intergenic
994474405 5:100249032-100249054 CAGAGGGTGGGGCAGTTTGGAGG + Intergenic
994593816 5:101806596-101806618 CAGGGGCAGGGGCAACTTCTGGG - Intergenic
996863083 5:128086829-128086851 CAGAGTAAGGGACAACTTCTGGG - Intronic
997474727 5:134136301-134136323 GAGAGGCTGGGGCAGCTGCAGGG - Intronic
998888339 5:146718846-146718868 TAGAGGCTGAGCCAGCTTCTAGG + Intronic
1001513535 5:172339453-172339475 CAGAGGACGGAGCAGCTCCGGGG - Exonic
1002398443 5:178976210-178976232 CAGAGAATGGGGCAGCTGGCGGG - Intergenic
1002687363 5:181024263-181024285 CAGAAGGTGGGGCACCTCCTTGG - Intergenic
1002795953 6:471140-471162 CTGGGGGTGGGGCAGCCTCTGGG - Intergenic
1003308185 6:4947173-4947195 GAGGGGATGGGGCAGGTTTTGGG + Intronic
1003682873 6:8272991-8273013 CAGTGTATGTGGCAGCTTCTAGG - Intergenic
1004945249 6:20604995-20605017 TGGAAGATGGGGCTGCTTCTTGG + Intronic
1006254075 6:32815334-32815356 CAGAGGAGGGGGCTGGTTCATGG - Intronic
1007150769 6:39688628-39688650 CAAATGCTGTGGCAGCTTCTTGG - Intronic
1007237438 6:40401006-40401028 CAGAGGATGTGGGAGCCTCTGGG - Intronic
1008762853 6:54874988-54875010 CAGGTGATGGGGAATCTTCTTGG + Intronic
1008872762 6:56291282-56291304 CTGAGAAAGGGGCAGTTTCTTGG + Intronic
1013469321 6:110447642-110447664 AAGAGGGGGTGGCAGCTTCTGGG - Intronic
1017708272 6:157144690-157144712 CAGAGCAGGGGCCAGCTGCTGGG - Intronic
1018041918 6:159932248-159932270 CTGAGGAAGGGGCACCTTCCTGG - Intergenic
1018380557 6:163254734-163254756 GTGAGGAGGGGGCACCTTCTGGG - Intronic
1019503932 7:1381168-1381190 CAGAGCCTGGGGCAGCTCATGGG + Intergenic
1019559781 7:1650304-1650326 CAGAAAATGGGGCAGCTACTGGG - Intergenic
1019643750 7:2118224-2118246 GAGTGGATGGGGCAGCATCCAGG + Intronic
1020114858 7:5470674-5470696 AAGGGGAGGGGGCAGCCTCTGGG - Intronic
1022339807 7:29457275-29457297 CAGAGAATGTGGCAGCTTCAAGG - Intronic
1023031207 7:36092023-36092045 CAGAGCATGGGGCTGGTTCAGGG - Intergenic
1024054160 7:45648852-45648874 CAGAAGGTGGCTCAGCTTCTAGG - Intronic
1025907219 7:65796761-65796783 ATGAGGATGGAGCACCTTCTAGG + Intergenic
1026041397 7:66871154-66871176 ATGAGGATGGAGCACCTTCTAGG + Intergenic
1026546582 7:71328337-71328359 AAGAGAATGGGGTGGCTTCTTGG - Intronic
1028207145 7:88031290-88031312 CAGAGGATGGAGCAGTTTGAAGG + Intronic
1030099888 7:105936448-105936470 CAGAGGAAGAGGCACCATCTTGG + Intronic
1030169597 7:106588234-106588256 AAGAGGATGGGGCAGGTGCTGGG - Intergenic
1032841097 7:135714264-135714286 CAGGAGTTGGGCCAGCTTCTGGG - Intronic
1033127690 7:138719673-138719695 GAGAGGATAGGGCAGTATCTGGG - Intronic
1033618144 7:143037118-143037140 CAGAGGATGGGGCTTGTTATTGG + Intergenic
1033672904 7:143510787-143510809 TGGAGGATGGGGCAACCTCTGGG + Intergenic
1034567138 7:151924302-151924324 CAGAGGATGGTGCAGAGTCCTGG - Intergenic
1035090690 7:156307575-156307597 CAGAGAAAGGGGCGGCTCCTCGG + Intergenic
1039202860 8:35116091-35116113 CAGAGGATGGGGCAGGCTTGTGG + Intergenic
1039791403 8:40878786-40878808 CAGAGGAGGGGGCATCTCCCAGG - Intronic
1041854430 8:62434578-62434600 CAGAGGAAGGGACAGATACTTGG - Intronic
1042163452 8:65921726-65921748 CAAAAGATGGGGCAGAATCTTGG - Intergenic
1043418089 8:80071914-80071936 CAGGAGATGGGGCAGGTGCTGGG - Intronic
1043526611 8:81104601-81104623 CAGAGGATGGAGCAGTTTGCAGG - Intronic
1045680064 8:104649449-104649471 CAGGTGATGGGGCAGCTTCAGGG - Intronic
1046550999 8:115716821-115716843 CAGGAGATGGGGCAGCTTCGTGG + Intronic
1047608601 8:126498651-126498673 CAGTGGATGCTGTAGCTTCTGGG - Intergenic
1049254224 8:141605301-141605323 GGGAGGCTGGGGCAGTTTCTAGG + Intergenic
1050899839 9:10933097-10933119 TGGAGGATGGTCCAGCTTCTTGG - Intergenic
1051913920 9:22185343-22185365 CAGAGGCAGGGGCAGCTCCCGGG + Intergenic
1052347540 9:27425511-27425533 CAGAGCCTGGGGCAGCACCTTGG + Intronic
1054987343 9:71278037-71278059 CTGGGGCTGGGGCAGCTGCTCGG + Intronic
1056786379 9:89595237-89595259 GAGAGGATGGGGGAGCTGCATGG + Intergenic
1057283815 9:93731408-93731430 CAGATGGTGGAGCAGATTCTAGG + Intergenic
1057565755 9:96164664-96164686 CACACCATGGGGCTGCTTCTGGG - Intergenic
1057991886 9:99779041-99779063 CAGAGGGTTTGGCAGCTTGTGGG - Intergenic
1058141716 9:101363363-101363385 CAGAGGAAAGGGCACCTTGTAGG + Intronic
1060042105 9:120308668-120308690 CTGAGGGTGGGGAAGCTTCCTGG + Intergenic
1060230157 9:121820057-121820079 CAGAGGAGGGGGCTGCTCCCGGG + Intergenic
1061796363 9:133087875-133087897 CAGAGGATGGGGAGGGTGCTGGG + Intergenic
1061911541 9:133727798-133727820 CACAGGAGGGGGCAGCTGCAGGG + Intronic
1062044415 9:134418449-134418471 CAGAGGTTGGGGCAACCTCATGG - Intronic
1062530593 9:136997801-136997823 CAAAGGATGGGGCAGCCACATGG - Intergenic
1186061954 X:5718601-5718623 AAGATGATGGTGCAGATTCTAGG + Intergenic
1188727867 X:33607380-33607402 CAGGGGCAGGGGGAGCTTCTTGG + Intergenic
1190699326 X:52975112-52975134 CAGATCAGTGGGCAGCTTCTGGG + Intronic
1192784042 X:74320849-74320871 GCGAGAATTGGGCAGCTTCTGGG - Intergenic
1192804569 X:74497422-74497444 GCGAGAATTGGGCAGCTTCTGGG + Intronic
1193344803 X:80393007-80393029 CAGAGGTTGTTGTAGCTTCTTGG - Intronic
1196846337 X:119899449-119899471 CAGAGGAAGGTGCAGCTCCCCGG + Intronic
1197291269 X:124661457-124661479 CAGGGGATAGTTCAGCTTCTAGG - Intronic
1198162797 X:134024189-134024211 CAGAGGATGTGGCAACCACTAGG + Intergenic
1198438066 X:136636351-136636373 CAGGGGAAGGGGCAGCTTTAGGG + Intergenic
1198729185 X:139709074-139709096 CAGAGGATGGGGCAGGGTTTTGG - Intergenic
1200146679 X:153929969-153929991 GAGGGGATGGGGCAGGCTCTAGG + Exonic