ID: 954345971

View in Genome Browser
Species Human (GRCh38)
Location 3:49999634-49999656
Sequence TATTCCAACCATCGGTTGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 46
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 38}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954345971 Original CRISPR TATTCCAACCATCGGTTGTG AGG Intronic
912254026 1:108040825-108040847 TATCACAACCACCAGTTGTGAGG - Intergenic
916619463 1:166480364-166480386 AATTCTAACCATGGGTTGTCTGG + Intergenic
917497645 1:175555854-175555876 CCTTCCAACCATGAGTTGTGTGG + Intronic
917868395 1:179219997-179220019 TATTTCAACAACCTGTTGTGAGG + Intronic
919595146 1:199552353-199552375 TATTCCAATGATCAGGTGTGAGG + Intergenic
1064494726 10:15897054-15897076 TATTTTAACCATAGGGTGTGGGG - Intergenic
1065630159 10:27671635-27671657 TACTCCAACGATCTGTTGTGGGG - Intergenic
1080559045 11:33445217-33445239 TATCCCAAACCTCTGTTGTGGGG + Intergenic
1093869681 12:24273620-24273642 TTTTCCAACAATCGGTTTTTTGG + Intergenic
1100125518 12:91420052-91420074 TGTTCCAACCTTCCATTGTGTGG - Intergenic
1108903022 13:55436079-55436101 TATTCACACCATCAGCTGTGGGG - Intergenic
1111296164 13:86280376-86280398 TATTTTAACCATTGGTTGTGGGG + Intergenic
1120440399 14:84529801-84529823 TATCCCACTCATTGGTTGTGGGG + Intergenic
1128983205 15:72200929-72200951 TCTGCCAACCATGGGCTGTGTGG - Intronic
1145981918 17:29017905-29017927 TACTCAAACCACAGGTTGTGCGG + Intronic
1147615979 17:41828107-41828129 AATTCCAACCATCAGTTTTATGG + Intronic
1155202778 18:23532082-23532104 GGTGCCAACCATCGGTTGTTTGG - Exonic
1156522328 18:37732222-37732244 TATTCCAACATTCGGGTGGGTGG - Intergenic
1158477008 18:57789283-57789305 TTTTCCAACCTTCGGCTGTGAGG + Intronic
1159367103 18:67482574-67482596 TTCTCAAACCATCTGTTGTGAGG - Intergenic
1163662236 19:18585410-18585432 TATCCCAATCATAGGTTCTGTGG + Intronic
1164898309 19:31896732-31896754 TTTTCCAACCATCTGTTGTTTGG + Intergenic
1165771153 19:38381075-38381097 CATTCCAGCCATTGGTTGTCTGG + Intronic
926961932 2:18366656-18366678 TATGCTAACCATGGGTTGAGAGG + Intergenic
940063090 2:149594691-149594713 TATTCTAGCCATCTGTTGTTAGG + Intergenic
1169627142 20:7583705-7583727 TATTCCAGCCTTCAGCTGTGTGG + Intergenic
1170978647 20:21190093-21190115 TGTTCCAGCCATCGGGTGTCAGG + Intronic
1173616769 20:44408275-44408297 TCTTCCAAGGATCAGTTGTGGGG - Intronic
1179070130 21:38063785-38063807 TATTTCAACTATCCGATGTGGGG - Intronic
1184673956 22:46030281-46030303 TTTTCCAACCATCAAATGTGAGG - Intergenic
949439720 3:4067309-4067331 TATTCTAGCCATTGGTTTTGAGG + Intronic
954345971 3:49999634-49999656 TATTCCAACCATCGGTTGTGAGG + Intronic
964402280 3:156311755-156311777 TATTCCAAACCTCTGGTGTGGGG + Intronic
970751754 4:19372090-19372112 TATTTCTATCATCAGTTGTGTGG - Intergenic
985014331 4:185617882-185617904 TATTCCAAGCATAGTTTGTGGGG - Intronic
989047785 5:37289563-37289585 TATTGCAAGCATCTGTTGTGGGG + Exonic
990467592 5:56084468-56084490 GATTCCAACCACTGCTTGTGGGG + Intergenic
1002148385 5:177205410-177205432 TATTTCAACCATCAGTATTGTGG + Intronic
1007769598 6:44182469-44182491 AATTCCAAGCATGGGTTGTCGGG - Intronic
1016002859 6:139059961-139059983 TATTGCAAGCATCTGTTGTGGGG + Intergenic
1016302340 6:142646343-142646365 TATTCCAAGCATCAGTTGCAAGG - Intergenic
1018810750 6:167296193-167296215 TATTCCAGTCATCCGGTGTGTGG + Exonic
1018905598 6:168073656-168073678 TCTTCCAACCATCGTGAGTGTGG - Intronic
1035635612 8:1141446-1141468 TCTTCTAACCATCAGCTGTGTGG - Intergenic
1035878191 8:3214385-3214407 TATTCCTCTCATCGGTGGTGAGG - Intronic
1189134137 X:38531856-38531878 TATTCCCACCATATTTTGTGAGG + Intronic