ID: 954353507

View in Genome Browser
Species Human (GRCh38)
Location 3:50065321-50065343
Sequence GAGAACCAGAGGCAGTTATC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 141}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954353507 Original CRISPR GAGAACCAGAGGCAGTTATC TGG Intronic
904198192 1:28801764-28801786 CTGAACCAGAGGCAGTCACCAGG - Intergenic
907387971 1:54138114-54138136 GAGAAGGAGAGGAAGTTAGCGGG - Intronic
908980985 1:69958676-69958698 GAGAGCCAGAGGTAGTTAATGGG + Intronic
909460661 1:75909387-75909409 GAGAACCAAAAGCAAATATCTGG - Intronic
909561630 1:77014742-77014764 AAGTACCAGAGGCTTTTATCAGG - Intronic
909833859 1:80229432-80229454 GTGAACAAGAGTCAGTTAGCAGG - Intergenic
911380548 1:97108278-97108300 GAGACACAGAGGGAGTCATCAGG - Intronic
916365775 1:164025989-164026011 GAGATCCATAGGCAGACATCTGG + Intergenic
918471914 1:184884075-184884097 CAGAACATGGGGCAGTTATCTGG - Intronic
919320107 1:196025620-196025642 GAGAACCATATGAAGTTATCTGG - Intergenic
922972645 1:229755880-229755902 CAGAAACAGAGCCAGTTATAAGG + Intergenic
1062936472 10:1394386-1394408 GAGAAGCTGAGGCACTTAACAGG - Intronic
1064419263 10:15176592-15176614 TAGAACAAGCGGCAGTTCTCTGG + Intergenic
1071784596 10:88884550-88884572 GAAAACCTTAGGCAGATATCAGG + Intronic
1072755829 10:98020118-98020140 GAGAGACAGAAGCAGTTAGCAGG - Intronic
1073106896 10:101037244-101037266 GAGAAGCAGGTGCAGTTCTCAGG + Intronic
1079633026 11:22700957-22700979 GAGCAAAAGAGGCAGTTATTGGG - Intronic
1084956992 11:72696852-72696874 GAGAAGCAGAGGCAGGCAACTGG + Intronic
1086984429 11:93232833-93232855 GAGGACAAGAGGCACTTCTCTGG + Intergenic
1087751607 11:102013168-102013190 GAGCTGCAGAGGCATTTATCAGG + Intergenic
1088651811 11:111964193-111964215 CAGAACCACAGCCAGTTTTCAGG - Intronic
1090584050 11:128190850-128190872 GAGAACCAGCATCAGCTATCTGG - Intergenic
1091292250 11:134447665-134447687 GAGAAGCAGAAGCAGTCTTCAGG + Intergenic
1098093907 12:66934184-66934206 GAGAAACAGAAGCAGTTCTGTGG - Intergenic
1098306024 12:69103483-69103505 GAGAACCAGATACAGTAATAGGG - Intergenic
1098472261 12:70858862-70858884 TAGAAGTATAGGCAGTTATCAGG - Intronic
1100619538 12:96257950-96257972 AAGTGCCAGAGGCAGTTATCTGG - Intronic
1102837782 12:116082440-116082462 TGGATCCAGAGTCAGTTATCAGG - Intronic
1104089636 12:125504833-125504855 AAGAACCAGAGGCAGTGTTTGGG + Intronic
1104939765 12:132389666-132389688 GAGTACCAGACGCTGTTATCAGG - Intergenic
1106932764 13:34684697-34684719 GGGATCCAGAAGCAGTTATCAGG + Intergenic
1110129486 13:71989615-71989637 TAGAACCAGAGCCAGAAATCTGG + Intergenic
1111839312 13:93429494-93429516 GAAAGACAGAGGCAATTATCAGG - Intronic
1113193591 13:107778832-107778854 GAGAGCCACAGGCTGTTTTCAGG - Intronic
1114255688 14:20999615-20999637 GAGAATCAGAGCAAGGTATCAGG - Intronic
1115509495 14:34125829-34125851 GAGAGCCAGAGGCAGATCTTTGG + Intronic
1116633378 14:47361571-47361593 GAGAAGCAGAGTTAGTTATTTGG - Intronic
1118222601 14:63869191-63869213 GAGTACCAGAGGCAGCGAGCAGG - Intronic
1119628378 14:76203511-76203533 GAGAACCAGAGGCAACTAAGAGG - Exonic
1119982064 14:79092977-79092999 GAGAACCAGAGTATGTCATCTGG + Intronic
1120601341 14:86514034-86514056 AAGCACCTGAGGCAGTCATCAGG - Intergenic
1125481897 15:40086950-40086972 CAGAAGAAGAGGCAGTTATTTGG + Intergenic
1125599337 15:40906890-40906912 GGGGCCCAGAGGGAGTTATCTGG + Intergenic
1126141584 15:45443707-45443729 GAGAAGCAGTGGGATTTATCAGG + Intronic
1126315894 15:47369035-47369057 TGGAACCATAGGTAGTTATCTGG - Intronic
1128683105 15:69665786-69665808 GAGAAGCAGAGACAGTTTGCTGG - Intergenic
1128769287 15:70269756-70269778 GAGAATCAGAGGCTGAGATCTGG - Intergenic
1129950682 15:79588226-79588248 GAGAACAACTGGCAGTTAACAGG - Intergenic
1133890148 16:9871248-9871270 AAGAACCAGAAACAGTTTTCTGG + Intronic
1139421389 16:66851455-66851477 GTGAACCAGATGCAGCTATGGGG - Exonic
1139447829 16:67009122-67009144 GAGAAGCAGAGGCAATTCTAAGG + Exonic
1141480381 16:84302406-84302428 GAGAACCTGAGGCACCTCTCGGG + Intronic
1141979110 16:87538807-87538829 GTGAACCAGAAGCAGCTCTCAGG - Intergenic
1145898623 17:28475304-28475326 GTGAGCCAGAGGCAGGTAGCAGG - Intronic
1147119441 17:38327262-38327284 CAGAAGCAGAGGCAGTTCTGAGG - Exonic
1147813915 17:43194562-43194584 TAGAGCCATAGGCAGTAATCAGG + Intronic
1149866469 17:60153898-60153920 GGGAAGGAGAGGCAGTGATCAGG + Intronic
1156707749 18:39904164-39904186 GAGAAGCAAAGGGAGTTTTCTGG - Intergenic
1161253249 19:3292732-3292754 GAGAAACAGAGACAGTTAGCTGG + Intronic
1163065394 19:14788818-14788840 GAGCACAAAAGGAAGTTATCTGG - Intergenic
1166088803 19:40494859-40494881 GAGAAACAGAGGCAGAGATGGGG - Intronic
1167100849 19:47403505-47403527 GGGAACCAGAGGCAGGTGTGAGG + Exonic
927215062 2:20663765-20663787 GAGGCCCAGAGGCAGATGTCAGG - Intergenic
927647210 2:24885575-24885597 GAGACCCAGAGGCTTTTACCTGG - Intronic
929505023 2:42521723-42521745 AAGATTCAGGGGCAGTTATCTGG - Intronic
930483247 2:51976636-51976658 GAGAACTAGAGTAAGATATCTGG - Intergenic
932221505 2:70003113-70003135 GAGAAAAAGAGGCAGTTGTCTGG - Intergenic
933035617 2:77393695-77393717 TAAAACCAGAGGCAGTTAGGAGG + Intronic
935608419 2:104994830-104994852 GAGAGGCAGAGGAAGTTCTCTGG + Intergenic
935743888 2:106174454-106174476 GAGCACCAGAGGCAGATAGTTGG + Intronic
937693751 2:124784989-124785011 TAGAACCAGAGGCATTGCTCTGG + Intronic
937886979 2:126906582-126906604 GAGAAACAGAGGCAATTCTCAGG + Intergenic
938207020 2:129432425-129432447 GAGGACCAGAGGCTGGGATCAGG - Intergenic
938585501 2:132686409-132686431 GACAACAAGGGGCAGTCATCAGG - Intronic
938981317 2:136529943-136529965 GAGAAACAAGGGCAATTATCTGG - Intergenic
940601907 2:155873806-155873828 GTGAACCATAGGCAGGTACCTGG - Intergenic
941849304 2:170163048-170163070 GAGAAGCAGAGGCAGTCGTGTGG - Intergenic
944196127 2:197054897-197054919 GAGGAAAAGAGGCAGTTATTTGG + Intronic
947769906 2:232662362-232662384 GAGAACCAGGGGCAGTGACCAGG + Intronic
1172484247 20:35288762-35288784 GAGGACCAGGGGCAGTAACCAGG - Intronic
1173257807 20:41407297-41407319 GGGAATCAGAGGCAGGGATCTGG + Intronic
1176365554 21:6030549-6030571 GAGAGCCAGAGGGAGGTTTCAGG - Intergenic
1178200382 21:30396362-30396384 GAGACCCAGAGTAAGTTGTCTGG - Exonic
1178203526 21:30436669-30436691 GAGATCCAGAGTAAGTCATCTGG + Intergenic
1178419417 21:32431506-32431528 GAGATCCATAGTCAGTTAGCTGG - Intronic
1179757964 21:43507996-43508018 GAGAGCCAGAGGGAGGTTTCAGG + Intergenic
1180569824 22:16704304-16704326 GAGACCCAGACGTAGTTTTCTGG + Intergenic
1182472302 22:30556033-30556055 TCGAGCCAGAGGCAGTGATCCGG - Exonic
1183683901 22:39350652-39350674 GAGAAGGAGAGGCAGTTCCCGGG - Intronic
949272098 3:2229945-2229967 GAGAATGTGAGGGAGTTATCAGG + Intronic
953687372 3:45088528-45088550 GAGAGACTGAGGCAGTTAACTGG + Intronic
954353507 3:50065321-50065343 GAGAACCAGAGGCAGTTATCTGG + Intronic
961005430 3:123402204-123402226 CAGAACCACAGTCGGTTATCAGG + Intronic
961405999 3:126679937-126679959 GAGAATCAGAGGCAGATGTGAGG - Intergenic
964384353 3:156131457-156131479 GGGAACCAGAGCCAGATATCTGG - Intronic
965222006 3:165938032-165938054 CAGAACCAGAGGTAGTTCTAAGG - Intergenic
965740098 3:171865285-171865307 GAGAAACAGAGGAAGTAATTAGG + Intronic
966801971 3:183772517-183772539 GAGGACCAGCGGCAGTAACCTGG - Exonic
967986259 3:195097750-195097772 GAGAATCAGAAGCAGTTGTGTGG - Intronic
970167486 4:13254744-13254766 GAGATGCAGAGGCAGGAATCAGG - Intergenic
970318854 4:14855951-14855973 GAGAACCAGGAGCAGTTGTCAGG + Intergenic
972564986 4:40261654-40261676 GAGAACAAAAGGCAGATAACAGG - Intergenic
972916673 4:43889828-43889850 GAGAAACAATGGCAGTTATATGG + Intergenic
975288002 4:72642823-72642845 GAGTATCATAGGCAGTTTTCTGG - Intergenic
975533613 4:75426090-75426112 TAGAACCAGAAGTAGATATCAGG - Intergenic
976254285 4:83084027-83084049 TAGGCCCAGAGGCAGTTAACTGG - Intergenic
979490922 4:121326809-121326831 GAGAACAAAAGGCAGTAGTCAGG + Intergenic
983397474 4:167218547-167218569 GAGAAGCATAGGCAGTTTTTAGG - Intronic
983566944 4:169163393-169163415 GAGAACCTGAGGCAGCACTCAGG + Intronic
984078729 4:175215806-175215828 GAGACGCAGAGGCAGTCAGCAGG + Intergenic
985277993 4:188257423-188257445 GATCAGTAGAGGCAGTTATCAGG + Intergenic
987811435 5:22841141-22841163 GAGAACTAGAAGCAGTAATTTGG + Intronic
990613237 5:57481396-57481418 GAGAACCGGATGTGGTTATCTGG + Exonic
996176541 5:120366327-120366349 GCGGACCACAGGCAGTTAGCAGG - Intergenic
998529061 5:142868475-142868497 GAGGAGCAGTTGCAGTTATCTGG + Intronic
1001449697 5:171815128-171815150 GAGAACCTGAGACAGTTAATGGG - Intergenic
1002930882 6:1634217-1634239 GATCACCAGAGGCAGTAACCTGG + Intronic
1004384573 6:15161577-15161599 GAGAACCAGAGGCCTTGAGCTGG - Intergenic
1005012547 6:21349670-21349692 GAGACTTTGAGGCAGTTATCTGG - Intergenic
1007474918 6:42113058-42113080 GGGAACCAGGGGCAGGTATAGGG + Intronic
1011805375 6:91066672-91066694 GAGAGACAGAGGCATTTCTCTGG + Intergenic
1015369873 6:132438571-132438593 GAGAACCTGGGGCAGTCAGCAGG + Intergenic
1015480874 6:133707498-133707520 GAGAACAAGAGGCATTTACATGG + Intergenic
1017697335 6:157030160-157030182 GAGAAGCAGAGCCACTTAGCAGG - Intronic
1022692723 7:32672921-32672943 AAGAACCAGAGACAGCCATCTGG + Intergenic
1022920397 7:35007445-35007467 AAGAACCAGAGACAGCCATCTGG + Intronic
1023204455 7:37733070-37733092 GAGAACCAAAACCAGATATCAGG + Intronic
1024258903 7:47559565-47559587 GAGAACAAGAGGCAGGGATGGGG + Intronic
1025205859 7:56993047-56993069 GAGATCCTGAGGCTGTTACCCGG + Intergenic
1025666081 7:63583891-63583913 GAGATCCTGAGGCTGTTACCCGG - Intergenic
1027256061 7:76431415-76431437 GATAACCAGACTCAGGTATCTGG - Intronic
1028053680 7:86217307-86217329 GAGAAGCAGCGTCAGGTATCTGG - Intergenic
1032854220 7:135820976-135820998 GAGAAACAGAGGCAGGGGTCAGG - Intergenic
1036198433 8:6744674-6744696 GAGAACCAGAGTCAGCTATATGG - Intronic
1036607730 8:10322505-10322527 GAGAAGCAGAGGCAGATTTGTGG + Intronic
1037513970 8:19611175-19611197 GACTACCAGAGGCAGATTTCAGG + Intronic
1038203224 8:25437035-25437057 GAAAACCAGAAGCAGTTATTTGG + Intronic
1041180741 8:55245490-55245512 GAGAGCCAGAGACAGTTAGCAGG - Intronic
1041932063 8:63297717-63297739 GAGAATCAGAGGGAAATATCAGG + Intergenic
1046838055 8:118825133-118825155 AAGAACTAGAGTGAGTTATCTGG + Intergenic
1048422677 8:134292807-134292829 GAGAACCAGAGGCAAGTAAATGG + Intergenic
1051668505 9:19487638-19487660 GAGAAACAGAGTGAGGTATCTGG - Intergenic
1055382642 9:75725651-75725673 GAGAATCAGTGGCAATCATCTGG - Intergenic
1060367621 9:123034345-123034367 GAGAGCCAGCAGCAGTTGTCTGG - Intronic
1060629646 9:125143793-125143815 GAGAACCTGGGGCAGGTGTCTGG - Intergenic
1061851395 9:133418070-133418092 CGGAACCAGAGGCAGGGATCCGG - Intronic
1061980490 9:134100491-134100513 GAGAAACAGAGGCCGTGTTCAGG + Intergenic
1062107821 9:134765464-134765486 GGGAACCAGGGGCAGGTGTCTGG - Intronic
1062633139 9:137476034-137476056 GAGAAACAAAGGCAGTTTCCAGG + Intronic
1187496881 X:19802962-19802984 GAGAGCCAGAGGCAGGTTCCAGG + Intronic
1188406998 X:29824008-29824030 GAGAACCAGTGGCAGGCATAAGG - Intronic
1191617271 X:63182660-63182682 GACAACCAATGGCAGTTATGGGG + Intergenic
1191619027 X:63196263-63196285 GACAACCAATGGCAGTTATGGGG - Intergenic
1195543334 X:106087633-106087655 GAGAACCAGCAGCAATTACCAGG - Intergenic
1196294010 X:113978477-113978499 GAGAATCACATGCAGGTATCTGG + Intergenic