ID: 954343167

View in Genome Browser
Species Human (GRCh38)
Location 3:49972283-49972305
Sequence GTGCAAAATATTAACACTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 288
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 260}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954343167_954343171 16 Left 954343167 3:49972283-49972305 CCCTCAGTGTTAATATTTTGCAC 0: 1
1: 0
2: 1
3: 26
4: 260
Right 954343171 3:49972322-49972344 CTAAACCAGGAAATTGACCCTGG 0: 1
1: 0
2: 9
3: 73
4: 327
954343167_954343170 3 Left 954343167 3:49972283-49972305 CCCTCAGTGTTAATATTTTGCAC 0: 1
1: 0
2: 1
3: 26
4: 260
Right 954343170 3:49972309-49972331 TGTGGTATAGTATCTAAACCAGG 0: 1
1: 0
2: 0
3: 13
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954343167 Original CRISPR GTGCAAAATATTAACACTGA GGG (reversed) Intronic
901210380 1:7521358-7521380 TTGCAAAATGTTACCACTGGGGG - Intronic
901252713 1:7793116-7793138 GTTCAAAAAATATACACTGAAGG - Intronic
901751250 1:11410784-11410806 TTTCAAAATATTACCACTGATGG + Intergenic
904589386 1:31601797-31601819 ATGCAAAATGTTACCATTGAGGG - Intergenic
908327545 1:63038196-63038218 TTGCAAAATGTTAAAACTGGAGG + Intergenic
909499992 1:76323752-76323774 CTTCAAAATATTAACTGTGATGG + Intronic
910867515 1:91801949-91801971 GTGAAAAAAATTAAGACTTAAGG + Intronic
911925469 1:103825199-103825221 GAGCAAAAAATCAAAACTGAAGG + Intergenic
912004582 1:104881603-104881625 ATGTAAAATATTAACAATAATGG - Intergenic
913024784 1:114826673-114826695 TTGGAAAATATTACCATTGAAGG + Intergenic
914857598 1:151363915-151363937 GTGTAATATATTTCCACTGATGG - Intergenic
914963272 1:152226120-152226142 GTACAAAATATTATCTCTGCAGG + Intergenic
915920221 1:159970802-159970824 TAGCAAATTATTAAAACTGAGGG - Intergenic
917909592 1:179629632-179629654 ATGCAAAATATGAAGACTGAAGG + Intronic
917919673 1:179740867-179740889 TTGCAAGATATTACCAATGAGGG + Intergenic
918530515 1:185515384-185515406 GTGCAAAAGGTTAACAGTGTAGG - Intergenic
918708690 1:187700896-187700918 TTGTAAAACACTAACACTGAAGG + Intergenic
919836307 1:201576023-201576045 TTGCAAGATGTTAACACTGGGGG - Intergenic
920091121 1:203453926-203453948 GGGCAAAGTATTCACACAGATGG - Intergenic
920710004 1:208286220-208286242 GGGCAAAAGATTACCATTGATGG - Intergenic
921522179 1:216169210-216169232 TTGAAAAATTTTAACAGTGATGG + Intronic
922318743 1:224465693-224465715 ATGCAAAATGTCAACATTGAGGG - Intronic
922417681 1:225436400-225436422 GTGCTAAACATTAACACTGATGG - Intergenic
922634011 1:227145859-227145881 GTGCAAAGTACTAATACTAAAGG + Intronic
922689191 1:227673759-227673781 TTGGAAAATATTAACACTCTTGG + Intronic
1063153881 10:3360498-3360520 GTGGAAAATATTAAAACAGTGGG - Intergenic
1063337499 10:5230221-5230243 GGGCCAAATATTAACATTAATGG - Intergenic
1063570329 10:7209711-7209733 ATGCAAAATACTAACACAGTGGG + Intronic
1065193958 10:23243375-23243397 ATGAAAAATTTTATCACTGATGG - Intergenic
1066658206 10:37713727-37713749 TTGCAAGATGTTATCACTGAAGG - Intergenic
1067042695 10:42963395-42963417 TTGCAAGATGTTATCACTGAAGG - Intergenic
1067157399 10:43793561-43793583 GTGAAAATTATTCACCCTGAGGG + Intergenic
1069586970 10:69613204-69613226 GTGCAAAATATCTACCATGATGG - Intergenic
1069677963 10:70262325-70262347 TTGAATAATATTTACACTGAAGG + Intronic
1071252449 10:83834303-83834325 GTGCAAAGTATTGCCAATGAGGG - Intergenic
1071592584 10:86888846-86888868 GTGAAAATTATTGAAACTGAAGG + Intronic
1073934677 10:108616954-108616976 TTGCAACCTATTAAAACTGATGG + Intergenic
1074919389 10:117992084-117992106 CTGCAGAGTATCAACACTGAGGG - Intergenic
1075288871 10:121211091-121211113 TTGCAAAATATGAATATTGATGG - Intergenic
1075876894 10:125815033-125815055 GAGCAAAACAATAAAACTGAAGG - Exonic
1075932306 10:126309812-126309834 TTGCAAAATATTAGAACTGCAGG + Intronic
1076548593 10:131262583-131262605 ATGCCAAATATTCACAATGAGGG - Intronic
1076561999 10:131373068-131373090 GAGCAGAATGTTAGCACTGAGGG - Intergenic
1078117630 11:8469540-8469562 GGTCAGAATATCAACACTGATGG - Intronic
1078126855 11:8574290-8574312 ATGCAAGATATTAATATTGAGGG + Intronic
1078779638 11:14424826-14424848 GTACAAAATTTTAAGAATGAGGG + Intergenic
1078812934 11:14788602-14788624 GGGCAAAATATTAATGCTAAAGG + Intronic
1079937089 11:26630635-26630657 GTCCAAAAACTTAACAATGAGGG - Intronic
1080179197 11:29402725-29402747 GTGCAATATTTTAACTCAGACGG + Intergenic
1080409853 11:32013303-32013325 TATCAAAATATTAACACTGGAGG + Intronic
1081233272 11:40613585-40613607 GGCCAAAATATTAACATTAACGG - Intronic
1082737185 11:56869509-56869531 TTGCTAAATCTTAACACTGATGG + Intergenic
1083188122 11:61029728-61029750 GGAGAAAATATTAACACTAAGGG + Intergenic
1085327407 11:75617629-75617651 GTGCAAAATAAGAAAACTTACGG + Intronic
1086031609 11:82365334-82365356 GTGTGAAATAACAACACTGAGGG + Intergenic
1086207202 11:84273661-84273683 GTGAAAAGTAGTAACATTGAAGG + Intronic
1089437975 11:118487516-118487538 GAGAAACATATTAACACTTAGGG - Intronic
1090167495 11:124565753-124565775 TTGCAAGATGTTACCACTGAAGG + Intergenic
1093406558 12:18811874-18811896 ATGGAAAATATATACACTGAGGG - Intergenic
1093618635 12:21259845-21259867 GTTCAACATATGAAAACTGATGG - Intergenic
1095838240 12:46662374-46662396 GGGCAAAATAGTAATACTGATGG + Intergenic
1096429282 12:51530018-51530040 GTGCAAAATATTACCAACCAGGG - Intergenic
1099746953 12:86717708-86717730 GTGCAAGAAATAAACACTCAAGG + Intronic
1099776566 12:87139307-87139329 TTGCAAAATATTACCAGTGGGGG - Intergenic
1099978655 12:89572709-89572731 GTGCAAAAAATTTAAACTGTAGG + Intergenic
1101080619 12:101179769-101179791 CTGCAAGATGTTACCACTGAGGG + Intronic
1101149317 12:101870004-101870026 GGTCAAAATATTAACATTAATGG + Intergenic
1101212197 12:102545676-102545698 TTTTAAAATATTAACACTGTAGG - Intergenic
1102447117 12:113011748-113011770 CTGCAAATTATCAAAACTGAAGG + Intergenic
1102762498 12:115400484-115400506 ATGTAAGATATTAACACTGAGGG - Intergenic
1105443136 13:20431742-20431764 TTGAAAAATTATAACACTGAGGG + Intronic
1105551642 13:21402219-21402241 AGTCAAAATATTAACACTGATGG + Intronic
1107146332 13:37064414-37064436 GAGCAAAATATTTAAAATGAAGG - Intergenic
1107894005 13:44940624-44940646 GTTTAAAATATTAATACAGATGG - Exonic
1107951911 13:45470616-45470638 GTGCAAAATGTTACCATTGAGGG - Intronic
1108329422 13:49370402-49370424 GTGAAAAATACGACCACTGATGG + Intronic
1110099810 13:71583986-71584008 GTGCAATATTTTAACATTGGAGG - Intronic
1110518769 13:76448965-76448987 GTGGAAAATATTAACTTTGTGGG - Intergenic
1111566391 13:90022605-90022627 GTGCATAATATAAAAACTGGTGG + Intergenic
1113016259 13:105831840-105831862 ATGCAAAATATTAACATTCTTGG + Intergenic
1113021440 13:105891921-105891943 GTCCATAATATTGAGACTGAGGG + Intergenic
1116251172 14:42484128-42484150 TTGCAAAATGTTAATACTGGAGG + Intergenic
1117291289 14:54336192-54336214 TTGCAAAATGCTACCACTGAGGG + Intergenic
1123181020 14:106470252-106470274 GTGCAAAAGATACACAGTGAGGG - Intergenic
1124715911 15:32061397-32061419 GTGCAAAAGGTTAATTCTGATGG - Intronic
1125264069 15:37859427-37859449 ATCCAAAATATTATCACTGGTGG + Intergenic
1125822558 15:42645115-42645137 GCTCAAAATATCAACATTGAGGG - Intronic
1125871584 15:43106779-43106801 GGGCAAAGTAGTAACTCTGAGGG + Intronic
1126732570 15:51699195-51699217 CTCCAAAATATTAACACTCCTGG - Intronic
1130760952 15:86819143-86819165 GGGCAAAAATCTAACACTGAAGG + Intronic
1131171656 15:90183488-90183510 TTAAAAAATATTAACGCTGACGG + Intronic
1131568946 15:93513106-93513128 ATCCAAAATATGAACACTCATGG + Intergenic
1132817629 16:1840486-1840508 TTGCAAAATGGTAACACTGGGGG + Intronic
1133208966 16:4252285-4252307 ATGCAAGATGTTAACACTGAGGG + Intergenic
1133526669 16:6612248-6612270 ATGCAAAATTTTAACATTTAGGG - Intronic
1133855649 16:9546905-9546927 GGGCAAAGTATGAGCACTGAAGG + Intergenic
1136609640 16:31358340-31358362 GTTTAAAATATTAACAATCAAGG + Intronic
1138403090 16:56764767-56764789 TGGCAAAATATTAATATTGAAGG + Intronic
1142739567 17:1923272-1923294 ACGCAAAATATTACCATTGAGGG + Intergenic
1143228366 17:5328248-5328270 TAGCAAAATATTAAAAATGATGG + Intronic
1144403117 17:14925880-14925902 GTGGAAAATATTAGCTCAGAAGG + Intergenic
1145721058 17:27073157-27073179 TTGCAAAATATTATCACTTCTGG + Intergenic
1147033790 17:37664193-37664215 GTGAAAAATATAAAGACTGATGG - Intergenic
1147476928 17:40720850-40720872 GTGTAAAATATCTACACTGAAGG - Intergenic
1147653856 17:42077590-42077612 GTTCATAATAATAACACTAAGGG + Intergenic
1148947930 17:51281704-51281726 ATGCAAAATGTTAACATTGGGGG + Intronic
1149250113 17:54758704-54758726 GTGCTAGACATTAACAATGAGGG - Intergenic
1150669318 17:67176888-67176910 CTTAAAAATATTAGCACTGATGG - Intronic
1157021685 18:43790628-43790650 TTAAAAAATAGTAACACTGATGG + Intergenic
1157759451 18:50249832-50249854 TTGCAAGATATTACCATTGAGGG + Intronic
1159527508 18:69612050-69612072 TTGCAAAATGTTACCACTGGGGG + Intronic
1160336385 18:78043962-78043984 ATGCATAATATATACACTGAGGG - Intergenic
1160454589 18:78992009-78992031 GTGCAAAATTTTGAGACGGAGGG + Intronic
1161024144 19:2027604-2027626 TTGCAAAATGTTACCACTGGGGG + Intronic
1162064561 19:8117231-8117253 GTGCACTGTATTAACACTGAGGG - Exonic
1162257915 19:9507653-9507675 TTGAAAAATATCAACTCTGAGGG - Intergenic
1164943852 19:32273499-32273521 ATTTAAAATATAAACACTGATGG - Intergenic
1165204758 19:34173570-34173592 ATGCCAAATATTAACACTGTGGG - Intronic
1167235906 19:48314968-48314990 GTCCAAAATGTTGACACTGGGGG + Intronic
1168556723 19:57349183-57349205 GTATAAAATATTAATACTGTTGG - Intergenic
925590512 2:5504804-5504826 GTGAAAACTGTTAACACTGCAGG + Intergenic
925935414 2:8753433-8753455 GTGGAAAATTTTAGAACTGATGG + Intronic
929448494 2:42019716-42019738 ATCCAAGATATTACCACTGAGGG + Intergenic
929837759 2:45423100-45423122 GTGCAAAACAATAAAAATGACGG + Intronic
932161815 2:69467107-69467129 GCCCAAAATATAAATACTGAAGG + Intronic
932811304 2:74828560-74828582 GTAGAAAATTTTAAGACTGAGGG - Intergenic
935369590 2:102331457-102331479 GTGCAAACTGTTAAGACTGCTGG + Intronic
935508851 2:103945584-103945606 GTGTATAATTTTAACTCTGATGG + Intergenic
936697369 2:114966352-114966374 GTGCAAAAAAGTAACCCTGCAGG - Intronic
936781031 2:116032876-116032898 GTGCAAGATATATACAGTGAGGG - Intergenic
938809122 2:134835548-134835570 ATGTAAAATTTTAACAATGAAGG - Intergenic
939139160 2:138332861-138332883 TGGCAAAATATTAACAGTCAAGG + Intergenic
939195732 2:138968368-138968390 AACCAAAATATTAACAGTGATGG - Intergenic
939933838 2:148264142-148264164 ATGCAAAATGTTAACATTGTTGG + Intronic
940077271 2:149756558-149756580 GTGCAAAATATAACCATTGGAGG - Intergenic
941459735 2:165754997-165755019 ATGTAAAATTTTTACACTGAAGG + Exonic
942809529 2:179981316-179981338 GTGTAAAATATTTACAGTGTGGG + Intronic
943572430 2:189589418-189589440 GTGAACAATATTTACACTCAGGG - Intergenic
943939633 2:193975657-193975679 CTGCAAAAGATTCTCACTGAAGG - Intergenic
946122340 2:217527180-217527202 GTGCAAAATATCAGCTATGAAGG - Intronic
947202363 2:227625883-227625905 GTGGAAAAAATTAACACACATGG - Intronic
948226468 2:236314131-236314153 GTGCAAAATGTTACCATTGGGGG + Intergenic
1168798893 20:631411-631433 ATGCAAAATGTTAACATTTAAGG - Intergenic
1170499973 20:16965072-16965094 TTGCAAAATATAAACACTTCTGG - Intergenic
1170684376 20:18555757-18555779 TTGCAAGATGTTAACACTAAGGG - Intronic
1171960442 20:31489887-31489909 GTGAAAAATAATAAAGCTGAAGG - Intergenic
1174341149 20:49896343-49896365 GTGCAAGATGTTACCACTGAGGG - Intergenic
1175620243 20:60438733-60438755 TTGCAAAATGTTACCAATGAAGG - Intergenic
1176358472 21:5972834-5972856 GTGCAAAATTTTAATAATGTTGG + Intergenic
1179765046 21:43565716-43565738 GTGCAAAATTTTAATAATGTTGG - Intronic
1182151863 22:28033224-28033246 CTTCAAAGTATTAACACCGAAGG + Intronic
1182307824 22:29383380-29383402 ATGCCAAAAATGAACACTGAAGG + Intronic
950933042 3:16810310-16810332 GTGCAAAATATTAAATATTATGG + Intronic
951630560 3:24715596-24715618 ATGCAAGATGTTAACACTGGGGG - Intergenic
954343167 3:49972283-49972305 GTGCAAAATATTAACACTGAGGG - Intronic
955459820 3:59169842-59169864 GGTCAAAATATTAACATTAACGG + Intergenic
956319008 3:67974462-67974484 TTGCAAAATTGTACCACTGAAGG + Intergenic
956936534 3:74107998-74108020 TTGCAAAACATTACCACTGGAGG + Intergenic
958438188 3:94123536-94123558 GTTCAAAAATTTAACAATGATGG + Intronic
958606789 3:96368277-96368299 TTGCAAAATGTTATCACTGGGGG - Intergenic
959410929 3:106020243-106020265 GTCCAAATTATTAACTGTGAAGG + Intergenic
959423550 3:106157095-106157117 ATGCAAGATCTTAACACTGAGGG - Intergenic
959563469 3:107809599-107809621 GTGGAAAATAGTGGCACTGAAGG - Intronic
960013501 3:112859148-112859170 TTGCAAAATGTTAGCACTGGAGG + Intergenic
960284000 3:115807423-115807445 GTCCATTATATTAAAACTGAGGG + Exonic
960851726 3:122061976-122061998 GTGCAAGATGTTACCACTGAAGG + Intronic
960888653 3:122422258-122422280 GTGGAAAGTATTGACACGGAAGG - Exonic
960999481 3:123364090-123364112 TTTCAAAATGTTAACAGTGATGG + Intronic
961095089 3:124147613-124147635 GTGCAAGATGTTAACAGTGGGGG - Intronic
961148464 3:124615553-124615575 GGGCAAAATGTTAACATTGGAGG + Intronic
961497180 3:127302553-127302575 GTGCAAGATATTAACAATAGAGG - Intergenic
965840116 3:172895141-172895163 TTGCAAGATATTACCATTGACGG - Intronic
967703922 3:192627748-192627770 TTGCAAAATATTACCATTGGGGG - Intronic
967793074 3:193569873-193569895 ATGTAAGATATTAACAATGAGGG + Intronic
969252648 4:5979694-5979716 TTGCAAAATATTCCCACTGGGGG - Intronic
970481041 4:16475010-16475032 TTGCAAAATATTACCACTGGGGG + Intergenic
970814613 4:20139239-20139261 GTGCAAACTATTCACGTTGAGGG - Intergenic
971896689 4:32605615-32605637 GTGCAAAGTATACACATTGACGG - Intergenic
974392554 4:61290912-61290934 ATGCAAAATATTAAAAATGAAGG + Intronic
974435460 4:61852074-61852096 GTGGAAAATAGCAAAACTGAGGG + Intronic
976027559 4:80708599-80708621 GTTAAAAATATTAACACGAAAGG - Intronic
976904700 4:90222858-90222880 TTGCAAGATATTAGCACTGGGGG - Intronic
977351101 4:95888878-95888900 GTAGAAGATATTAACAGTGAAGG + Intergenic
977772580 4:100877285-100877307 GTGCATAATATTTTCCCTGATGG - Intronic
978530706 4:109709661-109709683 GTGGAACTTATTAAAACTGAAGG + Intergenic
979491704 4:121335681-121335703 CTGAAAACTATTCACACTGAGGG + Intronic
979759745 4:124387922-124387944 GTTCAAAAAATTACCACTGTAGG + Intergenic
980097155 4:128503228-128503250 ATGTAAAATGTTAACACTGGGGG - Intergenic
981000003 4:139819800-139819822 GTGTAAAATATCAACACTCATGG - Intronic
981125028 4:141095799-141095821 GAGAAAAATATAATCACTGAGGG + Intronic
981359071 4:143826748-143826770 GTTCAAAAGATTAACACAGAGGG + Intergenic
981369854 4:143947646-143947668 GTTCAAAAGATTAACACAGAGGG + Intergenic
981379595 4:144057608-144057630 GATCAAAAGATTAACACAGAGGG + Intergenic
981492799 4:145358407-145358429 GTGCAAAATAACCTCACTGAAGG + Intergenic
981934662 4:150226618-150226640 ATGCAAAAAATTTACACTAAGGG + Intronic
982160237 4:152561690-152561712 ATGCAAGATATTAATAATGAGGG + Intergenic
982664854 4:158249557-158249579 TAGCAAAATCTTAACATTGAAGG + Intronic
983618590 4:169735474-169735496 TAGCAAAACATTAAGACTGAAGG - Intronic
984330505 4:178309468-178309490 ATGCAAAAAATTAACAGTTAAGG + Intergenic
1202770666 4_GL000008v2_random:203528-203550 GTGGAAAATATTAATAATGGGGG + Intergenic
985790669 5:1925451-1925473 GTGCAACTTAGTCACACTGACGG + Intergenic
985874321 5:2583897-2583919 CTGCAATATTTTAACACTTAGGG - Intergenic
987518037 5:18940336-18940358 GTGAAAAATATTGATAATGAAGG + Intergenic
987581419 5:19798289-19798311 GTGAAAAATATTGCCAATGAGGG + Intronic
987627853 5:20425527-20425549 GTGGAGAATATTATAACTGAAGG + Intronic
988371764 5:30379272-30379294 GTGCTTAATAATAACTCTGAAGG - Intergenic
989372658 5:40725431-40725453 ATGCAAAATATTAAAACCAATGG + Intronic
991361995 5:65830495-65830517 ATGGAAATTATTAACACTGATGG - Intronic
991636065 5:68707203-68707225 GTGCAGCATCTTAACACTGAGGG - Intergenic
991947874 5:71917088-71917110 ATTCAAAATATTGATACTGAAGG + Intergenic
992844884 5:80736473-80736495 GTGCAAAAAATTAACATAGCAGG + Intronic
995097077 5:108249376-108249398 GAACAAAATATTAAAAGTGAAGG + Intronic
997316652 5:132942221-132942243 CAGCAAATTATTAAAACTGAAGG - Intronic
998050475 5:139028628-139028650 ATGTAAAATGTTAACATTGAGGG - Intronic
998292803 5:140931596-140931618 AAGCAAAATATCAACAATGATGG - Intronic
1000378191 5:160603657-160603679 GTGCCAAATGTTTACACTGGTGG + Intronic
1001635645 5:173208282-173208304 GTGCAAAAGAGAAAAACTGATGG - Intergenic
1001730332 5:173949352-173949374 GTGCAAATTATTAACAGTTGGGG + Intronic
1001774504 5:174318678-174318700 CTGAAAAATATTAACTCTGTTGG + Intergenic
1002018190 5:176342771-176342793 GTGATAAACAGTAACACTGAGGG - Intronic
1003661540 6:8066787-8066809 TTGCAAAATGTTACCACTGGGGG - Intronic
1005380808 6:25232340-25232362 ATGTAAGATATTAACAATGAGGG + Intergenic
1005570519 6:27140934-27140956 GTGCAAAATTTTAATAATGTTGG + Intergenic
1006588804 6:35139306-35139328 CGGCAGAATATTAACACTGTGGG + Intronic
1008653615 6:53588731-53588753 GTGCAAAAGAATAACACTCCAGG + Intronic
1009622256 6:66092852-66092874 GTTTAAAATATTAATACAGATGG - Intergenic
1010259890 6:73803709-73803731 GTGTAAAAAACAAACACTGATGG + Intronic
1010941639 6:81926014-81926036 CTGCAAAATATTAACATCGTGGG + Intergenic
1011175425 6:84554355-84554377 ATGCAAAATATTAAGACAAAAGG + Intergenic
1011855667 6:91687326-91687348 GTGCAAAACATTATCACAAATGG + Intergenic
1012804052 6:103872716-103872738 GTGCAAATTTTTTACAATGATGG - Intergenic
1012885347 6:104840096-104840118 TTGCAAAATGTTACCACTGGAGG + Intronic
1014578402 6:123103638-123103660 ATAGAAAATATTCACACTGAAGG - Intergenic
1015077742 6:129181901-129181923 GAGAAAAATATTAAAACTGGGGG + Intronic
1016222323 6:141690119-141690141 ATGCCAAATATTAACACTTTTGG + Intergenic
1016377883 6:143442594-143442616 ATGCAAGATGTTACCACTGAAGG + Intronic
1016454576 6:144216946-144216968 GTGCACAAAATTAACATTGGCGG - Intergenic
1017568880 6:155720378-155720400 GTGATAAATATTTACAGTGATGG + Intergenic
1018303717 6:162431038-162431060 GACCAACATAATAACACTGAAGG - Intronic
1018657551 6:166054040-166054062 GTGCAAAATATAAGAAATGATGG - Intergenic
1021390169 7:20083165-20083187 TTGATAAATATTAACATTGATGG - Intergenic
1021645639 7:22786879-22786901 CTGCAAGATCTTCACACTGATGG - Intergenic
1022767638 7:33431837-33431859 GTGCAAAGTATGAACATTCATGG - Intronic
1022859518 7:34352794-34352816 ATGCAAAATATTGTCATTGAGGG + Intergenic
1022865525 7:34414955-34414977 GTGCAAAAAATTAACTCAAATGG - Intergenic
1024268294 7:47622979-47623001 CTGCCAAATATTAACATGGAAGG + Intergenic
1028022023 7:85789098-85789120 GTTTAAATTGTTAACACTGAAGG + Intergenic
1037062755 8:14535874-14535896 ATGTAAAATATTAACATTCAGGG + Intronic
1038799854 8:30739672-30739694 ATGCACAATTTTAACACTGGGGG + Intronic
1038940737 8:32301890-32301912 TTGCAAAATATCAAAACAGAGGG + Intronic
1039834146 8:41243082-41243104 ATGCAAGATATTAACATTAAGGG - Intergenic
1041692899 8:60706702-60706724 TAGCAAAATATTTCCACTGAGGG - Intronic
1042400848 8:68344522-68344544 TTGCAAAATATTACCAATGGAGG + Intronic
1042652259 8:71056202-71056224 GTTATAAATATTAACAATGAAGG + Intergenic
1042897056 8:73682011-73682033 GGGCAAAATAATAATAGTGAGGG + Intronic
1044037886 8:87328239-87328261 GTGCCAAAAATAAACAATGAAGG - Intronic
1046230352 8:111347752-111347774 GTGCAAGATGTTAACATTGGGGG - Intergenic
1047025626 8:120820641-120820663 GTGCAAAATATTTATACTCATGG - Intergenic
1047118561 8:121873548-121873570 GTGCAAAAAATAAGCACTAAAGG - Intergenic
1047240150 8:123079948-123079970 GGACAAAATAGTAACACTTATGG - Intronic
1047291002 8:123530593-123530615 GAGCAAAATATTAATGATGAAGG - Intronic
1047742290 8:127816213-127816235 ATCCAAACTATGAACACTGATGG + Intergenic
1050154079 9:2647342-2647364 GTGACAAATAGTAACACTTAAGG - Intronic
1050275178 9:3989963-3989985 TTGCAAAATACTAACATTGGGGG + Intronic
1050912863 9:11095978-11096000 GTGAAAAATATGCATACTGAGGG - Intergenic
1050913558 9:11103686-11103708 GTGGAAAACCTCAACACTGAAGG + Intergenic
1052727202 9:32243295-32243317 GTGCAAAATGTTAACATTGGGGG + Intergenic
1053247658 9:36548103-36548125 ATGGAAGATATTAACATTGAGGG - Intergenic
1053478840 9:38401309-38401331 GTGCAGAAGAATAATACTGAGGG - Intergenic
1054750629 9:68902009-68902031 GTGCAAGATATTACCACTGGGGG - Intronic
1058162955 9:101590179-101590201 ATGAAAAATTCTAACACTGAAGG - Intronic
1058844014 9:108937686-108937708 GTCCAAAATAGTAACACTTAAGG + Intronic
1059604128 9:115814729-115814751 TTGCAAGATATTATCATTGAGGG + Intergenic
1060065695 9:120498620-120498642 ATGCAAAATGTTAACACTAGGGG + Intronic
1203703982 Un_KI270742v1:20224-20246 GTGGAAAATATTAATAATGGGGG - Intergenic
1185565263 X:1090468-1090490 CTGCAAGATGTTACCACTGAGGG + Intergenic
1186852915 X:13597948-13597970 CAGCAAAATATTAACGTTGAGGG + Intronic
1187704829 X:21999391-21999413 TTATAAAATATAAACACTGAAGG - Intergenic
1188442089 X:30222845-30222867 GTGAAAAATATTAACAAAGTGGG + Intergenic
1189722843 X:43938217-43938239 CTGCAAAATATTAACAATTGAGG + Intergenic
1189776521 X:44474803-44474825 TAGCAAATTATTAAAACTGAGGG + Intergenic
1189866042 X:45328243-45328265 ATGCAAGATGTTACCACTGAGGG - Intergenic
1190967417 X:55313789-55313811 TTGCAAGATATTACCATTGAGGG - Intergenic
1192980604 X:76335830-76335852 GTGCAAAATAGCAACTCTTAAGG - Intergenic
1197159442 X:123307266-123307288 GTGCAAAATTTTATAGCTGATGG - Intronic
1197305427 X:124835604-124835626 ATGGGAAATATTAACACTTAGGG - Intronic
1197555069 X:127943110-127943132 ATGCAAAATGTTACCATTGAAGG + Intergenic
1199680360 X:150220190-150220212 TTGCAAAACATTACCACTGGCGG + Intergenic