ID: 954337888

View in Genome Browser
Species Human (GRCh38)
Location 3:49930310-49930332
Sequence ACGGTAGTTCTCAACTCTGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 76}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954337886_954337888 10 Left 954337886 3:49930277-49930299 CCACGTTTTAATGTATCAGTATA 0: 1
1: 0
2: 0
3: 20
4: 227
Right 954337888 3:49930310-49930332 ACGGTAGTTCTCAACTCTGACGG 0: 1
1: 0
2: 0
3: 9
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954337888 Original CRISPR ACGGTAGTTCTCAACTCTGA CGG Intergenic
903138590 1:21325324-21325346 ACGTTACTTCTCACCGCTGAAGG - Intronic
908327697 1:63039775-63039797 ATGGTAGCTCTCAATTCTGGCGG + Intergenic
916774905 1:167951870-167951892 TAGTTAATTCTCAACTCTGAAGG + Intronic
916895567 1:169158669-169158691 ACGGTAGTTCTCAAATTTCATGG + Intronic
917456277 1:175188768-175188790 CAGGTAGTTCTCAACTTTTAAGG - Intronic
1064792365 10:18972572-18972594 ACGGTAGTTTTTATCTCTGTGGG - Intergenic
1068275204 10:54785744-54785766 ACGGTAAATCTTAGCTCTGATGG - Intronic
1069527926 10:69190195-69190217 AGAGTAGTGCTTAACTCTGATGG - Intronic
1070189358 10:74097545-74097567 CCGGTTGTTTTCATCTCTGATGG - Intronic
1076319473 10:129567247-129567269 AAAGTAGTTCTCAGCTCTAAGGG + Intronic
1078547653 11:12257674-12257696 ACGGTAGTCCTTAGCTCTCAGGG + Intronic
1080785989 11:35475490-35475512 ACGGTGGTTTTCAAATCTTAGGG - Intronic
1086847659 11:91772178-91772200 AAGGTAGTTCTTCATTCTGAAGG - Intergenic
1090240601 11:125178904-125178926 ACAGTAATTCTCAACTCAGGTGG + Intronic
1090357355 11:126148902-126148924 ACAGTGGTTCTCAATTCTGGTGG - Intergenic
1090512715 11:127392751-127392773 ACTGTTGTTTTCAACTCTGCTGG - Intergenic
1091799042 12:3313248-3313270 ATGCTAGTACTCATCTCTGAGGG - Intergenic
1097029450 12:56080649-56080671 ACAGTAGTTCACACTTCTGAGGG + Intronic
1100089273 12:90950961-90950983 ACCATAGTTCTCAACTCCCATGG - Intronic
1100342193 12:93690036-93690058 TGGGTAGTTCACAACTTTGAAGG + Intronic
1101559371 12:105841378-105841400 AAAGTATTTCTCATCTCTGAAGG + Intergenic
1101843873 12:108346329-108346351 AAGGTAGTTTTCCACTCTGGGGG + Intergenic
1106691718 13:32124569-32124591 AAGGTGGTTCTTAACTCAGAAGG - Intronic
1115402273 14:32975458-32975480 ACAGTAGTTCACATCTGTGATGG - Intronic
1120377312 14:83726501-83726523 ACAGTAGTCCTCCCCTCTGAAGG + Intergenic
1123886579 15:24733090-24733112 TGGGTAGTCTTCAACTCTGATGG - Intergenic
1141843918 16:86594009-86594031 ATGGGAATTCTCAACTCTGGAGG + Intergenic
1143197317 17:5085960-5085982 ACAGTACTTCCCAACTCAGATGG + Intronic
1147378670 17:40038879-40038901 ATGGTGGTTCTGAACACTGATGG - Intronic
1149248959 17:54745886-54745908 ACTGAGGCTCTCAACTCTGAAGG - Intergenic
1154264030 18:12863732-12863754 ACGGTGGTTCTCTACTGTGTTGG - Intronic
1155177906 18:23317107-23317129 TCAGTAGTTCTCAGCCCTGATGG + Intronic
1155347914 18:24876747-24876769 TGGGTAGTTCTCAACAGTGAGGG - Intergenic
1162957080 19:14105018-14105040 ACAACAGTTCTCAACTCTGATGG - Intronic
928700609 2:33895172-33895194 ACGGTATTTGTCAACTGTCATGG - Intergenic
932186818 2:69704413-69704435 ACATTATTTCTCAACTCTGTGGG + Intronic
932809395 2:74811601-74811623 AAGGAAGTTGTAAACTCTGATGG + Intergenic
933259578 2:80117257-80117279 ACTGTAGTTCTTTACTCTAATGG + Intronic
934943684 2:98520875-98520897 ACAGAAGTTCACAACTGTGAGGG - Intronic
935700764 2:105809900-105809922 AAGGCAGTTCCCAACACTGAGGG + Intronic
941187107 2:162330716-162330738 TCCCTAGTTCTCACCTCTGATGG - Intronic
944504595 2:200397729-200397751 ATGGTAATTCTCAACTCATAGGG + Intronic
1169155106 20:3323081-3323103 TAGTTATTTCTCAACTCTGAAGG - Intronic
1184612773 22:45615651-45615673 AAGGTGGGACTCAACTCTGAAGG - Intergenic
951763086 3:26165705-26165727 ACTGTGGTTCTCAACTTTGGGGG - Intergenic
954337888 3:49930310-49930332 ACGGTAGTTCTCAACTCTGACGG + Intergenic
954832207 3:53431324-53431346 AATATATTTCTCAACTCTGAAGG - Intergenic
958017659 3:87960389-87960411 ACAGTAATTCTCAAAACTGAAGG + Intergenic
962429818 3:135308614-135308636 TCTGTAGTTCTCTTCTCTGAGGG - Intergenic
967689277 3:192455301-192455323 ACTCTAGTTCTCAACTCAGATGG + Intronic
969415781 4:7057397-7057419 ACGGTAGTCCTTACCTCTGTCGG + Exonic
971745718 4:30577422-30577444 AAAGTGGTTCTCAACTCTGAAGG + Intergenic
974949157 4:68567275-68567297 ACTATATTTCTCAACTGTGAAGG + Intronic
984983541 4:185305234-185305256 AGGGTAGTTCTCAGCTGTGGGGG - Intronic
994194054 5:96901882-96901904 ACTGAAGTTCTCAAGGCTGATGG - Intronic
996202087 5:120687734-120687756 ATGGTATCTTTCAACTCTGAGGG - Intergenic
996445813 5:123549114-123549136 ACAGAAGTTCTCAACTATGATGG - Intronic
1002901237 6:1411201-1411223 ACAGCAGTTCTCAACTGGGATGG + Intergenic
1003040883 6:2686213-2686235 AAGGTGGTTCTCAAATGTGAGGG - Intronic
1007023833 6:38549676-38549698 AGGGTGGTTCCCTACTCTGAAGG - Intronic
1008174493 6:48250689-48250711 GCAATGGTTCTCAACTCTGATGG - Intergenic
1012098536 6:94998758-94998780 AGGGTAGTTCTCAGCTCTGCTGG + Intergenic
1014855351 6:126394673-126394695 AAGGAAGTTCTCCAATCTGAAGG - Intergenic
1015005196 6:128271675-128271697 ACTGGTGTTCTCAACTTTGAAGG + Intronic
1016872400 6:148831596-148831618 ACAATTGTTCTCATCTCTGAGGG - Intronic
1018709170 6:166485667-166485689 GCGGTGTTTCTTAACTCTGAGGG - Intronic
1019019602 6:168907033-168907055 ATGTTAGTTCTCAGCCCTGATGG - Intergenic
1020041347 7:5005014-5005036 ACGTTATTTCTCAACTCTGTGGG + Intronic
1021198637 7:17700472-17700494 AAGGTAGTTCTTAAAACTGAAGG + Intergenic
1021605649 7:22406714-22406736 AGAGTAGTTCTCAACCCTGGCGG - Intergenic
1028423592 7:90661312-90661334 ACTGTAGTGTACAACTCTGAGGG + Intronic
1030343513 7:108407699-108407721 GCAGTAGTTCTCAGCTCTGCTGG + Intronic
1031762445 7:125730827-125730849 ACTGTAGTTCTCAATTTGGAGGG - Intergenic
1039253475 8:35692118-35692140 ACGGTGGTTTTCACTTCTGATGG + Intronic
1043656509 8:82674318-82674340 ACTGTGGTTCTCAACTCTGCAGG + Intergenic
1050108144 9:2186920-2186942 ACGGTGGTTCTCAAACCTGGAGG + Intronic
1050150426 9:2614343-2614365 ACTGTGGTCCTCAACCCTGATGG - Intergenic
1051022387 9:12559682-12559704 AGGGCAGTTCTCAACTGTAAAGG - Intergenic
1052912955 9:33900218-33900240 AAGGCAGTTCTCCACTCTGTGGG - Exonic
1053192406 9:36083766-36083788 ACAGGAATTCTCAATTCTGAGGG + Intronic
1056461676 9:86814900-86814922 ACTGCAGCTCTCAACTCTGATGG - Intergenic
1057627637 9:96691926-96691948 CTGGCAGGTCTCAACTCTGAGGG + Intergenic
1186352417 X:8753701-8753723 AGGTTGGTTCTCATCTCTGAAGG - Intergenic
1187941306 X:24385218-24385240 ACCGTAGTTTTCAAATATGAAGG - Intergenic
1199851997 X:151730522-151730544 ACTTTATTTCTCAATTCTGAGGG - Intergenic
1201715295 Y:17037867-17037889 ACTGTAGTTCCCAACTTTGGAGG - Intergenic