ID: 954342291

View in Genome Browser
Species Human (GRCh38)
Location 3:49964514-49964536
Sequence ACTCATTTGCAGATTGTGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 389
Summary {0: 1, 1: 1, 2: 3, 3: 50, 4: 334}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954342288_954342291 20 Left 954342288 3:49964471-49964493 CCTGTTTTTGTAAATAAAGTTTT 0: 330
1: 802
2: 1023
3: 995
4: 1555
Right 954342291 3:49964514-49964536 ACTCATTTGCAGATTGTGTATGG 0: 1
1: 1
2: 3
3: 50
4: 334

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954342291 Original CRISPR ACTCATTTGCAGATTGTGTA TGG Intronic
901722474 1:11210601-11210623 CATCATTTACACATTGTGTATGG + Intronic
902129295 1:14244822-14244844 AAGCGTGTGCAGATTGTGTAGGG + Intergenic
902961146 1:19963508-19963530 ACTCCATTGCTAATTGTGTAAGG + Intergenic
903695608 1:25204357-25204379 ACTTATTTGCATATTGTCTGTGG - Intergenic
904893412 1:33796044-33796066 ATTCATGTACACATTGTGTATGG - Intronic
905044660 1:34986205-34986227 ACTTATCTGCATATTGTCTATGG + Intronic
906970236 1:50505664-50505686 ATTCATTTGCATATTGTTTATGG + Intronic
907593476 1:55698402-55698424 CATCATTTGCATATTGTCTATGG - Intergenic
907760157 1:57349795-57349817 ACTCATTGGCAGTTTGTCCAAGG + Intronic
908150463 1:61295921-61295943 ACTCATTTTCAGGTTGAATATGG + Intronic
908463453 1:64368510-64368532 ATTCATTTGCATATTGTCTATGG - Intergenic
909196356 1:72630067-72630089 ATGCATTTGCATATTTTGTAGGG - Intergenic
909569291 1:77089767-77089789 ATTCATTTGCAGTTTATGAAAGG - Exonic
909629567 1:77757786-77757808 AAACATTTCAAGATTGTGTAAGG - Intronic
910307847 1:85787129-85787151 ATTCATTTACATATTGTTTAGGG + Intronic
910389860 1:86730224-86730246 CCTCATTTTCAGATTTTATAAGG - Intronic
910816309 1:91294559-91294581 ATTCATTTACATATTGTCTATGG + Intronic
913560020 1:120008515-120008537 ATTCATTTATAGATTGTCTATGG + Intronic
913968259 1:143394502-143394524 ATTCATTTACACATTGTCTATGG - Intergenic
914062638 1:144220094-144220116 ATTCATTTACACATTGTCTATGG - Intergenic
914116512 1:144746260-144746282 ATTCATTTACACATTGTCTATGG + Intergenic
914280605 1:146167934-146167956 ATTCATTTATAGATTGTCTATGG + Intronic
914541648 1:148618874-148618896 ATTCATTTATAGATTGTCTATGG + Intronic
914624990 1:149452373-149452395 ATTCATTTATAGATTGTCTATGG - Intergenic
915450252 1:156000135-156000157 AGTCATTTACATATTGTCTATGG + Intronic
916313071 1:163418201-163418223 TCCCTATTGCAGATTGTGTAAGG + Intergenic
916925668 1:169518037-169518059 ATTCATTTACATATTGTTTATGG + Intronic
918030646 1:180805505-180805527 ACTCATTCTCAGTTTGGGTATGG - Intronic
918383308 1:183979590-183979612 ATTCATTTACATATTGTTTATGG - Intronic
918816801 1:189196480-189196502 ACTCATTTACATATTGTCTATGG + Intergenic
921032024 1:211342148-211342170 ATTCATTTACATATTGTCTATGG - Intronic
921122087 1:212146020-212146042 ATTTATTTGCATATTGTCTATGG + Intergenic
922273611 1:224056659-224056681 ACTCATATACAGATGGTGGAAGG - Intergenic
922641696 1:227238473-227238495 ATTCATTTGCAAACTGTCTATGG + Intronic
922888498 1:229040628-229040650 ACTCATATCCAGAATCTGTAAGG + Intergenic
923737835 1:236628270-236628292 ACTCATATGCAGAATATTTAAGG + Intergenic
923988421 1:239407931-239407953 ACTCAGTTGCAGATTTCCTAAGG - Intronic
924682165 1:246248330-246248352 ACTCATTTTCGGATTTTGAAGGG + Intronic
1062901243 10:1148423-1148445 ATTCATTTGCATACTGTCTATGG - Intergenic
1063418452 10:5891247-5891269 ACTCATGAGCAGATTGAGTTTGG + Intronic
1063843075 10:10093311-10093333 ACTCATTTGCAGGTTATTTCAGG - Intergenic
1065202301 10:23324820-23324842 AACCATTTGCAGATTTTGCAAGG - Intronic
1066218028 10:33307328-33307350 ATTCATTTGCCTATTGTCTATGG + Intronic
1067020217 10:42790161-42790183 ATTCATTTACATATTGTCTATGG - Intronic
1067499944 10:46794564-46794586 ATTCATTTACATATTGTCTATGG - Intergenic
1068841257 10:61616843-61616865 ATTCATTTACAGTTTGTCTATGG + Intergenic
1069254245 10:66312399-66312421 ACACATTTGTAGATTGGGAAAGG - Intronic
1070608134 10:77914043-77914065 GCTCATTTTCAGATGGTGCAGGG - Intronic
1070656124 10:78272707-78272729 ATTCATTTGCATATTTTCTATGG - Intergenic
1071009688 10:80923545-80923567 ATTCATTTGTATATTGTCTATGG - Intergenic
1071297151 10:84229876-84229898 ACTAATTTACATATTGTCTATGG + Intergenic
1071965063 10:90843978-90844000 ACACATTTGCATATTATCTATGG + Intronic
1072512023 10:96136976-96136998 ACTCATTTACATATTGCCTATGG - Intronic
1072514285 10:96163700-96163722 ATTCATTTACATATTGTCTATGG - Intronic
1072865723 10:99058982-99059004 ATTCATTTACATATTGTCTATGG - Intronic
1073805545 10:107093770-107093792 AGTGATAGGCAGATTGTGTAAGG - Intronic
1073992311 10:109276150-109276172 TTTCATTTGCATATTGTTTATGG + Intergenic
1074645242 10:115442582-115442604 AATCATTTACATATTGTCTATGG - Intronic
1075752008 10:124780169-124780191 ATTCATTTGCATATTGTCTATGG - Intronic
1075925441 10:126248128-126248150 CCTCATCTGCAGATTGAGTGTGG + Intronic
1076199840 10:128549358-128549380 AGTCATTTGCATATTATTTATGG - Intergenic
1077522226 11:3043216-3043238 TCTCAGATGCAGGTTGTGTAAGG - Intronic
1078137098 11:8660512-8660534 ATTCATTTCCATATTGTCTATGG + Intronic
1078167275 11:8898671-8898693 ATTCATTTACATATTGTCTATGG + Intronic
1078361117 11:10668516-10668538 ATTCATTTGTATATTGTCTATGG + Intronic
1078584437 11:12569814-12569836 AGTCATTTACATATTGTTTATGG + Intergenic
1078649336 11:13172816-13172838 ATTCATTTACATATTGTCTATGG + Intergenic
1078703761 11:13717758-13717780 ATTCATTTGCCTATTGTCTATGG - Intronic
1078721437 11:13887920-13887942 ATTCATTTGTGTATTGTGTATGG + Intergenic
1080104984 11:28502384-28502406 GCTCATTTACATATTGTTTATGG - Intergenic
1080115722 11:28619516-28619538 ATTCATTTACACATTGTCTATGG - Intergenic
1080294213 11:30706580-30706602 ATTCATTTACATATTGTCTATGG - Intergenic
1081500755 11:43664292-43664314 TCTCATTTGCAGTTTGAGTAAGG + Intronic
1085133941 11:74067816-74067838 ACTCTTTTGCAGCTAGGGTATGG + Intronic
1087949176 11:104199142-104199164 ATTCATTTACATATTGTCTATGG - Intergenic
1087951632 11:104227892-104227914 GATGATTTGCAGATTCTGTAGGG - Intergenic
1088205223 11:107384680-107384702 ATTCATTTACATACTGTGTATGG + Intronic
1088483492 11:110319228-110319250 ACTCATGGGCTGATTGTGCAGGG - Intergenic
1090851103 11:130571299-130571321 ATTCATTTACACATTGTCTATGG - Intergenic
1091366672 11:135027592-135027614 ACTCATTTGCTGATTTTTCAAGG + Intergenic
1092605919 12:10118536-10118558 ACCCATCTCCAAATTGTGTATGG - Exonic
1093920646 12:24855960-24855982 TCTGATTTGCACATTGTTTAAGG - Intronic
1098608681 12:72427138-72427160 ATTCATTTACAGATTGTCTATGG - Intronic
1099499294 12:83392093-83392115 ATTCATTTGCATCTTGTCTATGG - Intergenic
1100224715 12:92544567-92544589 ATTCATTTACATATTGTCTATGG + Intergenic
1100399812 12:94219556-94219578 ACTCAAAAGCACATTGTGTAAGG + Intronic
1100959796 12:99949808-99949830 ACTCATTTACGGATTGTTAATGG + Intronic
1101289263 12:103351025-103351047 ACGCAATTACAGATTGTGAAAGG - Intronic
1101414083 12:104493732-104493754 ACACATTTACAGTTTGTGGAGGG + Intronic
1102893072 12:116576610-116576632 ATTCACTTACACATTGTGTAAGG - Intergenic
1105632146 13:22180489-22180511 ATTCATTTGTATATTTTGTAAGG + Intergenic
1105663281 13:22523439-22523461 ACTGATATGCAGACTGTGGAAGG + Intergenic
1105680723 13:22724693-22724715 ACTCCTTTGCATATTGTCCATGG + Intergenic
1106093308 13:26619189-26619211 ACTTATAAGCAGGTTGTGTATGG - Intronic
1106154698 13:27143292-27143314 ACTCATTTGCAGCATGGGTAGGG + Intronic
1107283030 13:38757941-38757963 CCTCATTTTCAGAATGTGTTAGG + Intronic
1107311897 13:39087542-39087564 ATTCATTTACACATTGTCTATGG - Intergenic
1107985555 13:45773039-45773061 ATTCATTTACATATTGTCTATGG + Intergenic
1108089055 13:46826805-46826827 ACTCATTTGCTTATTGTCTATGG + Intergenic
1109202439 13:59445936-59445958 ACTCATTTGAAGACTTTGGATGG - Intergenic
1109807455 13:67462239-67462261 ATTCATTTACATATTGTTTATGG - Intergenic
1109933294 13:69245202-69245224 AGTTATTTGCAGATAGTGTCAGG + Intergenic
1110972907 13:81788854-81788876 AGTCATTTGCAGAACGTGGATGG - Intergenic
1111966106 13:94863679-94863701 ACCCATTTACAGAATATGTATGG + Intergenic
1112365109 13:98749904-98749926 GCTCATTTGTTGATTGTGTACGG + Intronic
1112805463 13:103159842-103159864 ATTCATTTTCATATTGTGTATGG + Intergenic
1114303833 14:21402751-21402773 ACTCATTTACATATTATCTATGG + Intronic
1114963628 14:27928112-27928134 ATTTATTTTCAGATTGTGCATGG + Intergenic
1116371103 14:44133668-44133690 ACTCCTTTGTAGATTTTGAATGG - Intergenic
1116574789 14:46558920-46558942 ATTCATTTACATATTGTCTATGG + Intergenic
1117059933 14:51951772-51951794 ACTCATTTACATATTGTCTATGG + Intronic
1118423052 14:65628893-65628915 ATTCATTTGCATATTATCTATGG + Intronic
1119588961 14:75867159-75867181 ATTCATTTACATATTGTTTATGG - Intronic
1120722360 14:87902914-87902936 ACTAATTTGCAGATTGTCTCTGG + Intronic
1124448373 15:29760869-29760891 ATTCATTTACACATTGTCTATGG + Intronic
1124610631 15:31205759-31205781 ATTCATTTACAAATTGTCTATGG + Intergenic
1125876066 15:43146160-43146182 AATCATTTGCAGATTTAGTGAGG - Intronic
1126417183 15:48430037-48430059 ATTCATTTGCATATTGTCCATGG - Intronic
1126585462 15:50281659-50281681 ACCCATTTTCAAATTGTCTATGG + Intronic
1128872121 15:71167333-71167355 ATTCATTTACACATTGTCTATGG - Intronic
1130686850 15:86045555-86045577 ATTCATTTACATATTGTCTATGG - Intergenic
1132169439 15:99633870-99633892 ATTCATTTACATATTGTCTATGG + Intronic
1134285571 16:12859079-12859101 ACTCATTTACATATTGTCTGTGG + Intergenic
1134798290 16:17061556-17061578 ACTCAGTTACATATTGTCTATGG + Intergenic
1136033785 16:27522863-27522885 TTTCATTTTCAGATTGTGCACGG + Intronic
1138068234 16:53964282-53964304 ACTCATTTACATATTGTCCAGGG - Intronic
1139193527 16:64892147-64892169 ATTCATTCTCAGATTGTGGAGGG - Intergenic
1139800677 16:69520207-69520229 ACTCATTTGCACAGTGATTAAGG + Intergenic
1140149488 16:72347854-72347876 ATTCATTTACAAATTGTCTATGG + Intergenic
1140916474 16:79498301-79498323 ACTCATTGGCACATTGTCTATGG - Intergenic
1141021580 16:80501812-80501834 ATTCATTTGCATTTTGTCTATGG + Intergenic
1141182055 16:81760475-81760497 ACTCCCTTGCAGCTTGGGTAGGG - Intronic
1141977317 16:87525545-87525567 GCTCATTTGCAGGTTCTGCAAGG + Intergenic
1143519119 17:7435747-7435769 ACCCATTTGTAGGTTGTGTCTGG + Intronic
1144233496 17:13233146-13233168 ACTCATTTGTTTATTGTGAATGG + Intergenic
1144276130 17:13669911-13669933 ACTCTTATGCAGTTTTTGTAGGG - Intergenic
1144566241 17:16361950-16361972 CATCATTTGCACATTGTGGATGG + Intergenic
1146841378 17:36157764-36157786 ATTCATTTACAAATTGTGTATGG - Intergenic
1146853630 17:36245398-36245420 ATTCATTTACAAATTGTGTATGG - Intronic
1146869538 17:36369290-36369312 ATTCATTTACAAATTGTGTATGG - Intronic
1147072414 17:37969914-37969936 ATTCATTTACAAATTGTGTATGG - Intergenic
1147083938 17:38049451-38049473 ATTCATTTACAAATTGTGTATGG - Intronic
1147099884 17:38173418-38173440 ATTCATTTACAAATTGTGTATGG - Intergenic
1147351186 17:39845573-39845595 ATTCATTTGTATATTGTCTATGG + Intronic
1148176286 17:45568497-45568519 ATTCATTTACATATTGTCTATGG + Intergenic
1148710222 17:49674887-49674909 ACTGTTTTGCAGATTGGGGAGGG - Intronic
1148763410 17:50021428-50021450 GCACATCTGCAGATTGTGCAAGG - Intergenic
1149534021 17:57418127-57418149 ATTCATTTACATATTGTCTATGG - Intronic
1149573418 17:57694053-57694075 ATTCATTTACATATTGTCTATGG + Intergenic
1149858142 17:60103079-60103101 ATTCATTTACAAATTGTGTATGG + Intergenic
1150082889 17:62256708-62256730 ATTCATTTACAAATTGTGTATGG - Intergenic
1151023974 17:70655788-70655810 ATTCATTTACATATTGTCTATGG - Intergenic
1151793721 17:76327836-76327858 ACACATTTGTAGACTGTGTATGG - Intronic
1156412229 18:36841691-36841713 ATTCATTTGCATATTGCTTATGG - Intronic
1156824225 18:41410876-41410898 ACACTTTTGCAGATTATTTAGGG - Intergenic
1157005763 18:43582124-43582146 ATTCATTTACATATTGTGTATGG - Intergenic
1157590609 18:48834254-48834276 AGTCATTTGCATATCGTCTACGG - Intronic
1157898644 18:51492250-51492272 ATTCATTTACATATTGTCTATGG - Intergenic
1163106854 19:15128473-15128495 AATCATGTGCAGATTGTGTGTGG - Intergenic
1163472080 19:17503404-17503426 ATTCATTTGCACATTGTCTATGG - Intronic
1164807294 19:31126908-31126930 ATTTATTTACAGATCGTGTATGG + Intergenic
1166154241 19:40898888-40898910 ATTCATTTACATATTGTCTATGG - Intergenic
1167452086 19:49576979-49577001 ACCCATTTTCAAATTGTGTTAGG - Intronic
1167556382 19:50198640-50198662 ATTCATTTGCATATTGTCTCTGG + Intronic
1167729122 19:51240495-51240517 ATTCATTTTCAGATTGTCTGTGG - Intronic
1202702046 1_KI270712v1_random:171966-171988 ATTCATTTACACATTGTCTATGG - Intergenic
925830542 2:7889901-7889923 ATTAATTTCCAGATTATGTAAGG - Intergenic
928136218 2:28689576-28689598 ATTCATTTACATATTGTCTACGG - Intergenic
928561103 2:32486348-32486370 ATTCATTTACATATTGTCTATGG - Intronic
928669747 2:33589788-33589810 ACTCATTTATATATTGTCTATGG + Intronic
928829603 2:35464367-35464389 ATGCATTTGCATATTGTCTATGG - Intergenic
929496533 2:42449372-42449394 ACTCATTTACACATTGTCTATGG + Intronic
929880610 2:45833951-45833973 ACTAATGTGGAGAGTGTGTAAGG - Intronic
929915746 2:46134110-46134132 ACACATTTCCAGATAATGTATGG - Intronic
930227419 2:48808165-48808187 ATTCATTTACACATTGTCTAGGG - Intergenic
930621396 2:53647470-53647492 ACTCATTGACATATTGTCTATGG + Intronic
931120614 2:59214823-59214845 ACTCATTTACATATTGTCTAAGG - Intergenic
931160357 2:59683359-59683381 ATTCCTTTACATATTGTGTATGG + Intergenic
931585121 2:63817590-63817612 AATCATTTACATATTGTCTATGG + Intronic
931876066 2:66514142-66514164 ACTCCTTTGCAGATTGAGATGGG - Intronic
932552042 2:72781558-72781580 ACTCATTTGTTTATTGTCTATGG - Intronic
932885762 2:75547909-75547931 ACTCATTTGCATATTGTCTGTGG + Intronic
933019460 2:77173185-77173207 ATTCAATTTCAGATTCTGTAAGG - Intronic
933026479 2:77266074-77266096 ACTCATTTACACATTGTTGATGG + Intronic
933249453 2:80012599-80012621 ATTCATTTGCATATTATCTATGG - Intronic
933320476 2:80770082-80770104 ATTTATTTGCATATTGTCTAAGG + Intergenic
933687172 2:85151737-85151759 ATGCATTTGCATATTGTTTAGGG + Intronic
934172958 2:89555416-89555438 ATTCATTTACACATTGTCTATGG - Intergenic
934283272 2:91629773-91629795 ATTCATTTACACATTGTCTATGG - Intergenic
934621292 2:95809980-95810002 ATTTATTGGCAGATTGTGAAGGG + Intergenic
935205551 2:100893780-100893802 ACTCATTTACATGTTGTCTATGG + Intronic
935940377 2:108231299-108231321 ATTCATTTACACATTGTCTATGG - Intergenic
936671983 2:114667063-114667085 ACACATTTGCATAGTGTCTATGG - Intronic
937020782 2:118652185-118652207 ACTCATTTGTTGTTTGAGTATGG - Intergenic
937580526 2:123481639-123481661 ACTCATTTGTATGTTGTCTATGG + Intergenic
937636336 2:124159392-124159414 ATTCATTTACATATTGTCTATGG - Intronic
937639502 2:124195472-124195494 ACTCATTTGCATCATGTCTATGG - Intronic
938687981 2:133759841-133759863 ATTCATTTTCATATTGTCTATGG - Intergenic
938707825 2:133948759-133948781 ACTCATTTACATATCGTCTATGG - Intergenic
939467292 2:142574642-142574664 ATTAATTTGCAGAATGTCTAAGG + Intergenic
939789726 2:146556732-146556754 ATTCATTTGCATATTGTGATTGG + Intergenic
939898815 2:147826579-147826601 AATCAATTGAAGATAGTGTAAGG - Intergenic
940178693 2:150907411-150907433 ACTCATTTACATATTGTCCATGG + Intergenic
940263965 2:151817088-151817110 ACATATGTGCAGCTTGTGTAGGG - Intronic
940633049 2:156262699-156262721 ATTCATTTACATATTGTCTATGG + Intergenic
940677732 2:156745795-156745817 ATTCATTTACATATTGTCTATGG - Intergenic
940899850 2:159116627-159116649 ACTCATTTACGTATTGTCTAAGG - Intronic
941108881 2:161395384-161395406 ATTCTTTTACATATTGTGTATGG - Intronic
941625564 2:167826923-167826945 AAGCATTTGCTGATTTTGTATGG + Intergenic
942343612 2:174977194-174977216 ACTAATTTACATATTGTCTATGG - Intronic
942552717 2:177136116-177136138 ATTCATTTACATATTGTCTATGG + Intergenic
944076112 2:195732849-195732871 ATTCATTTACACATTGTCTATGG - Intronic
944400457 2:199320056-199320078 CCTCTTCTGCAGATTCTGTAGGG - Intronic
944749376 2:202692854-202692876 ATTCATTTACAGGTTGTCTATGG - Intronic
945134135 2:206608219-206608241 ATTCATTTACATATTGTTTATGG - Intronic
947202724 2:227629289-227629311 ACTCAAATGCAGGTTGTGTGTGG - Intronic
948917589 2:241043812-241043834 ATTCATTTACATATTGTCTATGG - Intronic
1169006588 20:2212461-2212483 ACTCATTAGCAGAATGTGTAAGG - Intergenic
1169649957 20:7855905-7855927 ACTCATTTACATATTGTCTAAGG + Intergenic
1171307377 20:24117915-24117937 GCTCACTTCCACATTGTGTAGGG + Intergenic
1173403847 20:42748089-42748111 ATTCATTTGCATATTTTTTATGG + Intronic
1173487522 20:43452299-43452321 ATTCATTTACACATTGTCTATGG - Intergenic
1174581547 20:51575699-51575721 ATTTATTTACAGATTGTCTATGG + Intergenic
1174820382 20:53721746-53721768 ATTCATTTACATATTGTGTATGG - Intergenic
1175095256 20:56535957-56535979 ACTCATTTCTATATTGTTTAAGG - Intronic
1175188316 20:57194871-57194893 ACTCATTGGCAGATGGTGCAGGG - Intronic
1175651609 20:60729541-60729563 ATTCATTTGCATATGGTCTATGG - Intergenic
1177169072 21:17636178-17636200 GCTTATTTGCAGATTCTTTAGGG + Intergenic
1177232836 21:18344716-18344738 AGTCATTTGAAGTTTGTGAAGGG + Intronic
1177376588 21:20278346-20278368 GCCCATTTCCAGATTGTGTCTGG - Intergenic
1177538740 21:22463955-22463977 ACTCATATCCAGAATGTATAAGG - Intergenic
1178095946 21:29215925-29215947 AGTCATTTACAGATTGTCTATGG - Intronic
1179511608 21:41877475-41877497 CCTCATTTGCAAAGTGTGGATGG - Intronic
1181880003 22:25971130-25971152 ATTCATTTGCATAATGTCTAGGG - Intronic
1182578390 22:31289430-31289452 TGTCATTTGCTGATTGTCTAGGG - Intronic
1183000568 22:34855333-34855355 ACTCTTTTACATATTGTTTATGG - Intergenic
1183964801 22:41435247-41435269 ACTGGTTTGCAGACTGTGGAAGG - Exonic
1184094463 22:42309128-42309150 CCTCATTTGCAGAGTGGGCATGG - Intronic
1184263032 22:43330149-43330171 ACTCAAATGCACATTCTGTAAGG + Intronic
1184321022 22:43742314-43742336 ACTCATTTACATATCGTCTAGGG + Intronic
949577271 3:5350862-5350884 ATTCATTTACATATTGTCTAAGG - Intergenic
949790414 3:7786321-7786343 GCTCATTTACATATTGTGTGTGG - Intergenic
951623369 3:24631617-24631639 ATTCATGTGCAGATTTTGTGTGG + Intergenic
952327969 3:32337869-32337891 ATTCATTTACATATTGTTTATGG + Intronic
953813703 3:46135596-46135618 ACTCATTTGCTGATTGAGTTGGG + Intergenic
954342291 3:49964514-49964536 ACTCATTTGCAGATTGTGTATGG + Intronic
955310580 3:57882608-57882630 ATTCATTTGCATATTGTCCATGG - Intronic
955830316 3:62994593-62994615 ATTCATTTACATATTGTCTAAGG + Intergenic
955893343 3:63673680-63673702 ATTCATTTGCATATTGTCTCTGG - Intronic
955936344 3:64106371-64106393 ATTCATTTGCATATTGTCGAGGG + Intronic
956012827 3:64849883-64849905 AATCATTTACAGATTGTCTATGG - Intergenic
956352162 3:68349692-68349714 ATTCATTTGCATATTGCTTATGG - Intronic
956608465 3:71097331-71097353 ATTCATTTACATATTGTCTATGG + Intronic
956654749 3:71537959-71537981 AGTCACTTACAGATTGTCTATGG + Intronic
958440634 3:94152099-94152121 AATCCCTTGCTGATTGTGTATGG + Intergenic
958675735 3:97265855-97265877 ACTCATTTACGTATTGTCTAGGG - Intronic
959431843 3:106263799-106263821 ATTCATTTACATTTTGTGTATGG - Intergenic
959517314 3:107283524-107283546 ATTCATTTGCATATTGCATATGG - Intergenic
960542701 3:118879148-118879170 AATCATTTACATATTGTTTATGG + Intergenic
964441960 3:156721010-156721032 ATTCTTTTGCATATTGTCTATGG - Intergenic
964467815 3:157017183-157017205 ATTCATTTGTATATTGTCTATGG - Intronic
964865839 3:161259713-161259735 TCTCATTTACACATTGTCTATGG - Intergenic
965276818 3:166694437-166694459 TCTCATTTGTAGTTTGTGTTCGG - Intergenic
967654666 3:192032634-192032656 ATTCATTTGCAAATTGTGTATGG + Intergenic
967875139 3:194263666-194263688 ATTCATTTACATATTGTCTATGG + Intergenic
968012788 3:195297381-195297403 AAGCATCTGCAGAATGTGTAAGG - Intronic
969826809 4:9764272-9764294 ATTCATTTACACATTGTCTATGG - Intergenic
971082285 4:23227239-23227261 ATTCACTTGCAGAATGAGTAGGG + Intergenic
971150530 4:24026736-24026758 AATCATCTGCAGTTTGTCTAAGG + Intergenic
972704014 4:41523357-41523379 ATTCATTTACATATTGTCTATGG - Intronic
974243381 4:59281810-59281832 TATCATTTGGAGATTGAGTATGG - Intergenic
974324044 4:60390876-60390898 ATTCATTAGAAGATTGAGTATGG + Intergenic
975286669 4:72629328-72629350 TCTCATTTGCAGATTCTGCTAGG + Intergenic
975328637 4:73088936-73088958 ATTCATTTGCATATTGTATAAGG - Intronic
975820196 4:78262946-78262968 ATTCATTTACATATTGTCTATGG - Intronic
979318436 4:119295797-119295819 ATTCATTTACATATTGTTTATGG - Intergenic
980032975 4:127851792-127851814 ACTAATATTCAGAATGTGTAAGG + Intergenic
981210434 4:142097555-142097577 CCTGATTTGCATATTGTCTATGG + Intronic
983911454 4:173244127-173244149 ATTCATTTACATATTGTCTATGG + Intronic
984643678 4:182198214-182198236 TCTAATCTGCAGAATGTGTAGGG - Intronic
984743769 4:183193613-183193635 TGTCATTTGCTGATTGTGTTGGG + Exonic
985137773 4:186805185-186805207 ATTCATTTGCATATTGTCTAAGG - Intergenic
986254649 5:6092061-6092083 ATTCATTTGCATATTGTCTATGG + Intergenic
986430033 5:7672768-7672790 ATTCATTTGCACATTGGCTATGG + Intronic
986627204 5:9733278-9733300 ACTCATTTGTGCATTGTCTATGG + Intergenic
986709314 5:10477049-10477071 ACTCATTTTCATATTGTCTATGG - Intergenic
989468696 5:41789236-41789258 ACTCATTTACGTATTGTTTATGG - Intronic
989744505 5:44811696-44811718 ATTCATTTATAAATTGTGTATGG - Intronic
990455602 5:55984156-55984178 ACTTATTTACATATTGTGTATGG - Intronic
991135055 5:63172939-63172961 ACTCTTTTGCAGATTGGTTTAGG + Intergenic
993573869 5:89577541-89577563 ATTCATTTACATATTGTCTATGG + Intergenic
994541188 5:101100031-101100053 ACTCATTGGCAGGTTGGATATGG + Intergenic
994841283 5:104928355-104928377 ATTCATTTACATATTGTCTATGG + Intergenic
996817050 5:127585862-127585884 ATTCATTTGCATATTGCTTACGG + Intergenic
1003528139 6:6915415-6915437 ACTCATTTGCATATGGTCTGGGG - Intergenic
1006787362 6:36677639-36677661 CCTCATTTGCAGATGGTTTATGG - Intronic
1008422006 6:51311924-51311946 ACTAACTTACAGATTATGTATGG - Intergenic
1008620530 6:53266937-53266959 ATTCATTTACATATTGTCTATGG + Intergenic
1008764461 6:54894488-54894510 ACTTATTTGTACATTTTGTATGG - Intronic
1008928595 6:56913489-56913511 ATTCATTTACATATTGTCTATGG + Intronic
1009472142 6:64040696-64040718 ACTGATTTACACATTGTCTATGG + Intronic
1009529142 6:64787562-64787584 ATTCATTTTTAGATTGTGAAGGG - Intronic
1009588193 6:65633829-65633851 ATTCATTTACATATTGTCTATGG + Intronic
1010786047 6:80003115-80003137 ACTCATAAGCAGATTGAGTCAGG - Intergenic
1011844027 6:91539682-91539704 ATTCATTTGCGTATTGTCTATGG + Intergenic
1013610980 6:111794717-111794739 ACTCGTTTCCATATTGTCTATGG + Intronic
1014652581 6:124058818-124058840 ACTCATTTGCATATTGTCTCTGG + Intronic
1016141959 6:140623855-140623877 ATTCATTTTCACATTGTCTATGG + Intergenic
1016227507 6:141757877-141757899 AGTCATTAGCAGGTTGGGTATGG + Intergenic
1016366960 6:143329838-143329860 ACTCGTTTACATATTGTCTATGG + Intronic
1016585923 6:145685496-145685518 ACACATATGCATATTGTTTAAGG + Intronic
1019264447 7:105536-105558 ACTCATATCCAGAATATGTAAGG + Intergenic
1020718340 7:11707955-11707977 ACTCATTGGCATATTTTGTAAGG - Intronic
1021316379 7:19153046-19153068 ATTCATTTGCACATTGTCTATGG - Intergenic
1022607178 7:31826927-31826949 ATTCATTTACATATTGTCTATGG - Intronic
1023291953 7:38678151-38678173 ATTCATTTGCATATTGTCTATGG + Intergenic
1023670787 7:42574458-42574480 GTTCATTTGCATATTGTCTATGG + Intergenic
1024589422 7:50868194-50868216 ACTAATTTGCAAATGGTGTGTGG - Intergenic
1026145415 7:67742342-67742364 ATTCATTTACATATTGTCTATGG - Intergenic
1027718191 7:81701834-81701856 GATCATCTGCAGATTATGTATGG + Exonic
1027741708 7:82016266-82016288 ATTCATTTGATGATTGTTTAGGG - Intronic
1029055703 7:97739388-97739410 ATTCATTTACATATTGTCTATGG - Intronic
1029362751 7:100099271-100099293 ACTCATGCGCAGATTGTGAGTGG - Exonic
1029649895 7:101884423-101884445 ACTCATTTTTAGATGGGGTAGGG + Intronic
1030383225 7:108837481-108837503 ATTCAGTTAAAGATTGTGTATGG - Intergenic
1032729689 7:134627327-134627349 ACTGATTTCCAGATGCTGTAGGG - Intergenic
1034904375 7:154930951-154930973 ATTCATTTACAGATTGGCTATGG - Intronic
1036009284 8:4703075-4703097 ACTCAAATGCAAATTATGTATGG - Intronic
1036397416 8:8381169-8381191 TGTGATTTGCAGACTGTGTAGGG - Intronic
1037241159 8:16779478-16779500 ACTCATTCACATATTGTCTATGG + Intergenic
1038606907 8:29015854-29015876 ATTCATTTACAGATTGTCTATGG - Intronic
1038669768 8:29573371-29573393 TCTTATCTACAGATTGTGTAAGG + Intergenic
1040557892 8:48497135-48497157 ACTCATTTACATATGGTTTATGG - Intergenic
1042793263 8:72632373-72632395 ACTCATTTGCATATTTTCTATGG + Intronic
1043146691 8:76665651-76665673 GCTAATGTGCAGATTGGGTACGG - Intergenic
1043219844 8:77646824-77646846 ACTAATTTTCAGATTATCTATGG + Intergenic
1043882313 8:85558593-85558615 AGTCACTTACAGATTGTCTATGG + Intergenic
1044095904 8:88064104-88064126 ATTTATTTACATATTGTGTATGG + Intronic
1046321207 8:112578791-112578813 ATTCATTTGCATATTGTCTATGG - Intronic
1046536160 8:115513607-115513629 ATTCATTTACTTATTGTGTATGG + Intronic
1047332774 8:123907064-123907086 ATTCATTTACACATTGTGTATGG - Intronic
1047338662 8:123959004-123959026 CCCTAATTGCAGATTGTGTATGG + Intronic
1047752916 8:127895880-127895902 ACTCATTTACATATTATCTATGG - Intergenic
1048601495 8:135923436-135923458 ACTGATTCTCAGATTGTGTGAGG + Intergenic
1048728941 8:137415944-137415966 ATTCATTTTCATATTGTTTATGG + Intergenic
1049127485 8:140804990-140805012 TCACATTTGTAGATTGAGTAGGG - Intronic
1050238286 9:3606327-3606349 ACACCTTTTCATATTGTGTATGG + Intergenic
1051207091 9:14699412-14699434 ATTCATTTACATATTGTCTATGG - Intergenic
1052329134 9:27249445-27249467 ACTCATTTACAGATTGTGTATGG - Intergenic
1052849986 9:33372314-33372336 TTTCATTTGCATATTGTCTACGG - Intergenic
1052965876 9:34340342-34340364 ATTCATCTGCAGATTGTGGCAGG + Intronic
1053373500 9:37583687-37583709 ACTCATTTGCATATTGTCCCTGG + Intronic
1054937333 9:70701998-70702020 ACTCATTTGGATTTTGTGGAGGG + Intronic
1054939024 9:70719991-70720013 ACTCATTTGGATTTTGTGGAGGG + Intronic
1055240924 9:74184693-74184715 ACTCATTTGAAGTTTCTGAAAGG + Intergenic
1056145482 9:83724618-83724640 ATTCATTTACATATTGTCTATGG - Intergenic
1057017030 9:91661347-91661369 ATTCATTTACATATTGTTTATGG - Intronic
1057845547 9:98519804-98519826 ATTCATTTGCACATTGTGTATGG - Intronic
1058868037 9:109179683-109179705 TCTGATTTGCAGAATGTGGATGG - Intronic
1058970504 9:110078118-110078140 ATTCATTTACATATTGTCTAAGG - Intronic
1059646514 9:116273370-116273392 ACTCATTTGCATATTGACTGTGG + Intronic
1061129966 9:128703132-128703154 ACTGATTTGGAGACTGTGCAAGG - Intronic
1186160450 X:6771835-6771857 ATTCATTTACAGATTGTCTGTGG - Intergenic
1186179709 X:6960914-6960936 ATTTATTTCCATATTGTGTATGG - Intergenic
1186844472 X:13517093-13517115 ATTCATTTACATATTGTCTATGG + Intergenic
1187037698 X:15559406-15559428 ATTCATTTTCATATTGTCTAGGG - Intergenic
1187230055 X:17412911-17412933 ACTCATTTACGTATTGTCTATGG - Intronic
1187830052 X:23371759-23371781 ACTCAATTGTAGATTATGTTTGG + Intronic
1188183056 X:27079274-27079296 ACTTATTTGGTGAGTGTGTAAGG + Intergenic
1188364199 X:29294619-29294641 ACTCATTTATATCTTGTGTATGG - Intronic
1188599421 X:31943086-31943108 ATTCATTTACATATTGTCTATGG + Intronic
1188623476 X:32255405-32255427 ATTCATTTACATATTGTCTATGG + Intronic
1188799752 X:34514241-34514263 ACTCATTTACATATTGTCTATGG + Intergenic
1188819032 X:34750609-34750631 ATTCATTTACATATTGTTTAGGG - Intergenic
1189077164 X:37928433-37928455 ATTCAGTTACAGATTGTCTATGG + Intronic
1189216195 X:39326859-39326881 ATTCATTTGCAGATATTATAAGG + Intergenic
1189554055 X:42123933-42123955 ATTCATTTGCATATTGTCTATGG - Intergenic
1189954351 X:46262579-46262601 ATTCATTTGCATATTGCCTATGG - Intergenic
1190399294 X:50015473-50015495 TCTCATTTCCATATTGTGTGGGG - Intronic
1192732157 X:73811235-73811257 ATTCATTTTCATATTGTCTATGG - Intergenic
1193206273 X:78751699-78751721 ACTCATTTCCAATTTCTGTAAGG - Intronic
1193938231 X:87649399-87649421 ACTAATTTCCAGAATATGTACGG - Intronic
1195593849 X:106665350-106665372 ATTCATTTGCATATTGTCAATGG - Intronic
1195880141 X:109585302-109585324 ACTCACTTGCAACTTGTTTAGGG - Intergenic
1196778943 X:119365133-119365155 ATTCATTTACATATTGTCTATGG + Intergenic
1197903390 X:131397182-131397204 ACTCATTCTCAGAATTTGTAAGG - Intronic
1198036541 X:132806613-132806635 ACTCATTTATATATTGTCTATGG - Intronic
1199423915 X:147679050-147679072 ATTAATTTTCAGAATGTGTATGG - Intergenic
1200285274 X:154816022-154816044 ACTCATTTTCAGCTCCTGTACGG - Intronic