ID: 954354438

View in Genome Browser
Species Human (GRCh38)
Location 3:50073142-50073164
Sequence CAGGGGATAAAGGAGGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1187
Summary {0: 1, 1: 0, 2: 7, 3: 103, 4: 1076}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954354438 Original CRISPR CAGGGGATAAAGGAGGAGGA TGG (reversed) Intronic
900166094 1:1244908-1244930 GAGGGGGAAGAGGAGGAGGAGGG - Intronic
900313098 1:2043859-2043881 CAGGGGAGGAAAGAGGAGGCTGG - Intergenic
900700782 1:4047487-4047509 AAGGGGAGGAAGGAGGAGGAAGG + Intergenic
900753745 1:4418633-4418655 GAGGGAAGGAAGGAGGAGGAGGG - Intergenic
900912945 1:5615023-5615045 CAGGGAATATAGCAGGATGAAGG + Intergenic
900968478 1:5975993-5976015 GAGGGGTTGAGGGAGGAGGAGGG + Intronic
901105124 1:6749445-6749467 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
901214932 1:7550004-7550026 GAGGGAAGGAAGGAGGAGGAGGG + Intronic
901449644 1:9328191-9328213 CAGGGGCTGAGGGAGGAGGCAGG + Intronic
901687799 1:10953761-10953783 GAGGGGACAAGGGAGGCGGATGG - Intronic
901829187 1:11881714-11881736 CAGGGGAATAAGGAGGAGCCAGG + Intergenic
902130519 1:14256448-14256470 CAGAGGGGAAAGGAGTAGGAAGG + Intergenic
902553350 1:17232343-17232365 CAGGGGGTGAAGTGGGAGGATGG - Intronic
902786076 1:18733577-18733599 CAGAGGGAAAAGGTGGAGGAGGG + Intronic
902959753 1:19954845-19954867 CAATGGGTCAAGGAGGAGGAAGG - Intergenic
903025929 1:20430056-20430078 GCGGGGATCAAGGTGGAGGAGGG - Intergenic
903313683 1:22482647-22482669 CAGGGGTTAGAGGAGAGGGAGGG - Intronic
904011091 1:27391159-27391181 CAGGGAACATGGGAGGAGGAGGG - Intergenic
904012554 1:27398189-27398211 CAGGGGAAGAAGGATGGGGAGGG + Intergenic
904314771 1:29653123-29653145 CAGGTGGAAAAGGTGGAGGAGGG - Intergenic
904323386 1:29711136-29711158 GAGGGGAGAAAGGAGGAAGAGGG + Intergenic
904493921 1:30876482-30876504 CAGGGGAGGGATGAGGAGGATGG - Intronic
904757248 1:32774696-32774718 CAGAGGACAAAGGAGAAGGGAGG + Exonic
904948762 1:34218774-34218796 CAAGGGCTAAGGGAGGAGAAGGG - Exonic
905074890 1:35261733-35261755 AAGGAGAAAAAGGAGGAAGAAGG - Intergenic
905409550 1:37758939-37758961 CATGTGATACAGGAGGAGAAAGG - Intronic
905420969 1:37843839-37843861 GAGGGGAGACAGGAGGAGTAGGG - Intronic
905441026 1:37996692-37996714 CAGGGTATAATGGGGAAGGAAGG - Intergenic
905466542 1:38158530-38158552 CTGGGGATAAAGGACACGGATGG + Intergenic
905800868 1:40841641-40841663 TATGGGAGAAAGGAGGAGGGAGG + Intergenic
905835816 1:41119841-41119863 GAGGGAAAAAAGGAGGAGGCAGG - Intronic
905863772 1:41366172-41366194 CGGAGGACAAAGGAGGAGGAGGG - Intronic
906436651 1:45802425-45802447 CAGGGAATAGAGGAGCAGGCTGG + Intronic
906562652 1:46770507-46770529 CAGGGGAAAAGGGTGGAGGGTGG - Intronic
906782675 1:48586460-48586482 CAGGTGAGGAGGGAGGAGGAGGG + Intronic
907403241 1:54238549-54238571 CAGGGGACACAGGAGGAAGTGGG + Intronic
907425409 1:54376127-54376149 CAGAGACTAAGGGAGGAGGAGGG - Intronic
907909252 1:58812875-58812897 CAGGGAAAAGAGGAGGATGATGG - Intergenic
908382122 1:63606544-63606566 CAGGGGAGAAAGATGGAGGAAGG + Intronic
908878420 1:68703497-68703519 GAGGGGATCAAAGAGGTGGAAGG - Intergenic
909480583 1:76125468-76125490 GAGGGGAGAGAGGTGGAGGAGGG - Intronic
909507750 1:76413130-76413152 CAGAGGAAATAGGAGAAGGAAGG - Intronic
909561834 1:77016181-77016203 GAGGAGATACAGGAGGAGGAGGG - Intronic
909561842 1:77016205-77016227 GAGGAGATACAGGAGGAGGAGGG - Intronic
909561850 1:77016229-77016251 GAGGAGATACAGGAGGAGGAGGG - Intronic
909561858 1:77016253-77016275 GAGGAGATACAGGAGGAGGAGGG - Intronic
909561866 1:77016277-77016299 GAGGAGATACAGGAGGATGAGGG - Intronic
909960602 1:81836331-81836353 CAGAGGCTAAATGAGGAGGCTGG + Intronic
909961504 1:81850324-81850346 GAAGGGGTAAAAGAGGAGGAGGG - Intronic
910570331 1:88694278-88694300 CAGGGGATGGAGGAGAGGGAAGG - Intronic
910799771 1:91133422-91133444 CAGGAGAAAAAGGAGGGGAAAGG - Intergenic
910843028 1:91578950-91578972 CTGGGGAGAAAGGAGGCAGAAGG - Intergenic
911054485 1:93698501-93698523 AAGGGGTTAAAGGAGGAGTAGGG - Intronic
911314488 1:96339586-96339608 CAGAGGAAAAGAGAGGAGGAAGG - Intergenic
912065523 1:105736389-105736411 AAGAAGAAAAAGGAGGAGGAGGG + Intergenic
912208023 1:107529697-107529719 CATGGGATATAGGTGCAGGAAGG - Intergenic
912227975 1:107757845-107757867 CAGGGGAAAAAAGAGGACTAGGG - Intronic
912368726 1:109156489-109156511 CAGGGGCTAGAGGAGCAGGATGG - Intronic
912696929 1:111848911-111848933 CAGGGGAAAAGGGAAGAGCAAGG - Intronic
912699187 1:111863846-111863868 CAGGGGAGAAATGATGAGGGGGG + Intronic
912775275 1:112502710-112502732 CAGGGGTTAGGAGAGGAGGAGGG + Intronic
913109712 1:115647002-115647024 CTGGGGCTAGAGAAGGAGGAGGG + Intronic
913181698 1:116328774-116328796 ATGGGGACAAAGGAAGAGGAAGG + Intergenic
913496229 1:119430573-119430595 CAGGGGCTCAAGGTGCAGGAGGG + Intergenic
914681766 1:149943898-149943920 CAGGGAAGAACTGAGGAGGAGGG - Exonic
914758523 1:150580041-150580063 CAGGGGTTGAAGGAAGAGGACGG + Intergenic
914843031 1:151264082-151264104 CAGGGGAGAAATGAGTATGATGG - Intronic
914873176 1:151492438-151492460 GAGGGGATATAGGAGGTGGGAGG - Intergenic
915488147 1:156236245-156236267 CAAGGAATGAAGGAGGCGGAAGG - Intronic
915593888 1:156885603-156885625 CAGGATAGAGAGGAGGAGGAAGG - Intergenic
915625876 1:157113819-157113841 CAGGGAAGACAGGAGCAGGAAGG - Intergenic
915730783 1:158052679-158052701 CAGAGGATAAGGCAGGAGAATGG + Intronic
915732015 1:158060554-158060576 AGGGAGTTAAAGGAGGAGGAAGG - Intronic
916324198 1:163538906-163538928 AAGGGAATAAAGAAGGAGGCTGG + Intergenic
916332159 1:163628692-163628714 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
916820543 1:168393978-168394000 CAGGGGAGAAAAAAGGAGAATGG + Intergenic
916932447 1:169592831-169592853 AAGGGGATTATGGAGGAGGCAGG - Intronic
917253072 1:173083608-173083630 CAGGGTAGAGAGTAGGAGGAGGG + Intergenic
917686969 1:177426288-177426310 TGGGGGATGAAGGAGCAGGATGG - Intergenic
918668873 1:187187580-187187602 GAGGGGGGAAAGCAGGAGGAGGG + Intergenic
919176715 1:194028416-194028438 AGGGGGAGGAAGGAGGAGGAAGG - Intergenic
919721327 1:200839695-200839717 CAGGGAAAAAAGCAGGAGGGAGG + Intronic
919849774 1:201664840-201664862 CAGGGGAAAAGGGAGGAGATGGG - Intronic
919913111 1:202123913-202123935 CAGGGGAGAAGGGCTGAGGAAGG - Intronic
920100767 1:203515720-203515742 CAGGGGAGAAAGGTGGAGGTGGG + Intergenic
920255611 1:204652219-204652241 AAGGGGAGAGAGGAGGGGGAAGG - Intronic
920420150 1:205827696-205827718 CAAGGGAAAGTGGAGGAGGAGGG - Intergenic
920565623 1:206970446-206970468 AAGGGGACACAAGAGGAGGAAGG - Exonic
920671597 1:208007701-208007723 CAGGGGTGGAAGGACGAGGAAGG - Intergenic
921184145 1:212655787-212655809 GAAGGGATACAGGATGAGGAAGG - Intergenic
921334867 1:214075961-214075983 GAGGTGATTAGGGAGGAGGAGGG + Intergenic
921934533 1:220785063-220785085 CAAAGGAAAATGGAGGAGGAGGG - Intergenic
922187975 1:223293206-223293228 TAGGGGTAAGAGGAGGAGGAAGG - Intronic
922722760 1:227906914-227906936 GAGGGAAGAAAGTAGGAGGAGGG - Intergenic
922804901 1:228380395-228380417 GAGGTCGTAAAGGAGGAGGAAGG - Intergenic
922825851 1:228517928-228517950 AAGGGGAAGGAGGAGGAGGAGGG - Intergenic
923072378 1:230577679-230577701 GAGGAGAAGAAGGAGGAGGAAGG - Intergenic
923072397 1:230577757-230577779 GAGGAGAAGAAGGAGGAGGAGGG - Intergenic
923227716 1:231954683-231954705 TAGGGAAGAAAGGAAGAGGAGGG + Intronic
923412754 1:233726023-233726045 GAGGGGACAGAAGAGGAGGAAGG + Intergenic
923481142 1:234385322-234385344 CAGGTGATAAAGCAGCAGCAGGG - Intergenic
923543682 1:234908591-234908613 CAGGGGATAGAGGGGAAGCAAGG + Intergenic
924035370 1:239930719-239930741 AAGGGGATTATGGAGGATGAAGG + Intergenic
924156386 1:241181041-241181063 CAGGGGTTAGAGGAGAGGGATGG + Intronic
924280131 1:242428787-242428809 CAGGAGATAAAGGAACAAGAAGG + Intronic
1062898667 10:1125051-1125073 CAGGGCACAGTGGAGGAGGACGG + Intronic
1063215453 10:3921608-3921630 GAGGGGTTAATGGACGAGGATGG - Intergenic
1063272642 10:4528640-4528662 AAGGAGATTAAGGAGGAGGAAGG + Intergenic
1063548710 10:7007595-7007617 GTAGGGATAAAGAAGGAGGAAGG - Intergenic
1063662436 10:8043705-8043727 CAGGGCAGGAAGGTGGAGGAGGG + Intergenic
1064287325 10:14003186-14003208 CACGGAATAGAGGAGCAGGACGG + Intronic
1064737695 10:18399531-18399553 AAGGGTAGAAGGGAGGAGGAGGG + Intronic
1064766927 10:18684659-18684681 CAGGAAATAAAGGAGATGGATGG - Intergenic
1064947686 10:20809846-20809868 CAGGGGATCAAGGTCGAAGATGG + Exonic
1065167069 10:22990922-22990944 CCGGGGAAAAAGGTGGAGGGAGG - Intronic
1065562974 10:26981875-26981897 CAGGGGCTCAAGGCGCAGGAGGG + Intergenic
1065624235 10:27614402-27614424 TCGGGGGTGAAGGAGGAGGAAGG - Intergenic
1065890766 10:30119241-30119263 CAGGGGAAAAGGCAGGAGGGAGG + Intergenic
1065993175 10:31032126-31032148 TCGGGGTTAGAGGAGGAGGAGGG + Intergenic
1066214399 10:33272497-33272519 GAGGAGAAAGAGGAGGAGGAGGG + Intronic
1066224131 10:33365811-33365833 CAGGGGAGAAGGAAGGGGGATGG - Intergenic
1067015780 10:42755473-42755495 CAGGGGCTTAAGGAGGAGGTTGG - Intergenic
1067061669 10:43081023-43081045 GATGGGAAAAATGAGGAGGAAGG - Intronic
1067145629 10:43691745-43691767 CAGCTGCTGAAGGAGGAGGAGGG + Intergenic
1068203904 10:53822460-53822482 GAGGAGAAATAGGAGGAGGAGGG + Exonic
1068905412 10:62316774-62316796 CAGGAGACAAAGGAGGATGGGGG - Intergenic
1068975634 10:63006195-63006217 CAAGGGCTGAGGGAGGAGGAAGG + Intergenic
1069729760 10:70602946-70602968 CAGGGCACACAGGCGGAGGAGGG + Intergenic
1070343970 10:75523783-75523805 CAGGGAAGAAGGGAGAAGGATGG - Intronic
1070692071 10:78534245-78534267 GAGGAGACAGAGGAGGAGGAGGG - Intergenic
1070729214 10:78813768-78813790 CAGGGGAGAGAGGAAGGGGAAGG - Intergenic
1070752744 10:78973753-78973775 GAGGGGAGAAAGGAGCGGGAGGG + Intergenic
1071038763 10:81280949-81280971 CAGGGGAGACAGTAGGGGGATGG + Intergenic
1071114410 10:82200724-82200746 CAGAGGATAAAGAAAGAGAAAGG - Intronic
1071530522 10:86387819-86387841 TAGGGGAGATAGGAGAAGGAGGG - Intergenic
1071730559 10:88244265-88244287 CTGAGGAACAAGGAGGAGGAGGG - Intergenic
1071855027 10:89615430-89615452 CAGGAGATGAAGCAGGAGGAAGG - Intronic
1071877793 10:89861436-89861458 GAGGGGGAAGAGGAGGAGGAGGG - Intergenic
1071877800 10:89861454-89861476 GAGGAGGAAAAGGAGGAGGAGGG - Intergenic
1071895045 10:90057109-90057131 CAGGGGAAAAGGTGGGAGGAAGG + Intergenic
1072085638 10:92076794-92076816 AAGGAGAAAGAGGAGGAGGAGGG + Intronic
1072436168 10:95416218-95416240 CAGGGAAAAAAGAAAGAGGAGGG + Intronic
1072465047 10:95655977-95655999 CAGGGGATAATGATGGGGGAAGG + Intronic
1072608348 10:97001420-97001442 CAGGAGGAAGAGGAGGAGGAGGG + Intronic
1072889127 10:99306271-99306293 GAGGGTAAAATGGAGGAGGAGGG - Intergenic
1073181192 10:101584574-101584596 CAGGGGCTAGAGTGGGAGGAGGG - Intronic
1073318152 10:102597323-102597345 CTGGGGAAAAGGAAGGAGGAAGG - Intronic
1073338391 10:102727621-102727643 CAGGGGAGGAAGGAAGAGGTAGG - Intronic
1074547266 10:114410615-114410637 GGTGGGATAAAGCAGGAGGAAGG + Intergenic
1074561578 10:114539879-114539901 CAGGGGAAGGGGGAGGAGGAGGG + Intronic
1074781357 10:116804521-116804543 CTGGGGGTAAAGGGAGAGGAAGG - Intergenic
1074889117 10:117720539-117720561 AAGGGGAGAAAGCAGAAGGAAGG + Intergenic
1075076303 10:119352935-119352957 CAGGGGAGAGAGAGGGAGGACGG - Intronic
1075628697 10:123985919-123985941 AAGGGGATTATGGAGGATGAGGG + Intergenic
1075833082 10:125427893-125427915 AGGGGGACAAAAGAGGAGGATGG - Intergenic
1075901915 10:126049973-126049995 CAGGGCAGAAAGGAGGTGGCTGG + Intronic
1076318900 10:129564261-129564283 GAGGGGGAAGAGGAGGAGGAAGG - Intronic
1076588923 10:131570150-131570172 CAGAGATGAAAGGAGGAGGAGGG + Intergenic
1076682114 10:132178345-132178367 AAGGGGGTAGAGGAGGAAGAGGG + Intronic
1076816735 10:132918793-132918815 CAGGGGATGCAGGAGGAGTTGGG - Intronic
1076835080 10:133016929-133016951 CAAGGGATGAAGGGGGACGACGG - Intergenic
1077055915 11:593053-593075 CAGAGGGTGAAGGAGGAGCAGGG - Intronic
1077355867 11:2116704-2116726 CAGGGGGTGAAGTTGGAGGAAGG + Intergenic
1077394173 11:2313069-2313091 CAGGGGGTGAAGAAGGTGGAAGG - Intronic
1077522742 11:3045954-3045976 CAGGGGCTGAAGGGGGAGGTGGG - Intronic
1077644584 11:3912166-3912188 GAGGGGAGAAAGGAGGAGAGGGG - Intronic
1077659906 11:4058554-4058576 CAGTGGATATAAGAGGAGGGGGG - Intronic
1077839399 11:5958784-5958806 GAGGTGATCAGGGAGGAGGAGGG - Intergenic
1078050300 11:7960095-7960117 CTGGAGGTAAAGGAGCAGGAAGG - Exonic
1078155593 11:8797447-8797469 AAGGGGAAGAAGGAGGAAGAAGG - Intronic
1078173047 11:8944419-8944441 AAGGGGTTAGAGAAGGAGGAGGG - Intergenic
1078257901 11:9675719-9675741 CAGGGAATGCAGGAGAAGGAAGG - Intronic
1078267656 11:9766885-9766907 GAGGGGATAAAGGAGGAGAGGGG - Intergenic
1078894811 11:15588671-15588693 CAGGGGACAAGTGAAGAGGAGGG + Intergenic
1078975064 11:16464479-16464501 GAGGGGAGAAAGGAAAAGGAAGG + Intronic
1079378840 11:19918903-19918925 CAGAGCATAAAGCAGAAGGAAGG - Intronic
1079861507 11:25678044-25678066 CTGGGGAGAAAAGAGGAGAATGG + Intergenic
1080268103 11:30422644-30422666 GAGGGGGGAAAGGAGGAGGAGGG + Intronic
1080381569 11:31777266-31777288 CAGGGTCACAAGGAGGAGGATGG - Intronic
1080575706 11:33597371-33597393 GAGGGGAGAAGGGAGGAGGAGGG + Intronic
1081285042 11:41257662-41257684 CAGGGGGCAAAGGAGCTGGAAGG + Intronic
1081462105 11:43281426-43281448 CAAGGGATAGAGCAGGAGGCAGG - Intergenic
1081634367 11:44711163-44711185 CAGGGTAGAGAGGAGGAGGGAGG + Intergenic
1081990373 11:47334133-47334155 CAGGAGCTAAAGGAGGCGCAGGG - Intronic
1082718673 11:56646561-56646583 CAGGGGAGACAGAAGAAGGATGG - Intergenic
1083134371 11:60657920-60657942 CAGGGGATAAAGTAGTTGCAGGG + Intergenic
1084332498 11:68438224-68438246 CGGGGGTCAGAGGAGGAGGAGGG + Intronic
1084468260 11:69339925-69339947 CAGGGCATTAGGGAAGAGGATGG + Intronic
1085010498 11:73137694-73137716 CAGGTGAAAAAGTGGGAGGAAGG + Intronic
1085510697 11:77086704-77086726 CAGGGGATGGAGTGGGAGGAGGG - Intronic
1085520928 11:77138434-77138456 GAGGGGAGAAGGGAGGGGGAGGG + Intronic
1086354469 11:85980234-85980256 CAGAGGATAGAGAAGGAGGATGG + Intronic
1086560580 11:88163940-88163962 CAGTGGATAAAGCAGGGGGAAGG + Intronic
1087124220 11:94607158-94607180 CAGGAGAGAAATGAGGAGAAAGG + Intronic
1087175013 11:95088721-95088743 GTGGGGCTAAAGGAGGAGGCAGG - Intergenic
1087666361 11:101053624-101053646 GAGGGAAGAAAGGAGGAAGAAGG - Intronic
1087781400 11:102304660-102304682 AAGAGGATAAAAGAGGAGGAGGG + Intergenic
1087815875 11:102658147-102658169 TAGGGAAGAAAGGAGGTGGAGGG + Intergenic
1088058292 11:105611207-105611229 AAGGAGAGAAAGGAAGAGGAGGG - Intronic
1089067293 11:115671410-115671432 GAGGGGAAGAAGGAAGAGGATGG - Intergenic
1089120424 11:116130628-116130650 CAGTAGAGAAAGGAGGAGGCAGG - Intergenic
1089220828 11:116870058-116870080 CAGGGGACAAGGAAGAAGGAGGG + Intronic
1089290268 11:117433397-117433419 GAGGGGAGAAGGGAGGAGAAAGG + Intronic
1090056483 11:123429247-123429269 CTGGGGTTGAAGGAGGAGAATGG + Intergenic
1090085676 11:123648844-123648866 AAGGGGATGAAGTAGTAGGAGGG + Intronic
1090294113 11:125571071-125571093 CAGGGGATATGGCAGTAGGAAGG - Intronic
1090502971 11:127279729-127279751 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
1090546391 11:127771928-127771950 GGGGGGATACAAGAGGAGGAGGG + Intergenic
1090612108 11:128480452-128480474 CTGGAGGTAAAGGAGGAGGTAGG + Intronic
1090796496 11:130140174-130140196 ATGGGTATAATGGAGGAGGAGGG - Intronic
1091217052 11:133908521-133908543 CAGTGGAGGCAGGAGGAGGAGGG - Intergenic
1091531222 12:1357843-1357865 CTGGGGATGAAGTTGGAGGAGGG - Intronic
1091603174 12:1930052-1930074 GAGGGGGAGAAGGAGGAGGAGGG + Intergenic
1091665924 12:2418542-2418564 GAGGAGAGAGAGGAGGAGGAGGG + Intronic
1091706172 12:2694946-2694968 AAGGTGGTAAAGGAGGATGATGG + Intronic
1091710585 12:2737439-2737461 CAGGGGAGAAAGGAGAAGTGTGG - Intergenic
1092116755 12:6014378-6014400 CAGGGGACAAAGGTGGAAGCTGG + Intronic
1092140791 12:6182108-6182130 CAGGGGATGGAGGAGGAGTTGGG + Intergenic
1092245083 12:6859593-6859615 CAGGCGGTCAGGGAGGAGGAAGG - Intronic
1092279549 12:7089205-7089227 CAGGGGATCCAGGAGGAAGTTGG + Intronic
1092387912 12:8050410-8050432 CAGGGAAGAGAGAAGGAGGATGG + Intronic
1092443618 12:8532195-8532217 CAGAGGAGAAAGGAGGAAGAAGG + Intergenic
1092882889 12:12901487-12901509 AAGGGGAGTCAGGAGGAGGACGG - Intronic
1092906499 12:13104572-13104594 CAGGGCAGCAAGGAGAAGGAAGG - Intronic
1092931927 12:13324077-13324099 CAGGGTATTTATGAGGAGGAGGG - Intergenic
1092997377 12:13963010-13963032 GAGAGAATAAAGGAAGAGGAAGG - Intronic
1093235958 12:16608612-16608634 TTGGGGAAAAAGGAAGAGGATGG - Intronic
1094155809 12:27335773-27335795 GAGAGGGGAAAGGAGGAGGAAGG + Intronic
1094156086 12:27338221-27338243 AAGTGGATAAAGCAGGAGAAGGG + Intronic
1094189555 12:27683574-27683596 CTGGGGTTAAAGGAGGAGGGAGG + Intronic
1094441924 12:30487064-30487086 CTGGGGATAAGGGAGGAGCAGGG + Intergenic
1095246806 12:39932864-39932886 CAGGGGATAAAGGTGGGGGTGGG + Intronic
1095695481 12:45139013-45139035 CATGAGAGAAAGGAGGAGGAAGG - Intergenic
1096153492 12:49329286-49329308 TAGGGGAGAAAGGAGATGGATGG + Intronic
1096503414 12:52079216-52079238 AAGGGGATGATGGACGAGGAAGG + Intergenic
1096587976 12:52636127-52636149 CAGGGGAAAGAAGAGAAGGAGGG - Intergenic
1096630852 12:52925921-52925943 TAGGGGAGGAAGGAGGAGAAAGG + Intronic
1096633518 12:52944690-52944712 CCAAGGATAAAGGAAGAGGAAGG - Intronic
1096875410 12:54626330-54626352 CAGGATATAAATGAGGAGGTGGG + Intergenic
1096991646 12:55809099-55809121 GAGGGGCTAAAGCTGGAGGATGG + Intronic
1097045377 12:56183931-56183953 CTGGGGATAGAGGAAGAGAAGGG + Intronic
1097167565 12:57093849-57093871 AAGAGGATGAAGGAGCAGGAAGG + Intronic
1097282660 12:57854250-57854272 AAGGGGAGGAAGGAGGAAGAAGG + Intergenic
1097365882 12:58711856-58711878 CAGGGGATAAAAGTAGAGCAGGG - Intronic
1098394420 12:70003088-70003110 CAGAGGAGAGAGGAGGAGGGAGG + Intergenic
1098763222 12:74451361-74451383 AAGAGGATAAAGGAGAAGAAAGG + Intergenic
1098852749 12:75616962-75616984 CAGGGGAATGAGTAGGAGGAGGG + Intergenic
1099064943 12:77964020-77964042 AAGGAGAAAAAGGAGGAGGAGGG - Intronic
1099508855 12:83509141-83509163 AAGGGGATAACGCAGGAAGAAGG + Intergenic
1099904321 12:88754021-88754043 CAGAGGCCACAGGAGGAGGATGG + Intergenic
1100448966 12:94687093-94687115 CTGGGGATAAGGAAGGATGATGG + Intergenic
1100679535 12:96903715-96903737 AAGAGGAGAAAGGAGGAGAAGGG - Intergenic
1101706532 12:107225735-107225757 AGGGGGAGGAAGGAGGAGGAGGG + Intergenic
1101940787 12:109097836-109097858 TAGGGGGTGAAGGGGGAGGAAGG + Intronic
1102167835 12:110820676-110820698 CTGGGGAGAGGGGAGGAGGAGGG - Intergenic
1102230251 12:111257257-111257279 AAGAGGAAAAGGGAGGAGGAGGG - Intronic
1102551656 12:113696010-113696032 CATGGGATGAGGGATGAGGAGGG - Intergenic
1102709878 12:114916547-114916569 GAGGGGAAGAAGAAGGAGGAAGG - Intergenic
1102786118 12:115606349-115606371 AAGGGGAGAGAGGAGGGGGATGG + Intergenic
1102820159 12:115901793-115901815 CTGGGGATTTTGGAGGAGGACGG + Intergenic
1102990468 12:117311997-117312019 CAGTGGAAAAAGTAGGAGGTAGG + Intronic
1103039715 12:117685132-117685154 CAGGGGATGGTGGAGGAGGCTGG - Intronic
1103235377 12:119368177-119368199 GAGGAGAAAAAGGAGGGGGAAGG + Intronic
1103397471 12:120619143-120619165 GAGGGGCTAAGGAAGGAGGAGGG - Intergenic
1103450110 12:121022724-121022746 CAGAGGACAAAGGATGATGAGGG - Intronic
1103972120 12:124678892-124678914 CAGGGGAGGGAGGAAGAGGAGGG - Intergenic
1104113796 12:125729349-125729371 CAGCTGATAAAGCAGGAGCAGGG + Intergenic
1104578337 12:129989153-129989175 CAGGGGAGAATGGAGGGAGAGGG + Intergenic
1104606566 12:130193737-130193759 CAGGGTAGAAAGGATGAAGACGG - Intergenic
1104846123 12:131847870-131847892 CAGGGGACAGAGGGGGAGCAGGG - Intronic
1105250239 13:18692658-18692680 AAGAGGATAAAGTATGAGGAAGG - Intergenic
1105738332 13:23295708-23295730 GAGAGGAAGAAGGAGGAGGAAGG - Intronic
1105966340 13:25388181-25388203 AAGGAGAGAAAGAAGGAGGAAGG + Intronic
1106231728 13:27825941-27825963 CAGGAGAGAAAGGAGGAGGAAGG + Intergenic
1106582027 13:31027088-31027110 CTGGAGAAGAAGGAGGAGGAGGG - Intergenic
1106602424 13:31199725-31199747 CAGAGGAGAAAGGAAGAGGAGGG + Intergenic
1107037509 13:35916871-35916893 CAGGAGAGAAGGGAGGTGGAAGG - Intronic
1107149101 13:37091287-37091309 CATGGGAAAAAGGAAGAAGAGGG + Intergenic
1108577120 13:51800104-51800126 TAGGGAATAAAGGAGGAGGATGG + Intronic
1109168982 13:59073015-59073037 CAGGGGAGAAAGGTGGAAAAGGG - Intergenic
1109709947 13:66146533-66146555 CAGAGCAAAAAGGAGGAGGACGG + Intergenic
1110034764 13:70669308-70669330 GAGGGAAGAAAGGAGGATGAGGG - Intergenic
1110215509 13:73020609-73020631 CAGGTAATAGAGGAGGATGAAGG - Intergenic
1110778183 13:79433744-79433766 AAGGAGACAGAGGAGGAGGAAGG + Intergenic
1110844586 13:80179821-80179843 CAGGGGAGAATGGTGGAGGAAGG - Intergenic
1111495858 13:89048831-89048853 CAGGGGATAAGGGCTGAGGGGGG + Intergenic
1112232263 13:97601117-97601139 TAGGGGAGCAAGGAGGATGAGGG + Intergenic
1112364689 13:98746876-98746898 CAGAGGCTTAAGAAGGAGGAAGG - Intronic
1112586394 13:100722614-100722636 CGGGGGAGAATGGAGGAGGGGGG + Intergenic
1113225905 13:108159273-108159295 CAGCTGAGAAAAGAGGAGGAAGG + Intergenic
1113325399 13:109276778-109276800 CAGGGGAGAATGGTGGAAGAAGG - Intergenic
1113754784 13:112803828-112803850 AAGGAGAGGAAGGAGGAGGAGGG - Intronic
1113909876 13:113836721-113836743 GAGGGGAATGAGGAGGAGGAGGG + Intronic
1113920387 13:113904895-113904917 AAGGTGATAAAGAAAGAGGAAGG + Intergenic
1113957718 13:114108157-114108179 CAGGGGATGACGGAGGATGATGG - Intronic
1114287930 14:21262746-21262768 CAAGGGAAACAGGAGGAAGATGG + Intronic
1114465922 14:22922671-22922693 AAGGGAAGAAAGCAGGAGGAAGG + Intronic
1114479706 14:23025143-23025165 CAGGGGATAGAGGAGGTTGATGG - Intronic
1114517396 14:23308774-23308796 CAGGAGAGAAAGAAGGAGAAAGG - Intronic
1114531471 14:23399217-23399239 CTGGGCAGAAAGGAGGAGGAAGG - Intronic
1114614847 14:24062861-24062883 CAGGTTATTAAGGAGGAGCAGGG - Intronic
1114987921 14:28252829-28252851 AAGGGGAGAAAAGAGTAGGATGG - Intergenic
1115442238 14:33449001-33449023 GAGGAAATAAAGGAGGAGAAGGG + Intronic
1115822811 14:37229900-37229922 CAGGGGCTAAAGGTTGGGGATGG + Intronic
1116660493 14:47704467-47704489 CAGGGGAGAAAAGAGGATGGGGG + Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1118533909 14:66737229-66737251 AAGGGGAAAAAGAAAGAGGAAGG - Intronic
1118595699 14:67433643-67433665 TGGGGGAAAAAGAAGGAGGAGGG + Intergenic
1118676310 14:68188351-68188373 AAGGGGAGAAAGGAGGAGGGGGG - Intronic
1118712566 14:68534443-68534465 TAAAGGATAAAGGAGGAGAAAGG + Intronic
1118892195 14:69919911-69919933 CAGGGGAGAAAGGGGGGGGGGGG - Intronic
1118908672 14:70043216-70043238 TGGGAGATAAAGGAAGAGGATGG + Intergenic
1118915660 14:70101344-70101366 CAGTGGATAAAGAAAGAGAATGG + Intronic
1119180384 14:72601044-72601066 AAGGGGGAAGAGGAGGAGGAGGG + Intergenic
1119667966 14:76498533-76498555 CAGGGGTTGAAGGTGGAGGCTGG - Intronic
1119964809 14:78902532-78902554 AAGGAGATGAAGGAGGAGGAAGG + Intronic
1119996831 14:79262438-79262460 GAGGAGAAAGAGGAGGAGGAAGG + Intronic
1120167970 14:81220675-81220697 GAGCGGAGAGAGGAGGAGGAGGG + Exonic
1120878226 14:89394005-89394027 CATGGGATAATGGAGCAAGAAGG - Intronic
1121152934 14:91654070-91654092 AAAGGGATAAAGAAGGAGGTGGG + Intronic
1121443402 14:93963144-93963166 CAGGGGATGAAGGTGGGTGATGG - Intronic
1121882736 14:97515104-97515126 CAAGGGCTAAGGGAGGAGGCCGG - Intergenic
1122082427 14:99274745-99274767 GAGGGGGAGAAGGAGGAGGAGGG - Intergenic
1122376251 14:101261074-101261096 CTGTGGATAAAGGGGGATGATGG + Intergenic
1122581563 14:102775021-102775043 GAGAAGAAAAAGGAGGAGGAGGG + Intergenic
1122647895 14:103207278-103207300 GAGAGGAGAAAAGAGGAGGAGGG - Intergenic
1122840754 14:104461588-104461610 CAGGGGACAAGGGGGGTGGACGG + Intergenic
1123194896 14:106606687-106606709 CAGGTGAAAAGGGAGGAGGGAGG + Intergenic
1123197182 14:106627816-106627838 GAGGTGAAAAAGGAGGAGGGAGG + Intergenic
1123198526 14:106639692-106639714 GAGGTGAAAAAGGAGGAGGGAGG + Intergenic
1123485828 15:20737520-20737542 CAGGGGATGAGGCAGGAGCATGG + Intergenic
1123542316 15:21306563-21306585 CAGGGGATGAGGCAGGAGGATGG + Intergenic
1124058541 15:26265231-26265253 CAGCGGGTAAGGGAGGAGGAAGG - Intergenic
1124587623 15:31024324-31024346 CAAGGGATAAGGTGGGAGGATGG - Intronic
1124591585 15:31058669-31058691 CAGGAGAGGAAGGAGGAGTATGG + Intronic
1124788943 15:32708364-32708386 CAGGGACTCAAAGAGGAGGAAGG + Intergenic
1124872731 15:33559084-33559106 CAGAGGGTAAAGGAGGAGGTTGG + Intronic
1125007373 15:34832941-34832963 AAGAGGATAAGGGAGGAGAAGGG + Intergenic
1125031441 15:35079620-35079642 CAAGAGAAAAAGGAGGAGAAAGG + Intergenic
1125306205 15:38318577-38318599 CAGGGGAAAGAGAAGGAGGGAGG - Intronic
1125544008 15:40489330-40489352 CGGGGGAGAAAGGAGGGGGCGGG + Intergenic
1125617824 15:41031489-41031511 GAGGGGAGGAAGGAGAAGGAAGG + Intronic
1125668576 15:41452627-41452649 CAGAGGCTAAAGTGGGAGGATGG + Intronic
1126108878 15:45164082-45164104 TAGGTGCTAAAGGAGGAGGCAGG + Intronic
1126314705 15:47357579-47357601 CACGGGAGAAAGGTGTAGGATGG + Intronic
1126777476 15:52112332-52112354 CCGCGGCTAAAGGAGCAGGAGGG - Exonic
1127800835 15:62476208-62476230 CAGGTGACAAAGCAGGAGGAGGG - Intronic
1127841320 15:62834663-62834685 CAGGGGATCAACGGGAAGGATGG - Intronic
1128258679 15:66216742-66216764 TTAGGGAGAAAGGAGGAGGAGGG + Intronic
1128396198 15:67228979-67229001 GAGGGGAGACAGTAGGAGGAGGG + Intronic
1128683669 15:69668563-69668585 AGGGGAAGAAAGGAGGAGGAGGG + Intergenic
1128713276 15:69887897-69887919 CAGGAGAAAAGGAAGGAGGAAGG + Intergenic
1128797760 15:70477834-70477856 GAGGAGATGGAGGAGGAGGAGGG + Intergenic
1128810665 15:70569587-70569609 CTGGGGTTAAAGGTGGAGGAAGG + Intergenic
1129165434 15:73774591-73774613 CAGGGGTGAGAGGAGGTGGACGG - Intergenic
1129272848 15:74428582-74428604 CTGGGCAGAAAGGAGGAGGAGGG + Intronic
1129614674 15:77089063-77089085 CATGGAATAAATGAGGAGGGAGG - Intergenic
1129671765 15:77611657-77611679 CAGGGGATAAAGCCTGAGAAAGG + Intergenic
1129695677 15:77739496-77739518 CAAGGGAAAAAGGAGGGGAAAGG - Intronic
1129740270 15:77986584-77986606 GAGGGGCTATGGGAGGAGGAAGG - Intronic
1129845482 15:78766013-78766035 GAGGGGCTATGGGAGGAGGAAGG + Exonic
1130107802 15:80942178-80942200 CTGGGGATACGGGAAGAGGAGGG + Intronic
1130256366 15:82327846-82327868 AAGGGGCTATGGGAGGAGGAGGG - Intergenic
1130598585 15:85262142-85262164 GAGGGGCTATGGGAGGAGGAGGG + Intergenic
1130740057 15:86589726-86589748 GAGGGAGGAAAGGAGGAGGAAGG - Intronic
1130918375 15:88323840-88323862 AAAAGGATCAAGGAGGAGGAAGG + Intergenic
1130959923 15:88652611-88652633 GAGGGGACAGGGGAGGAGGAAGG - Intronic
1131132922 15:89911786-89911808 CAGGGGATAGTGGATGGGGATGG - Intronic
1131302011 15:91207911-91207933 CAGGGGAGAAGTGAGGAAGAAGG + Intronic
1131689317 15:94809434-94809456 AAGGGGGTGAAGGAGAAGGAAGG + Intergenic
1131852141 15:96554731-96554753 GAGGTGATGGAGGAGGAGGAGGG - Intergenic
1131951357 15:97684551-97684573 GTGAGGCTAAAGGAGGAGGAAGG - Intergenic
1132358446 15:101191406-101191428 CAGGGGTTACAGGGGAAGGAAGG + Intronic
1202950633 15_KI270727v1_random:33704-33726 CAGGGGATGAGGCAGGAGGATGG + Intergenic
1132539963 16:504128-504150 GAGGGGGTACAGGAGGAGGTGGG - Intronic
1132551950 16:557188-557210 CAGGGGAGAACGGAGGGGGCTGG - Intergenic
1132812670 16:1809021-1809043 CAGTGGCTCACGGAGGAGGAAGG + Exonic
1133037252 16:3040595-3040617 CAGGAGAAAAATGAGTAGGAGGG + Intergenic
1133037739 16:3043809-3043831 TAGGGGATAAAGTGGGATGAGGG - Intergenic
1133392789 16:5422898-5422920 GAGGGGAGGAAAGAGGAGGAGGG + Intergenic
1133392821 16:5422994-5423016 GAGGGGAGGAAGGAGGAGAAAGG + Intergenic
1133520157 16:6549194-6549216 GAGGGGAAAAGGGAGGAGGAGGG + Intronic
1133520202 16:6549315-6549337 GAGGGGAGGAGGGAGGAGGAGGG + Intronic
1133624989 16:7562729-7562751 CAGTGGGGGAAGGAGGAGGAAGG + Intronic
1133981684 16:10637385-10637407 CAGTGAATAAAGAAGGAAGAAGG + Intronic
1134085570 16:11355213-11355235 CAGGTGAAGCAGGAGGAGGAAGG + Intergenic
1134266743 16:12699470-12699492 GATGAGATAAACGAGGAGGAGGG - Intronic
1134340859 16:13344439-13344461 AAGGGCATAGAGGAGGAAGAAGG - Intergenic
1134892878 16:17856539-17856561 CAAGGCAGAAAGGAGGAGTATGG - Intergenic
1135183081 16:20291920-20291942 CAGGGGAGAGAGGAGGGGGAGGG + Intergenic
1135543340 16:23349002-23349024 AAGGAGAGAAAGGAGAAGGAAGG - Intronic
1137442027 16:48505962-48505984 CAGGGAAGGTAGGAGGAGGAGGG + Intergenic
1137968358 16:52959108-52959130 AAGAAGAAAAAGGAGGAGGAGGG - Intergenic
1137979265 16:53055692-53055714 CACATGAGAAAGGAGGAGGAGGG - Intronic
1138492753 16:57385929-57385951 CAGGAGATCCAGGAGGTGGAGGG - Intergenic
1138923610 16:61564066-61564088 CAAGAGATTAAGAAGGAGGAAGG - Intergenic
1139321657 16:66119218-66119240 AAGGAGGTATAGGAGGAGGAAGG - Intergenic
1139365407 16:66429416-66429438 CAGGGGATAGGGGAGGATGCTGG + Intronic
1139480676 16:67228921-67228943 CAGGGAATAAAAGATGGGGAGGG - Intronic
1139612170 16:68067128-68067150 GAGGGGAGAAGGGAGGGGGAGGG - Intronic
1139851018 16:69951660-69951682 CTGGGGAGGAAGGAGGAGGAAGG + Intronic
1139880000 16:70174572-70174594 CTGGGGAGGAAGGAGGAGGAAGG + Intronic
1139910900 16:70396920-70396942 CAGGGGCTAAGGGAGGTGAAGGG - Intronic
1140270341 16:73459736-73459758 CAGGAGATAAAGGGGAAGCAAGG + Intergenic
1140372514 16:74420955-74420977 CTGGGGAGGAAGGAGGAGGAAGG - Intronic
1140464800 16:75172730-75172752 CAGGGTAGAAAGATGGAGGATGG + Intergenic
1140958886 16:79893759-79893781 CAGGGTAAAAAGGATGAGGCAGG + Intergenic
1141363600 16:83420911-83420933 CAGGGGAAAAAGAAGTAAGACGG + Intronic
1141580638 16:84996232-84996254 CTGGGGCTAAAAGAGCAGGAGGG - Intronic
1141659491 16:85434353-85434375 CCGGGTATACAGGAGGCGGACGG - Intergenic
1141714019 16:85716650-85716672 CAGAGGGAGAAGGAGGAGGAAGG + Intronic
1141857370 16:86692739-86692761 CAGGGGTTAATGGAGTAGGTCGG + Intergenic
1142129247 16:88425283-88425305 CAGGAGGTGATGGAGGAGGAGGG - Intergenic
1142362237 16:89632941-89632963 GAGGGGCTGCAGGAGGAGGAGGG + Intronic
1203141803 16_KI270728v1_random:1771761-1771783 GAGATGATAGAGGAGGAGGAGGG - Intergenic
1142471896 17:169341-169363 CAGGGGCCAGGGGAGGAGGAAGG + Intronic
1142539545 17:647523-647545 CAGCGGATGGGGGAGGAGGAAGG - Intronic
1142541726 17:664920-664942 CAGGGAATGCAGGAGGAGGACGG + Intronic
1142581988 17:948880-948902 CAGGGGGGAGAGGAGGAGGCAGG - Intronic
1142581996 17:948899-948921 CAGGGGGGAGAGGAGGAGGCAGG - Intronic
1142582004 17:948918-948940 CAGGGGGGAGAGGAGGAGGCAGG - Intronic
1142582012 17:948937-948959 CAGGGGGGAGAGGAGGAGGCAGG - Intronic
1142798078 17:2324666-2324688 GTGGGTATGAAGGAGGAGGATGG - Exonic
1142887291 17:2920635-2920657 CAGGGATTAAAGGAGGAAGCAGG + Intronic
1143728839 17:8868403-8868425 GAGGGGATAAAGCATGAGGTTGG - Intergenic
1143980356 17:10863867-10863889 AAGGGGAAAAAGAAAGAGGAAGG - Intergenic
1144051165 17:11498268-11498290 TTGGGGATGGAGGAGGAGGAAGG - Intronic
1144155216 17:12493821-12493843 CACGGGAGAAAGAAGGAGGCCGG - Intergenic
1144438721 17:15262789-15262811 CAGGGGAGAAGGGAGGTGGGAGG - Intronic
1144784882 17:17826025-17826047 GAGGGGCTAAAGGAAGAGCAGGG - Intronic
1144867301 17:18344904-18344926 CAGGGGCTGAAGGTGGAGGCAGG + Intronic
1144874796 17:18391836-18391858 CAGGGGGCAGAGGAGGAGCATGG - Intergenic
1145013671 17:19383587-19383609 CAGGGGAGCAAGGAGGAGCCAGG + Exonic
1145157429 17:20552585-20552607 CAGGGGGCAGAGGAGGAGCATGG + Intergenic
1145727161 17:27140809-27140831 AAGAGGAGAAAGGAGGAGGAAGG - Intergenic
1145799841 17:27675932-27675954 CAGGGGGCAGAGGAGGAGCATGG + Intergenic
1146159363 17:30551666-30551688 CAGGGGGCAGAGGAGGAGCATGG - Intergenic
1146373640 17:32280477-32280499 CAGGCTGTGAAGGAGGAGGAAGG + Intronic
1146453702 17:32993809-32993831 CAGGGGAAGGAGGAGCAGGAGGG + Intronic
1146845216 17:36178148-36178170 CAGGGGGCAGAGGAGGAGCATGG + Intronic
1146873432 17:36389991-36390013 CAGGGGGCAGAGGAGGAGCATGG + Intronic
1146880791 17:36441079-36441101 CAGGGGGCAGAGGAGGAGCATGG + Intergenic
1146915051 17:36673072-36673094 CAGGTGATATAGGAGGAAGGTGG + Intergenic
1147065958 17:37922882-37922904 CAGGGGGCAGAGGAGGAGCATGG - Intergenic
1147317185 17:39626692-39626714 GAGAGGATAAAGGGGGAGGGAGG - Intergenic
1147431587 17:40374687-40374709 GAGGACAAAAAGGAGGAGGAGGG - Intergenic
1147441935 17:40452804-40452826 CAGGGGAGAGGGGAGGAGGTAGG + Intronic
1147538138 17:41334188-41334210 CAGGGGGCAGAGGAGGAGCATGG + Intergenic
1147579981 17:41622735-41622757 CAGGGAATAGAAGAGAAGGAGGG - Intronic
1147587525 17:41660881-41660903 CAGGGGATTCACCAGGAGGAGGG + Intergenic
1147610217 17:41797599-41797621 AAAGGAAGAAAGGAGGAGGAAGG - Intergenic
1147862806 17:43533434-43533456 CAGGGATTACAGGAGAAGGAAGG + Intronic
1147962367 17:44175856-44175878 TAGGGGAAAGTGGAGGAGGATGG + Intronic
1148733601 17:49852057-49852079 CAGGAGATAAAGCAGGGGCAGGG + Intergenic
1148758265 17:49985966-49985988 AAGGGGAGAATGGAGGGGGAAGG - Intergenic
1148804295 17:50256555-50256577 AAGAAGAAAAAGGAGGAGGAGGG + Intergenic
1148856358 17:50581132-50581154 CAGGGGAGAAAGGATATGGAGGG + Intronic
1149443472 17:56694980-56695002 CAGGGGTTAGGGGAGGGGGAAGG - Intergenic
1149500577 17:57149313-57149335 GAGGGGAAAAATGAGGGGGAAGG + Intergenic
1149576692 17:57718726-57718748 CAGGAGAGAAAGAAGGAGAAAGG + Intergenic
1150105649 17:62460705-62460727 GAGAGGAAAAAGGAGGAAGAAGG - Intronic
1150290474 17:63978604-63978626 CGGGGAGTAAAGGAGAAGGAAGG - Intergenic
1150381877 17:64727265-64727287 CAGGGGTTATGGTAGGAGGAAGG + Intergenic
1150582252 17:66484980-66485002 CAGGAGATAAAGGAGGAGTGGGG + Intronic
1151504257 17:74516136-74516158 CATGGGAGAAAGGTGGAGGCTGG + Intergenic
1151757683 17:76083912-76083934 CAAGGGAAAAAGGAGAAGGGTGG - Intronic
1152000090 17:77639931-77639953 AAGAGGAAGAAGGAGGAGGAGGG - Intergenic
1152031204 17:77844581-77844603 CAGGGGCTGGAGGAGGAGGAAGG + Intergenic
1152305491 17:79518071-79518093 CCTGGGGAAAAGGAGGAGGAGGG - Intergenic
1152340810 17:79723385-79723407 CAGGGTATGAAGGGGGTGGAGGG + Intergenic
1152557335 17:81059968-81059990 CATGGGCACAAGGAGGAGGAGGG + Intronic
1152659333 17:81535224-81535246 ATGGGGATGATGGAGGAGGAAGG - Intronic
1152912195 17:83011185-83011207 CCGGGGCGAGAGGAGGAGGAAGG + Intronic
1153396732 18:4630513-4630535 GAGGAGAAAGAGGAGGAGGAGGG + Intergenic
1153612302 18:6898879-6898901 CAGGGGCAAAAGGGGGAAGAGGG + Intronic
1153927544 18:9847355-9847377 CAGGGAGCTAAGGAGGAGGAGGG - Intronic
1154000404 18:10477728-10477750 CAGGGGAGAAAGGAAGAGGATGG + Intronic
1154122474 18:11663127-11663149 CAGGTAACCAAGGAGGAGGAGGG + Intergenic
1154375986 18:13810273-13810295 CAGGTGCTAAAGGATGAGGAGGG - Intergenic
1154505306 18:15033030-15033052 CATGGGATAACACAGGAGGAAGG - Intergenic
1154986384 18:21555249-21555271 CAGGGGTTAAGGTAGGAAGAAGG + Intronic
1155576403 18:27252505-27252527 GGGGGGAAAGAGGAGGAGGAAGG + Intergenic
1156019424 18:32582915-32582937 GAGGGGGAAAAAGAGGAGGAGGG - Intergenic
1156457113 18:37301058-37301080 CAGGAGACACAGGAGGAGGCAGG + Intronic
1156768543 18:40689609-40689631 AAGGAGAAAAAGAAGGAGGAGGG - Intergenic
1156812946 18:41274238-41274260 CAGGGGAAAGAGTAGCAGGAGGG + Intergenic
1156961298 18:43034908-43034930 CAAGGCACAGAGGAGGAGGAAGG - Intronic
1157072513 18:44424491-44424513 AACAGGATAAAGGAGGAAGATGG + Intergenic
1157494089 18:48142864-48142886 GAGGAGCAAAAGGAGGAGGAAGG - Intronic
1157545430 18:48543181-48543203 CAGGTCATGAAGGAGGAGGCAGG + Intronic
1157551105 18:48582400-48582422 CTGGGGATAAAGGAGGTGCCTGG + Intronic
1157618764 18:49003325-49003347 GAGGGGAAAAGGGAGGAGGATGG - Intergenic
1157666894 18:49494716-49494738 GAAGGGATAAAAGATGAGGAAGG - Intergenic
1157966244 18:52211493-52211515 TAGGAGGTAAAGAAGGAGGAGGG + Intergenic
1158015689 18:52780763-52780785 CAGGGGAGAAGGGAGGAGGAAGG + Intronic
1158275190 18:55759216-55759238 GAGGAGAAAGAGGAGGAGGAGGG + Intergenic
1158516914 18:58138370-58138392 GAGGGGAGGAAAGAGGAGGAGGG - Intronic
1158588827 18:58762853-58762875 CAGGGAATACAGGAGGAAAATGG - Intergenic
1159333749 18:67036047-67036069 CAGGAGACAAAGGAGAAGTAAGG - Intergenic
1159702857 18:71650900-71650922 CAGAATATAAAGGTGGAGGAAGG + Intergenic
1159933089 18:74334324-74334346 AAGGGGAGAAAAGAGGAGGAGGG + Intronic
1159970749 18:74648962-74648984 CAGGGGATCAAGGGTGCGGAGGG - Intronic
1160031723 18:75267563-75267585 GAGAGGATAAAGGAGAGGGAAGG + Intronic
1160080668 18:75724271-75724293 CAAAGCATAAATGAGGAGGAGGG + Intergenic
1160623526 18:80187609-80187631 CAGGGGAGCCAGGAGGTGGATGG - Intronic
1160819718 19:1052362-1052384 GAGGGGGAAGAGGAGGAGGAGGG + Intronic
1161012613 19:1967850-1967872 CTGGGGAGAAGGGAGGAGGGAGG - Intronic
1161012634 19:1967911-1967933 CTGGGGAGAAGGGAGGAGGGAGG - Intronic
1161370553 19:3908696-3908718 GAGGAGAAAAGGGAGGAGGAGGG - Intronic
1161642325 19:5432071-5432093 CAGGGAAGAAAGGGGTAGGATGG + Intergenic
1161957856 19:7506349-7506371 CAGGGGATGAAGCCGGGGGAGGG - Intronic
1161958069 19:7507136-7507158 CAGCGGGTAAGGGAGGCGGAGGG + Exonic
1162003988 19:7765436-7765458 CAGGAGAGGGAGGAGGAGGAGGG + Intronic
1162080490 19:8214966-8214988 GAGGAGAAAAAGGAAGAGGAGGG + Intronic
1162080503 19:8215008-8215030 GAGGAGAAAAAGGAAGAGGAGGG + Intronic
1162094519 19:8302624-8302646 CAGAGGAGTAAGGAGGGGGAAGG + Intronic
1162527819 19:11216876-11216898 CAGGAGATGATGGAGGAGGCAGG - Intronic
1162716327 19:12636684-12636706 GAGGGGAAAAAGGGGGATGAAGG - Intronic
1163156824 19:15444233-15444255 CAAGGGATAAAAGTGGAGGTAGG + Intronic
1163188108 19:15653793-15653815 CAGGACAGAAAGGAGGAGAAGGG + Intronic
1163216783 19:15885056-15885078 CAGGACAGAAAGGAGGAGAAGGG - Intronic
1163282196 19:16324892-16324914 CCGGGGAGAAAGGACGCGGACGG - Exonic
1163465805 19:17467991-17468013 GAGAAGAAAAAGGAGGAGGAGGG + Intergenic
1163658394 19:18561711-18561733 CAGGGGATGAGGGAGGAAGCTGG + Intronic
1163729175 19:18940019-18940041 CAGGGGACCAAGGAGGAGTTTGG + Intronic
1164335596 19:24316314-24316336 CAGGAAAAAAAGGAGAAGGAAGG + Intergenic
1164441704 19:28284492-28284514 AAGGGGAAAGAGGAGGTGGAGGG + Intergenic
1164441897 19:28285128-28285150 GAGGGGAAGAAGGAGAAGGAGGG + Intergenic
1164479833 19:28602780-28602802 CAGGCGATTTAGGAGGAGAAGGG - Intergenic
1164592609 19:29514496-29514518 CAGGGGATGAGGAAGAAGGAGGG + Intergenic
1164609829 19:29624377-29624399 CAGGGGAAAAGGGAGCAGGCAGG + Intergenic
1164671503 19:30074678-30074700 CAGGAGAGACTGGAGGAGGAAGG - Intergenic
1165098238 19:33422064-33422086 CAGGGGAGTAAGGGGGAGGTGGG - Intronic
1165231396 19:34389415-34389437 CAGAGGATAAAGGAAGGGGTGGG - Intronic
1165362387 19:35344943-35344965 CAAGGGATAGAGGAGGTGGTGGG - Intronic
1165467369 19:35982891-35982913 CAGCAGGTACAGGAGGAGGAAGG - Intergenic
1165730618 19:38142539-38142561 CAGGGGAGGAAGGAGGCAGAGGG - Intronic
1165742159 19:38210885-38210907 CAGGGGAAGAAGGAGGTGGATGG + Intergenic
1165796585 19:38523475-38523497 GAGAAGATACAGGAGGAGGAAGG - Intronic
1165796601 19:38523551-38523573 GAGAAGATACAGGAGGAGGAAGG - Intronic
1165880027 19:39035885-39035907 CAGAGGCTAAGGCAGGAGGATGG - Intergenic
1166346586 19:42170069-42170091 TGGGGGGAAAAGGAGGAGGAGGG + Intronic
1166366033 19:42279016-42279038 CAAGGGGTAAAGGGGGAGGTAGG - Intronic
1166384990 19:42375874-42375896 CTGGGGATCCAGGAGGAGCAGGG + Exonic
1166911279 19:46160072-46160094 AAGGTGATAAGGAAGGAGGAAGG - Intronic
1166960294 19:46492923-46492945 GAAGGGAAAGAGGAGGAGGAGGG - Exonic
1167074412 19:47240003-47240025 CAGGGGAGCAGGGAGGTGGATGG - Intergenic
1167191252 19:47991625-47991647 GAGGGGAAGGAGGAGGAGGAGGG - Intronic
1167214236 19:48153871-48153893 AAGAGGAAGAAGGAGGAGGAAGG - Exonic
1167367401 19:49061947-49061969 GAGGAGGAAAAGGAGGAGGATGG + Exonic
1167474543 19:49692144-49692166 CTGGGTATGAAGGAGGAGGAGGG + Intronic
1167609891 19:50501933-50501955 GAGGTGATGAAGGAGGAGGGTGG - Intergenic
1168514980 19:57003629-57003651 CAGGGGCTGCAAGAGGAGGAGGG - Intergenic
1168517460 19:57019404-57019426 CAGGGGATGAATGAGGAAAATGG + Intergenic
1168615688 19:57835159-57835181 ATGGGGTTAAGGGAGGAGGAAGG + Intronic
1168621095 19:57880289-57880311 ATGGGGTTAAGGGAGGAGGAAGG - Intronic
925285871 2:2715457-2715479 CAGATGCTGAAGGAGGAGGATGG - Intergenic
925461550 2:4067596-4067618 CAGGTGATAAAGGATCAGGAGGG - Intergenic
925571867 2:5321122-5321144 CAGGAGATGAAGGAGGAACAAGG - Intergenic
925637112 2:5951165-5951187 CTGGGGAGAGAGAAGGAGGAAGG - Intergenic
925774094 2:7316245-7316267 CAGGGGTTACAGGAGAGGGAGGG + Intergenic
925831891 2:7904016-7904038 CAGGAGAAAAGGGATGAGGATGG - Intergenic
926123665 2:10258251-10258273 AAGGTGAGCAAGGAGGAGGAAGG - Intergenic
927003157 2:18820774-18820796 GAGGGGATAAAGAAGCAGAAAGG - Intergenic
927502491 2:23591893-23591915 CTGGAGATAAAGGAAGAGGAAGG - Intronic
927641718 2:24849741-24849763 CAGAGGGGAAAGGAGGAGGGGGG + Intronic
927943787 2:27122576-27122598 CAGGGGAAGAAGGAGGAACATGG - Intergenic
928197513 2:29226174-29226196 GAAGAGTTAAAGGAGGAGGATGG + Intronic
929049365 2:37822708-37822730 CATGGGATGAAGGAGCTGGAGGG - Intergenic
929242237 2:39665554-39665576 AAGGGGAGAGAGGAGGATGAGGG + Intronic
929922395 2:46182069-46182091 AAGGGGATAATGGAGTAGTAGGG - Intronic
929959716 2:46487440-46487462 CAGGAATTAAAGGAGGAGGAAGG - Intergenic
930139595 2:47938506-47938528 CTTGGGAAAGAGGAGGAGGAGGG - Intergenic
930241552 2:48940887-48940909 CAAGGGAAAGAAGAGGAGGAGGG - Intergenic
930254298 2:49071793-49071815 CAACGGATGAAGGATGAGGAAGG + Intronic
930605916 2:53492965-53492987 CAGGGGATAAAGAAGAGGGGAGG + Intergenic
930675084 2:54191773-54191795 CAGAGAATAATGGAGGGGGAGGG - Intronic
930692814 2:54381685-54381707 CAGGAGTGAAAGGATGAGGAAGG - Intronic
931019309 2:58025057-58025079 CATGGGATTAAGGACAAGGATGG - Intronic
931348801 2:61470759-61470781 GAGGGGAGAGAGGCGGAGGAGGG + Exonic
931405639 2:61974932-61974954 CAGGGGTTCAGGAAGGAGGAGGG - Intronic
931522313 2:63112274-63112296 CAGGGGTTACAGGAAAAGGAGGG - Intergenic
931587138 2:63841211-63841233 CAGCTGCTAAAGGAAGAGGAAGG + Intronic
931732425 2:65165132-65165154 CAGAGCAGAAAGGAGGAGCAAGG - Intergenic
931985388 2:67736657-67736679 AAGGGGATGGAGGAGGAGAATGG - Intergenic
932818202 2:74878517-74878539 CAGGGGCAGGAGGAGGAGGAAGG - Intronic
933888129 2:86739412-86739434 CAGGAAAAAAAGGAGGAGAAGGG - Intronic
933922049 2:87057294-87057316 CAGGAAAAAAAGGAGGAGAAGGG + Intergenic
934159479 2:89234830-89234852 AAGGAGATGAGGGAGGAGGAGGG - Intergenic
934207798 2:89947601-89947623 AAGGAGATGAGGGAGGAGGAGGG + Intergenic
935259760 2:101344096-101344118 CAGGGCAGGCAGGAGGAGGAAGG + Intergenic
935514931 2:104024041-104024063 CAGGGAATGATGGAGGTGGAGGG + Intergenic
935753673 2:106260876-106260898 AAGGGGAGAAGGGAGGATGAGGG + Intergenic
935874821 2:107494866-107494888 CAGAGGAAAAAGGGGAAGGATGG + Intergenic
935883635 2:107592326-107592348 CGGGAGAGAAGGGAGGAGGAAGG - Intergenic
936341184 2:111633816-111633838 GAGAGGCCAAAGGAGGAGGAAGG + Intergenic
936941166 2:117885896-117885918 TAGAGAATAACGGAGGAGGATGG + Intergenic
937160845 2:119759828-119759850 GAAGAGATAGAGGAGGAGGAGGG + Exonic
937264484 2:120607292-120607314 CAGGGCATAGAGCAGGAGGATGG + Intergenic
937490247 2:122359518-122359540 GAGGAGGAAAAGGAGGAGGAAGG - Intergenic
938178942 2:129162513-129162535 GAGGGGCAGAAGGAGGAGGAAGG + Intergenic
938399982 2:130982584-130982606 GAGGAGGGAAAGGAGGAGGAGGG - Intronic
938504493 2:131863292-131863314 CATGGGATAACACAGGAGGAAGG - Intergenic
938713735 2:133999731-133999753 CATGGGATAAATCAGCAGGAAGG - Intergenic
939316413 2:140556186-140556208 CAGGGGAGAAAGGAGAGAGAAGG - Intronic
939560259 2:143723331-143723353 GAGGGGCTGAAGGAGGAGGCTGG + Intronic
940658984 2:156523248-156523270 CAGGGGTTAGGGGAGGGGGAAGG - Intronic
940890873 2:159034205-159034227 CAAGGGAGAAGGCAGGAGGAGGG - Intronic
941010769 2:160297197-160297219 CAGGGGAGAAAGATGGAGGAGGG + Intronic
941322766 2:164075783-164075805 CAAAGGATAAAGGAGAAGAAAGG - Intergenic
941615885 2:167718809-167718831 CAGGGGAGAAAGGAGGGAGAAGG + Intergenic
942378840 2:175365752-175365774 TCGGGGAGAAAGTAGGAGGAAGG + Intergenic
942612253 2:177754577-177754599 CAGGGGAGGAAGGTGAAGGAAGG - Intronic
942692578 2:178601967-178601989 CAGTGGAAAAAAGAGGAGAATGG + Intronic
943775200 2:191757980-191758002 CAGGTGAAAATGGAGGGGGAGGG + Intergenic
943834659 2:192503626-192503648 CTGGAGATAAGGGAGGAAGAAGG + Intergenic
944523111 2:200591311-200591333 CATGGGAACAAAGAGGAGGATGG + Intronic
944818200 2:203401275-203401297 GAGGAGATGAAGGTGGAGGAGGG - Intronic
944850445 2:203713943-203713965 TAGGAAAGAAAGGAGGAGGAGGG + Intronic
945942668 2:215965470-215965492 CAGGGGATACAGAGGGAGGAAGG + Intronic
946136935 2:217655287-217655309 CAGAGGCTCAAGGATGAGGAAGG + Intronic
946359107 2:219208365-219208387 AAGGGGAAAAAGGGGGAGCAGGG - Intronic
946519116 2:220446683-220446705 GAGGGGAGAAGGGGGGAGGAAGG - Intergenic
946604217 2:221385042-221385064 CATGGGTTAGAGGTGGAGGAAGG - Intergenic
947586152 2:231358173-231358195 CAGGGTATGAATGAGGGGGAGGG + Intronic
948091926 2:235302165-235302187 AAGGGGAGGAGGGAGGAGGAGGG - Intergenic
948136159 2:235637919-235637941 GAGGGCAAAAAGGTGGAGGAAGG - Intronic
948462515 2:238137200-238137222 CAGGGGAAAGAGCAGGAGCAGGG + Intergenic
948691881 2:239711415-239711437 CCAGGGACAAAGGAGGAGGAGGG - Intergenic
948691946 2:239711680-239711702 CTGAGGAGAAAAGAGGAGGATGG - Intergenic
948827189 2:240578421-240578443 CAGGGGACACAGGGAGAGGATGG + Exonic
949022340 2:241748692-241748714 CAGGGGCTGAAGGTGGAGGGCGG - Intronic
1168764571 20:373005-373027 CTGAGGATAAAGGGGGAGGTGGG - Intronic
1168876099 20:1173341-1173363 TTGGGGATCAGGGAGGAGGAGGG - Intronic
1168900312 20:1358306-1358328 CATGGGAAGAAGGAGGAGGGAGG + Intronic
1168956611 20:1838682-1838704 CAGGTCATAAAGCAGGGGGATGG - Intergenic
1169697284 20:8404510-8404532 CAGGGGAGAAAAAAGGAAGAAGG - Intronic
1170110060 20:12795427-12795449 CATGGGAAAAAGGAGAAGGAGGG - Intergenic
1170271407 20:14531095-14531117 CAGGGAAGGTAGGAGGAGGAGGG + Intronic
1170698875 20:18685302-18685324 CAAGGGATAAAGGTGCTGGAAGG + Intronic
1170718297 20:18851399-18851421 CTGAGGATCAAGGAGGAGGTGGG - Intergenic
1170948919 20:20916630-20916652 GAAAGGAAAAAGGAGGAGGATGG + Intergenic
1170995685 20:21355219-21355241 CTGGGGAGAAAGGAGGAGTAGGG - Intronic
1171358911 20:24572828-24572850 CAGGGGTTAAGGATGGAGGAAGG + Intronic
1171486393 20:25489463-25489485 CGGGGGAGTAAGGAGAAGGAGGG - Intronic
1172329276 20:34063729-34063751 AAGGGGATCAAAGAGGAGAAAGG + Intronic
1172778607 20:37422768-37422790 CAGAGGAGGAAGGAGGAGGGAGG - Intergenic
1172791767 20:37510774-37510796 GAGGGGAAGAAGGAGGTGGAGGG - Intronic
1172957649 20:38772526-38772548 AAGGGGAAAAAATAGGAGGAGGG - Intergenic
1172979187 20:38928040-38928062 CTGGGGATCAAGGAGGAAGAAGG + Intronic
1173112287 20:40203229-40203251 GAGGGGAAGAAGGAAGAGGAGGG + Intergenic
1173112831 20:40209957-40209979 AAGGGAAGAAAGGAGGAGGCAGG + Intergenic
1173113064 20:40213490-40213512 CAGGGGCTGAAGCAGGAGAATGG + Intergenic
1173144213 20:40510854-40510876 CAGGGAGGAAAGAAGGAGGAAGG + Intergenic
1173419338 20:42887081-42887103 GAGCGTTTAAAGGAGGAGGATGG - Intronic
1173644881 20:44627033-44627055 CAGGGAATGAGGGAGAAGGAAGG - Intronic
1173793025 20:45840521-45840543 CAGGGGTGAAAGGAAGAGGTGGG + Intronic
1174254898 20:49247259-49247281 CAGGGGATGATGTAGGAAGATGG - Exonic
1174338613 20:49882413-49882435 AAGGAGAGAAAGGAGGAGCATGG - Intronic
1174639346 20:52029792-52029814 GAGGAGGAAAAGGAGGAGGAGGG - Intergenic
1174641774 20:52050482-52050504 GAGGAGAAAGAGGAGGAGGAAGG - Intergenic
1174898483 20:54475258-54475280 CAGGGGCTGAAGGGGGAGGCGGG + Intergenic
1174983912 20:55428201-55428223 GAGGGGAGACAGGAAGAGGAAGG + Intergenic
1175150508 20:56930144-56930166 GAAGGGACAAAGGGGGAGGAGGG + Intergenic
1175298807 20:57928507-57928529 GAGGAGAAAAGGGAGGAGGAAGG - Intergenic
1176792545 21:13336070-13336092 CATGGGATAACACAGGAGGAAGG + Intergenic
1176914433 21:14608242-14608264 CAGGAGATAGAGGAGGAGGGTGG - Intronic
1177543052 21:22520562-22520584 GAGAGGACAAAGGAGGAGGAAGG - Intergenic
1177758344 21:25373784-25373806 GAGGGGAAGGAGGAGGAGGAGGG - Intergenic
1178031365 21:28530090-28530112 CAGGGGTTATAGGAGAGGGAGGG - Intergenic
1178286688 21:31331413-31331435 CAGGGGAAAAATGAGGAAGGAGG + Intronic
1178459680 21:32791495-32791517 AAGGGGAAAAAGGAGGAAAAAGG - Exonic
1178781787 21:35610386-35610408 CATAGGTGAAAGGAGGAGGAAGG - Intronic
1179109457 21:38433899-38433921 CAGAGGATTAGGAAGGAGGATGG - Intronic
1179131187 21:38638803-38638825 AAGGGGATGTGGGAGGAGGAGGG - Intronic
1180104268 21:45607619-45607641 GAGGGGAAAATGGAGGAGAAAGG + Intergenic
1180561931 22:16623363-16623385 AAGAGCATAAAGGTGGAGGAGGG + Intergenic
1180568178 22:16692867-16692889 CAGGGGACAAAGGTGGAAGCTGG + Intergenic
1180883867 22:19225781-19225803 CACGGGAAAAAGTAGGAGCAAGG + Intronic
1180955163 22:19738221-19738243 AAGGGGAGACTGGAGGAGGAGGG - Intergenic
1181090498 22:20469278-20469300 CAGGGAATTAAGAAGGTGGACGG + Intronic
1181673329 22:24436279-24436301 CAGCTGAGAAAGGAGGAGGGAGG - Intronic
1181959976 22:26616066-26616088 GAGGAGAAGAAGGAGGAGGAGGG + Intronic
1182006018 22:26960297-26960319 AGGGAGAGAAAGGAGGAGGAAGG + Intergenic
1182095694 22:27623848-27623870 CAGGGCATAAAGGGGAAGGGAGG - Intergenic
1182134829 22:27891674-27891696 CAGGAGAGAGAGGAGGAGGAAGG - Intronic
1182363547 22:29762777-29762799 GACGGGATACAGGAGGGGGATGG - Intronic
1182630058 22:31678199-31678221 CTGTGGATAAGGAAGGAGGAGGG + Intronic
1182754589 22:32668547-32668569 GAGTGGAGGAAGGAGGAGGAAGG - Intronic
1182931456 22:34178253-34178275 GAGGGGGATAAGGAGGAGGAAGG - Intergenic
1183279291 22:36923482-36923504 CAGAGGACAGAGGAGGAGGGAGG + Intronic
1183487583 22:38097701-38097723 CAGGAGAGAGGGGAGGAGGATGG + Intronic
1183613057 22:38923698-38923720 GAGGGAAGAAAGGAGGAGGGAGG - Intergenic
1183613072 22:38923747-38923769 GAGGGAAGAAAGGAGGAGGGAGG - Intergenic
1183630827 22:39031671-39031693 CTGGGGAAGGAGGAGGAGGAGGG - Intronic
1183634343 22:39052051-39052073 CTGGGGAAGGAGGAGGAGGAGGG - Intronic
1183748212 22:39704351-39704373 AAGGGCACAAAGGTGGAGGAGGG + Intergenic
1183961341 22:41413610-41413632 GAGGAGAAAAAGGAGGAGGAGGG + Intergenic
1184131466 22:42519300-42519322 CAGGGGCAAGAGGAGAAGGAGGG + Intronic
1184141692 22:42581516-42581538 CAGGGGCAAGAGGAGAAGGAGGG + Intergenic
1184278857 22:43426047-43426069 ATGGGGATAAAGGAGGAGGGGGG - Intronic
1184306806 22:43608707-43608729 AAGGTGATTAAGGAGGTGGATGG - Intronic
1184420981 22:44382788-44382810 CAGGGGGTGGAGGAGCAGGAGGG - Intergenic
1184437607 22:44488927-44488949 CAGGGGAGAAAGGGGAGGGAGGG + Intergenic
1184449718 22:44575775-44575797 AAGGGGAAAGAAGAGGAGGAGGG + Intergenic
1184449778 22:44576025-44576047 GAGGGGGAAAAAGAGGAGGAGGG + Intergenic
1184455432 22:44607278-44607300 ATGGGGATGGAGGAGGAGGAGGG + Intergenic
1184652596 22:45925962-45925984 CAGGGGAGGGAGGAGGGGGAGGG - Intronic
1184738808 22:46415102-46415124 CAGGAGCTCAGGGAGGAGGATGG + Intronic
1185361940 22:50413673-50413695 AAGGGGAAGAAGGAAGAGGAGGG - Intronic
949702589 3:6776301-6776323 CAGGGGGTAGAGGGGGAGCAGGG - Intronic
949976976 3:9469981-9470003 GAAGGGAAAAAGGTGGAGGAAGG - Intronic
950298393 3:11851912-11851934 CTGGGACTAAAGGATGAGGAAGG - Intergenic
950453398 3:13078447-13078469 GAGGGGAGAAAGGAGGGGTATGG - Intergenic
951269539 3:20607941-20607963 CAGGGGGTAAAACAGGGGGAAGG + Intergenic
951558556 3:23945012-23945034 GAGAGGAAAGAGGAGGAGGAGGG + Intronic
952397918 3:32937566-32937588 CAGGGGCTAAAGGAGGCTGGGGG + Intergenic
952439730 3:33313685-33313707 CAGGAGGTAAGGCAGGAGGATGG - Intronic
952447908 3:33401017-33401039 CTGGGGAGAAAGGAGAAAGAAGG + Intronic
952887786 3:38022150-38022172 CCTGGGAGAAAGGTGGAGGAAGG - Intronic
953023524 3:39131140-39131162 TGGGGGCTGAAGGAGGAGGAAGG + Intronic
953926328 3:46984490-46984512 CATGGGATGAAGCAGGAAGATGG - Intronic
954354438 3:50073142-50073164 CAGGGGATAAAGGAGGAGGATGG - Intronic
954432945 3:50480907-50480929 AAGGGGAGGAAGGGGGAGGAAGG + Intronic
954752192 3:52819920-52819942 CAGGTGACAAAGTAGGAGGTGGG - Exonic
955670234 3:61394384-61394406 GAGGGGGAAAAGGAGGGGGAGGG + Intergenic
956201787 3:66713971-66713993 CAGTGGGGAAATGAGGAGGATGG - Intergenic
956302228 3:67784631-67784653 CAGGGGAAGAATTAGGAGGATGG + Intergenic
956492285 3:69785892-69785914 CCGTGGATGAAGGAGGAAGAGGG + Intronic
957018991 3:75102179-75102201 CAGGGGATAAAGGAGGGGTGGGG + Intergenic
957100353 3:75819062-75819084 CAGGTGGTGAGGGAGGAGGAGGG - Intergenic
957225163 3:77433851-77433873 CAGGGGATAAGGGAAAGGGAAGG - Intronic
957314500 3:78559869-78559891 CATGGAATAAAGGAGCAAGAAGG + Intergenic
957764872 3:84610526-84610548 AAGGGGAAAAAGAAGGAAGAGGG + Intergenic
957947801 3:87087304-87087326 CAGGGGATGAAGGGGGCGCAGGG + Intergenic
958182991 3:90083923-90083945 AGGGGGATACAAGAGGAGGATGG - Intergenic
958963036 3:100528504-100528526 CAAGGGACAGAGGAGGAGGCAGG + Intronic
959129739 3:102339859-102339881 CAGTGGTCAAAGGAGGAGCAAGG - Intronic
959731676 3:109610935-109610957 CAGCAGCTAGAGGAGGAGGATGG + Intergenic
960202455 3:114853560-114853582 CAGGGGTTTAAGGACAAGGACGG - Intronic
960315210 3:116167950-116167972 CAGGGGATGAAAGAAAAGGAAGG + Intronic
960954536 3:123022615-123022637 CAGGAGAGAAAGCAGAAGGAGGG - Intronic
961014072 3:123454036-123454058 CTGGGGGCAGAGGAGGAGGAGGG - Intergenic
961122628 3:124385678-124385700 AAGTGGAGAAAGGAGAAGGAAGG + Intronic
961168722 3:124780778-124780800 GAGGGGAAGAGGGAGGAGGAGGG - Intronic
961428561 3:126864348-126864370 GTGGTGATGAAGGAGGAGGAGGG - Intronic
961612103 3:128148083-128148105 CAGAGGTTAAAGGTGTAGGAGGG + Intronic
961940938 3:130636896-130636918 GAGGGGAGGAAGGGGGAGGAAGG - Intronic
962072168 3:132044614-132044636 GAGGGGATGAAGGGGGAGGGAGG + Intronic
962308763 3:134311481-134311503 CAGAGGCTGAAGCAGGAGGATGG + Intergenic
962408865 3:135123900-135123922 AAGAGGATAAAGGTGGAAGAAGG - Intronic
962731823 3:138290426-138290448 CAAGGGGTACAGGAGGAGTAGGG + Intronic
962932087 3:140048070-140048092 GAGGGGAGAAAGGAGGAGGAAGG + Intronic
963112223 3:141697135-141697157 CAGGTGCTAAAGGACCAGGAGGG + Intergenic
963121446 3:141780292-141780314 GAGATGATAAAGGAGGAGGTGGG - Intronic
963482901 3:145899435-145899457 CAGGGGCTAGAAGAGGAGGGGGG - Intergenic
963837015 3:150067977-150067999 TTGGGGGTAAAGGAGAAGGAGGG + Intergenic
964205594 3:154171525-154171547 CAGGGGCTTAAGGAGAGGGAGGG - Intronic
964236450 3:154535971-154535993 AAGAAGATAAAGGAGGAAGAGGG - Intergenic
964304718 3:155327583-155327605 CAGGGGACCAGGGAGCAGGAGGG - Intergenic
964473515 3:157078222-157078244 TAAGGGATAAAGGTGGAAGAGGG - Intergenic
964907056 3:161729567-161729589 CAGGGGATGAGGGAGAAGGGGGG + Intergenic
965338556 3:167457928-167457950 TGGGGGATAAATGAGGAAGAGGG + Intronic
966318755 3:178677583-178677605 CAGGGGTTTTAGGAGGAGGCTGG - Intronic
966767747 3:183478308-183478330 TAGGAGACAAAGCAGGAGGAGGG - Intergenic
966908524 3:184544619-184544641 GAGGGGGAGAAGGAGGAGGAGGG - Intronic
967826573 3:193882079-193882101 CCGGGAACAAAGGAGAAGGATGG - Intergenic
968009222 3:195262323-195262345 CAGGGGAGACAGGAGGACGGAGG + Intronic
968084830 3:195869587-195869609 CAGAGGACAAAGGAGGGAGACGG + Intronic
968257306 3:197287622-197287644 AAAAGGAAAAAGGAGGAGGAAGG + Intronic
968542043 4:1172707-1172729 CGTGGGAGAAAGGAGGAGAAGGG + Intronic
968689859 4:1984825-1984847 CTGGGGATGTAGGAGGAGGCGGG + Exonic
968744438 4:2352393-2352415 AAGGGGAGATAGGAGGAGGGAGG + Intronic
969454452 4:7293339-7293361 CAGGGGACAAAGGTGGTGGCTGG - Intronic
969561194 4:7949531-7949553 AAGGGGAAAGAGGAAGAGGAAGG - Intergenic
969568816 4:7996026-7996048 CTGGGCATGAAGGAGGAGGAAGG - Intronic
969682485 4:8651025-8651047 CAGGAGAAAAAGGCAGAGGAAGG + Intergenic
969692899 4:8715435-8715457 CAGAAAATAGAGGAGGAGGAAGG - Intergenic
970550957 4:17180631-17180653 AAGAGGGTAGAGGAGGAGGAAGG + Intergenic
971075895 4:23149048-23149070 CAGATGATATAGGTGGAGGATGG - Intergenic
972127619 4:35789218-35789240 CAGGGGAGAGAGGAGGGGAAGGG + Intergenic
972299332 4:37770439-37770461 CAGGGGAGAAGGGAGGAGAGAGG - Intergenic
972446615 4:39150415-39150437 CAGGGGATGGAGAGGGAGGAAGG + Intergenic
972511364 4:39770914-39770936 GAGGGGATAGAGGAGGTGGGGGG + Intronic
973774948 4:54233728-54233750 CAGGGGAGTGTGGAGGAGGACGG + Intronic
973981932 4:56314703-56314725 CTGGGGGAAGAGGAGGAGGAGGG + Exonic
974145541 4:57943120-57943142 ATGGGGATGAAGGAGGAGAAGGG + Intergenic
974235939 4:59180862-59180884 AAGGGGATCATGGAGGATGAGGG - Intergenic
974451122 4:62061613-62061635 CAGGGGTGAAAGATGGAGGATGG - Intronic
974662377 4:64908965-64908987 CTAGGGATTAAGGAGAAGGAAGG - Intergenic
975099936 4:70501229-70501251 CAGGGGCTTAAGGAGAAGGGTGG + Intergenic
975786966 4:77900990-77901012 TAGGGGGTAAGGGAGGGGGAAGG + Intronic
975967592 4:79993352-79993374 GAGAGAATAAAGAAGGAGGAAGG + Intronic
976132299 4:81897551-81897573 AAGGGGGGAGAGGAGGAGGAAGG - Intronic
976784703 4:88804959-88804981 CAGGGAATAAAGGAGGGTTAAGG - Intronic
976802347 4:89006798-89006820 CAGGGGATGGTGCAGGAGGAAGG + Intronic
977535185 4:98249238-98249260 CAGGTGGTTAAGGAGGAGTAGGG - Intergenic
977536621 4:98261579-98261601 CAGGCGATGACGGCGGAGGAAGG - Intronic
977937271 4:102821427-102821449 CAGGGAATAAATGAGGAAGATGG - Intronic
978591708 4:110330801-110330823 CAGGAGACAAAGGGGGAGAAGGG - Intergenic
978630838 4:110742421-110742443 CAGGGAATAAGAGAGAAGGAAGG - Intergenic
978655557 4:111061676-111061698 CTGGGGACAAAGAATGAGGATGG + Intergenic
978835616 4:113146012-113146034 TAGGCCACAAAGGAGGAGGAAGG + Intronic
978838602 4:113183221-113183243 GAGGGGATGGAGGTGGAGGAGGG + Intronic
980113649 4:128658731-128658753 GAGGGGAGAAGGGAGAAGGAGGG + Intergenic
980463754 4:133149321-133149343 CAGAGGCTGAAGCAGGAGGAAGG + Exonic
981918095 4:150056878-150056900 GAGGGGGTAGAGGAAGAGGAAGG - Intergenic
981961269 4:150542183-150542205 CAGAGGATAGGGGAGGAGCAAGG - Intronic
982010631 4:151102629-151102651 GAGGGTAGAAAGGAGGAGGGAGG + Intronic
982174048 4:152688740-152688762 CAGGGCACGGAGGAGGAGGAGGG + Intronic
982317736 4:154048309-154048331 CAAAGGATACAGGAGGAGGGTGG + Intergenic
982913539 4:161175905-161175927 AAGTGGATGAAGGGGGAGGAGGG + Intergenic
983477927 4:168238480-168238502 AAGGGGAGAAAGGAAGAGGAAGG + Intronic
984637885 4:182133019-182133041 CAGGCGAGTCAGGAGGAGGAGGG + Intergenic
984703495 4:182833193-182833215 GAGGGGAGAGAGAAGGAGGAGGG - Intergenic
984960290 4:185090712-185090734 CAGGGCATCAAGTAGAAGGAAGG + Intergenic
984985960 4:185329704-185329726 GAGAGGATGAGGGAGGAGGAGGG + Intronic
985057936 4:186051311-186051333 CAGGGAAGACAGGAAGAGGAGGG - Intergenic
985280570 4:188282653-188282675 CCGGGGATAGGGAAGGAGGAAGG - Intergenic
985563129 5:601976-601998 CAGGGAGCAAAGGAGGCGGAGGG - Intergenic
986039085 5:3969476-3969498 CAGGGGAGACAGTAGGAGGCAGG + Intergenic
986427071 5:7644267-7644289 GAGGAAATCAAGGAGGAGGATGG - Intronic
986494061 5:8323785-8323807 CAGGGGAGGAAGTAGAAGGAAGG + Intergenic
986827023 5:11532881-11532903 CAGGAGAAAAAGAAGGAGGGAGG + Intronic
986858820 5:11903744-11903766 CAGCGGCAAGAGGAGGAGGACGG + Intronic
987032876 5:13991569-13991591 GAGGAGAAAGAGGAGGAGGAGGG + Intergenic
987032882 5:13991587-13991609 GAGGGGGAAGAGGAGGAGGAAGG + Intergenic
987165677 5:15195478-15195500 CAGAAGGTGAAGGAGGAGGAAGG + Intergenic
987310289 5:16675232-16675254 AAAGGAATAAATGAGGAGGACGG + Intronic
987616169 5:20276939-20276961 AAGGGGAGGAAGGAGTAGGAAGG + Intronic
988232057 5:28492026-28492048 CAGGGCAAAAGGTAGGAGGAGGG + Intergenic
988922205 5:35953945-35953967 AAAGGGAGAAAGGAGGAGGCAGG + Exonic
988927857 5:36007190-36007212 CAGGGGATGAAGGCCTAGGAGGG - Intergenic
989352109 5:40498445-40498467 CAGGGGATAAGTGAGGTGGTGGG - Intergenic
990317953 5:54601801-54601823 CAGGTGAGAAATGAGGAAGAAGG - Intergenic
990616219 5:57511204-57511226 GAGTGGTGAAAGGAGGAGGAAGG + Intergenic
991696826 5:69280904-69280926 CAGGGGCTGAGGCAGGAGGATGG - Exonic
991957711 5:72012437-72012459 CATGGGTTAGAGGAGGAAGAGGG - Intergenic
993038702 5:82787481-82787503 CAGAGTAAAAAGGTGGAGGAAGG + Intergenic
993064024 5:83076700-83076722 CTGGAGGTAAAAGAGGAGGAAGG + Intronic
993387623 5:87278869-87278891 CAGGGAATAAGGAAAGAGGAAGG - Intronic
993491205 5:88552260-88552282 CAGGGGAGAAGGGAGGGTGATGG - Intergenic
994100319 5:95884229-95884251 GAAGGAATAATGGAGGAGGAAGG - Intergenic
994470317 5:100195622-100195644 CATGGAATAAAAGAGAAGGAGGG - Intergenic
994643392 5:102438404-102438426 AATGGGATAAAGGAGGAACACGG + Intronic
994976780 5:106818379-106818401 CAGGTAAAGAAGGAGGAGGAAGG - Intergenic
995109627 5:108414475-108414497 AAGGGGAAAAGGGAGGGGGATGG - Intergenic
995291588 5:110462500-110462522 CACGGGAGAAAGGAGGAGGCTGG - Intronic
995443801 5:112220781-112220803 CAGGGGAAAAAGGAGGAAGAAGG - Intronic
995488019 5:112658547-112658569 AAGGGGGTAAAGGAAGACGAAGG + Intergenic
995906791 5:117134365-117134387 CTGGGGAAAAAGGATCAGGAGGG + Intergenic
997240166 5:132301047-132301069 CTGAGGCTAAAGGAGCAGGAAGG + Intronic
997331614 5:133067175-133067197 CATGGGATATAGGAAGAGCAGGG + Intronic
997444893 5:133933751-133933773 AAGTGGATAGAGAAGGAGGAGGG - Intergenic
997791442 5:136766002-136766024 AAGGGGAGGAAGCAGGAGGATGG - Intergenic
998199428 5:140107864-140107886 CAGGGGAAGGAGGAGGAGGAGGG + Intronic
998391282 5:141788536-141788558 TAGGAGAAAAAGGAGGAGGTGGG - Intergenic
998407579 5:141882816-141882838 GAGGGGAGACAGGAGCAGGAAGG + Intergenic
998756625 5:145388077-145388099 CAAGAGATAAAGGATGAGGATGG + Intergenic
999126735 5:149251568-149251590 CAGGGGAAAAGGGAGGGGGTGGG - Intronic
999231488 5:150064744-150064766 GAGGGGATCAAGGAGGATGGAGG + Intronic
999258185 5:150221559-150221581 CAGGGCAGAGAGGAGGAGGGAGG - Intronic
999309360 5:150541829-150541851 GAGGGGAAAGAGGTGGAGGAGGG + Intronic
999316699 5:150588671-150588693 CAGGGGAGAGAAGAGGAGGCTGG + Intergenic
999361892 5:150992540-150992562 CCGGAGCTGAAGGAGGAGGAGGG + Intergenic
999629096 5:153551732-153551754 CAGGGGTTCAGGGAGGAGGATGG - Intronic
1000091068 5:157930100-157930122 GAGGGGAAGAAGGGGGAGGAAGG + Intergenic
1000240839 5:159406678-159406700 CTGGGGATAGAGTAGGAGCACGG - Intergenic
1000371660 5:160542360-160542382 AAGGGGATTAAGGAAGAGAAAGG - Intergenic
1000844175 5:166258314-166258336 CTGCAGTTAAAGGAGGAGGAAGG + Intergenic
1001545982 5:172570805-172570827 GAGGGGAAAAGGAAGGAGGAAGG + Intergenic
1001646692 5:173287353-173287375 CAAAGCATAAAGGAGGTGGAGGG + Intergenic
1001949448 5:175806054-175806076 CAGGGGCTCAAGGATGAGAAAGG - Intronic
1001971246 5:175956611-175956633 CAGCGGGTGAAGGAGGAGGGGGG - Intronic
1002075841 5:176707883-176707905 CAGGAACTAAGGGAGGAGGAGGG + Intergenic
1002102327 5:176863719-176863741 GAGGGGGAAAAGGGGGAGGAGGG - Intronic
1002102353 5:176863772-176863794 AAGGGGGTAAAGAAGGAGGAGGG - Intronic
1002209050 5:177585099-177585121 CAGAGAAAGAAGGAGGAGGAAGG + Intergenic
1002246196 5:177887166-177887188 CAGCGGGTGAAGGAGGAGGGGGG + Intergenic
1003020431 6:2504832-2504854 GAGGAGATGAAGGATGAGGAGGG - Intergenic
1003020438 6:2504868-2504890 GAGGAGATGAAGGATGAGGAGGG - Intergenic
1003400300 6:5785150-5785172 CAGAGGATACAGCAGGAGAAGGG + Intergenic
1003495263 6:6658038-6658060 CAAGGGGTAAAGGGAGAGGAAGG + Intergenic
1004278498 6:14258882-14258904 GAGGAGAAAGAGGAGGAGGAGGG + Intergenic
1004973418 6:20937191-20937213 CAGGAGCTGAAGTAGGAGGATGG - Intronic
1005039531 6:21588499-21588521 CAGGGGATGGGGTAGGAGGACGG + Intergenic
1005631697 6:27714098-27714120 CAGCTTATAAAGGATGAGGATGG + Intergenic
1005646919 6:27848265-27848287 TAGGAGAAAAAGCAGGAGGAGGG - Intronic
1005912931 6:30326785-30326807 CTGCGGAAGAAGGAGGAGGAGGG - Intronic
1006030695 6:31174692-31174714 CAAGAGATATAGGAGGAGGCCGG + Intronic
1006174267 6:32112481-32112503 GTGGGGAGAAGGGAGGAGGAAGG + Intronic
1006520856 6:34570342-34570364 GAGGGGGTGAAGGAGGAGGGTGG - Intergenic
1006980886 6:38146773-38146795 GAAGGGATAAAGGAGGATAAGGG - Intronic
1007221823 6:40284687-40284709 CAGAGCAGAAAGGAGAAGGAAGG - Intergenic
1007476287 6:42122059-42122081 CAGTTTATAAAGGAGAAGGATGG + Intronic
1007590953 6:43020800-43020822 CAGGGGTCAAAGGAGCAGGTGGG - Exonic
1007667915 6:43526840-43526862 CAGGTGAGGAAGGAGGAAGATGG + Intronic
1007712749 6:43835035-43835057 CAGGGGACAATGGAGGAGGTAGG + Intergenic
1008271181 6:49491958-49491980 CAGTGGTGAAAGGAGCAGGATGG + Intronic
1008651606 6:53569588-53569610 CAGGGGTTAATGGAGGAGCTGGG + Intronic
1008759169 6:54833473-54833495 GAGGGGGAAAAGGAGGAGGAGGG + Intergenic
1008863216 6:56176864-56176886 AAGGGGAGGAAAGAGGAGGAAGG + Intronic
1008863233 6:56176903-56176925 AAGGGGAGGAAGGGGGAGGAAGG + Intronic
1009488376 6:64254614-64254636 CAGGGAACAAAGCAAGAGGAAGG - Intronic
1009593738 6:65708771-65708793 AATGGGGAAAAGGAGGAGGAAGG - Intergenic
1010117595 6:72333003-72333025 GAGGGGACAAGGAAGGAGGAGGG + Intronic
1010828631 6:80503527-80503549 CAGAGGACAAAGGAGGTGCAGGG - Intergenic
1011247875 6:85338984-85339006 CAGAGGATAGAGGTGGAGGTGGG + Intergenic
1011816446 6:91196933-91196955 CAGTGGTTAAAAGAGGCGGAAGG + Intergenic
1011868473 6:91861837-91861859 CAGAGGCTAAGGGGGGAGGACGG + Intergenic
1012061127 6:94482695-94482717 CCGGGGATAAAAGAGCAGGAGGG - Intergenic
1012140007 6:95614874-95614896 CAGGGAAAAGAGAAGGAGGAGGG - Intergenic
1012460894 6:99458785-99458807 CAGAGGCTACAGGAGGAGAATGG + Intronic
1012961902 6:105630967-105630989 GAGGAGATAAAGAAGGAGGGAGG + Intergenic
1013926037 6:115473689-115473711 CAGGGGTGGGAGGAGGAGGAAGG + Intergenic
1014743208 6:125169881-125169903 CAGGAAATAAAAGAGGAAGAAGG - Intronic
1014813041 6:125906666-125906688 CTGGGGAGAGAGGAGGAAGAGGG + Intronic
1015389922 6:132670105-132670127 GAGGGGAGGAAGGAAGAGGAGGG + Intergenic
1015561922 6:134525274-134525296 AAGGAGAAAGAGGAGGAGGAGGG + Intergenic
1016120507 6:140337437-140337459 CAGGTGATTCTGGAGGAGGAAGG - Intergenic
1016143762 6:140644898-140644920 CAGAAGGTAAAGGAGGAGTAAGG + Intergenic
1016874246 6:148849059-148849081 CAGAACAAAAAGGAGGAGGAAGG - Intronic
1017124474 6:151052460-151052482 CAAGGGATACAGAAGAAGGATGG + Intronic
1017469576 6:154726411-154726433 CAGAGGGTAAAGGAGGAGCCAGG + Intergenic
1017593715 6:156006007-156006029 AGAGAGATAAAGGAGGAGGAGGG + Intergenic
1017871163 6:158487892-158487914 CTGGGGTTAAAGCAGGAGGCAGG + Intronic
1017956836 6:159185654-159185676 CAAGGGGTAAAAAAGGAGGAAGG + Intronic
1018341885 6:162859543-162859565 CAGGGGAGAAAGGAAGATGAAGG - Intronic
1018429837 6:163713893-163713915 TAGGGTATAATGGAGGAGTACGG + Intergenic
1018596102 6:165482344-165482366 CTGGGGATAGAGAAGGAAGAGGG + Intronic
1018789355 6:167134751-167134773 CAGGGAAAAGAGGAGGAAGATGG + Intronic
1019419063 7:942323-942345 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419076 7:942378-942400 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419081 7:942396-942418 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419086 7:942414-942436 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419091 7:942432-942454 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419096 7:942450-942472 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419112 7:942509-942531 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419127 7:942575-942597 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419132 7:942593-942615 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419137 7:942611-942633 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419153 7:942670-942692 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419167 7:942720-942742 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419172 7:942738-942760 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419188 7:942797-942819 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419202 7:942847-942869 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419218 7:942906-942928 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419241 7:943006-943028 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419266 7:943097-943119 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419285 7:943181-943203 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419298 7:943233-943255 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419308 7:943267-943289 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419317 7:943303-943325 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419322 7:943321-943343 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419338 7:943380-943402 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419375 7:943523-943545 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419393 7:943588-943610 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419398 7:943606-943628 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419403 7:943624-943646 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419440 7:943767-943789 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419454 7:943817-943839 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1020080033 7:5282226-5282248 AGGGGGAGAAAAGAGGAGGATGG + Intronic
1020254165 7:6492773-6492795 TAGAGGAGGAAGGAGGAGGAGGG + Intergenic
1021028173 7:15695319-15695341 CAGGGGGAAAAAGAGGTGGAGGG + Intergenic
1021171128 7:17399097-17399119 GAGGGGCTAAAGTGGGAGGATGG - Intergenic
1021559469 7:21955510-21955532 CAGGGGTTAAGGAAGGAGGAAGG - Intergenic
1021600974 7:22362829-22362851 CAGGGGATAGAGGAGTAGCAGGG + Intergenic
1021601050 7:22363738-22363760 CAGGGAATAGAGGAGTAGCAGGG + Intergenic
1022095337 7:27137246-27137268 CAGGGGAAAGAGCAGGAGAAAGG + Intronic
1022360866 7:29655888-29655910 CAGGGGCTGAAGCAGGAGAATGG + Intergenic
1022437161 7:30399310-30399332 CAGAGGCTGGAGGAGGAGGAGGG + Intronic
1022658155 7:32340158-32340180 GAGGGGATCAGGGAGCAGGATGG + Intergenic
1023057206 7:36299971-36299993 CAGGGGATGAAGGAGGGGCTGGG - Exonic
1023156458 7:37256757-37256779 GAAGGGAGAAGGGAGGAGGAAGG + Intronic
1023737625 7:43248766-43248788 GAGGGGAAACAGGAGGAGAACGG - Intronic
1024019547 7:45353358-45353380 CAGGGGAGGGAAGAGGAGGAAGG + Intergenic
1024499731 7:50092328-50092350 TAGGGGATAGGGGAGGAGAAAGG - Intronic
1024966331 7:55025280-55025302 CAGAGGATGAAGCAGGAGCAAGG + Intronic
1025198883 7:56949990-56950012 AGGGGGAGAAAAGAGGAGGATGG - Intergenic
1025673063 7:63626943-63626965 AGGGGGAGAAAAGAGGAGGATGG + Intergenic
1025828514 7:65030445-65030467 AAGAGGAAGAAGGAGGAGGAGGG + Intergenic
1025873098 7:65453344-65453366 CAGGGGAAAATGGAGTAGAAGGG + Intergenic
1026136025 7:67661555-67661577 CAGGTGATGGAGGAGAAGGATGG - Intergenic
1026291934 7:69015083-69015105 CAGGGGAGAAAGGTGGGAGAAGG - Intergenic
1026806125 7:73430450-73430472 AAGGGGATGGAGGGGGAGGAGGG - Intergenic
1026935172 7:74250599-74250621 CTGGAGACGAAGGAGGAGGATGG - Intronic
1027224478 7:76235277-76235299 CAGGAGATGATGGAGGAGCAGGG + Exonic
1027448615 7:78303407-78303429 CAGATGATTCAGGAGGAGGAGGG - Intronic
1027489223 7:78801843-78801865 CAATAGATAAAGGAGGAGAAGGG - Intronic
1027727962 7:81830955-81830977 TAGGGGGTAAAGGAGTATGAAGG + Intergenic
1027987736 7:85315909-85315931 GAGGGGATAAATGGGGAGGAAGG - Intergenic
1028308683 7:89300853-89300875 CAGTGGATAGAAGTGGAGGAGGG + Intronic
1028382161 7:90211828-90211850 CAGGGGAGAAGGAAGGAGGGAGG - Exonic
1028761966 7:94507260-94507282 AAGTAGATAAAGGAGAAGGAAGG + Intergenic
1029147394 7:98456570-98456592 GAGGGGCTCAGGGAGGAGGAGGG + Intergenic
1029306908 7:99626273-99626295 CAGAGGAGTAAGGAGGAGGCAGG + Intronic
1029552929 7:101247571-101247593 CAGGGGACACAGGAAGATGAAGG + Intronic
1029590715 7:101505048-101505070 CAGAGGCTGAGGGAGGAGGATGG + Intronic
1029644550 7:101845546-101845568 GAGGGAATAGAGGAGGAGGCTGG + Intronic
1029653973 7:101912244-101912266 ATGGAGATAGAGGAGGAGGAGGG - Intronic
1029705633 7:102274329-102274351 CATGGGAGGAGGGAGGAGGAGGG + Intronic
1029995135 7:105000530-105000552 GATGGAAAAAAGGAGGAGGATGG + Intergenic
1030454982 7:109761283-109761305 CTGGGGCTGAAGTAGGAGGAAGG - Intergenic
1030583093 7:111384289-111384311 GAGAGGAGAAAGGAGGAGGAGGG + Intronic
1030894226 7:115037615-115037637 CAGTGGGGAAAGGAGGAGGGTGG + Intergenic
1030982264 7:116200122-116200144 CAGGGGACAATGGATAAGGAAGG + Intergenic
1031472790 7:122187158-122187180 GAGGGGATAAAGGGGGAGGTGGG + Intergenic
1031630166 7:124034298-124034320 AAGGAGATAAAGAGGGAGGAAGG - Intergenic
1031923508 7:127618174-127618196 CAGAGGAGAGAGGAGGAGGGAGG + Intergenic
1031978324 7:128107741-128107763 CAGGGGATGAGGGAGCAGTATGG - Intergenic
1031984184 7:128152254-128152276 TTGGGGTTGAAGGAGGAGGAAGG - Intergenic
1032034807 7:128513905-128513927 GAGAGGAAAAAGGAGGAAGAAGG - Intergenic
1032092898 7:128920533-128920555 CAGGGGATGAGGGGGCAGGAGGG + Intergenic
1032479760 7:132236857-132236879 CAGGAGAGAAAGGAGAAGGCTGG - Intronic
1032702497 7:134394914-134394936 CAAAGGATTGAGGAGGAGGAAGG + Intergenic
1033366161 7:140673665-140673687 GAGGGGGTAGAGGAGTAGGAGGG - Exonic
1033454645 7:141491862-141491884 CAGGGGAGAGATGAGGAGGCAGG - Intergenic
1033463169 7:141565680-141565702 CAGGGAATGAAGGAGGATAAAGG - Intronic
1033586910 7:142780807-142780829 AAGCGGAGACAGGAGGAGGATGG - Intergenic
1033669623 7:143478585-143478607 CAGAGCATAAAGAATGAGGAAGG - Exonic
1034271145 7:149803916-149803938 CAGGGGATGAAGGATGAAGAAGG + Intergenic
1034277269 7:149829401-149829423 AGGGGGACACAGGAGGAGGAGGG - Intergenic
1034358530 7:150473650-150473672 CAGGGGCTAAGGCAGGAGCAGGG - Intronic
1034447054 7:151119096-151119118 TGTGGGAAAAAGGAGGAGGAGGG + Intronic
1034702873 7:153111437-153111459 CAGGGGACAGAGGAGGCGCAGGG + Intergenic
1034738003 7:153446804-153446826 CAGGGAATAAAACAGAAGGAAGG - Intergenic
1035458607 7:159025319-159025341 CAAGGGAGAGATGAGGAGGAGGG - Intergenic
1035517795 8:251268-251290 CAGGGAATAGTGGTGGAGGAGGG + Intergenic
1036229389 8:6986496-6986518 GAGGGGATAAGGGATGAGGCCGG - Intergenic
1036231840 8:7005599-7005621 GAGGGGATAAGGGATGAGGCCGG - Intronic
1036233000 8:7015167-7015189 GAGGGGATAAGGGACGAGGGAGG - Intronic
1036748655 8:11429121-11429143 CAGGGGCTGGAGGAGGGGGATGG - Intronic
1037071528 8:14656316-14656338 GGAGGGATAGAGGAGGAGGAAGG - Intronic
1037526486 8:19729735-19729757 CAGAGGATAAATGAGGGGGAAGG - Intronic
1037693887 8:21207246-21207268 AAGAGGAGAAAGGAGGAGAATGG - Intergenic
1037753234 8:21696089-21696111 GAGGGGACAGAGGAGGGGGAGGG - Intronic
1037939944 8:22943868-22943890 CAGTAGATAAAGGAGGTGGTTGG - Intronic
1037959921 8:23089211-23089233 CAGGGTAGAAAGTGGGAGGAGGG + Intronic
1038391579 8:27206977-27206999 CAGGGGAGAAAGGTGGTGGCAGG - Intergenic
1038400003 8:27277387-27277409 GAGGGGAAAAAGAAAGAGGAGGG - Intergenic
1038483747 8:27919182-27919204 GAGGGGAAAGAGGAGGAGGAGGG + Intronic
1038625944 8:29193323-29193345 GAGGAGCAAAAGGAGGAGGATGG + Intronic
1038779211 8:30556504-30556526 CAGGAGACACAGGAGGGGGAGGG - Intronic
1038922466 8:32099910-32099932 CAGTGGATGAAGGTGGAGGGGGG + Intronic
1039090972 8:33829320-33829342 AAGGGGATAAGGTGGGAGGAGGG - Intergenic
1039378273 8:37059463-37059485 CAGGGGATTGATGGGGAGGAGGG + Intergenic
1039737420 8:40347711-40347733 CAGGAGGTCAAGAAGGAGGAAGG - Intergenic
1039741442 8:40386660-40386682 CAGAGAATAAAGGACAAGGAGGG - Intergenic
1039931984 8:42001015-42001037 GAGGGAAGGAAGGAGGAGGAAGG + Intronic
1040071935 8:43195648-43195670 GAGGGGCTGGAGGAGGAGGAGGG + Intronic
1040645602 8:49392843-49392865 CAGGAGGTAAGGGAGGAGAATGG + Intergenic
1040825146 8:51612299-51612321 CAGCAGATATAGGAGGAGAAAGG + Intronic
1040987523 8:53312761-53312783 CATGGGAAAATGGAAGAGGAAGG - Intergenic
1041727575 8:61032231-61032253 CAGGGGTGACAGGAGCAGGAAGG + Intergenic
1042536115 8:69860426-69860448 AAGGGTATAAAGGTGGAGGTGGG + Intergenic
1042977156 8:74482026-74482048 ATGGGGATAAAGGAGCAGTACGG + Intronic
1043087530 8:75853352-75853374 TAGGGGATAAAGGAGGAGGTTGG + Intergenic
1043489697 8:80736690-80736712 CAGGGGAAATAGTGGGAGGAGGG + Intronic
1043545035 8:81306055-81306077 TTGGTGATAAAGGAAGAGGATGG - Intergenic
1043803542 8:84642854-84642876 CAGGAGATAAAGTAGGATGGTGG - Intronic
1044055444 8:87564254-87564276 CAGGGCATAAGGCAGGAGGCAGG - Intronic
1044169696 8:89034194-89034216 GAGGGGAGGAAGGAGGAGGAGGG + Intergenic
1045542021 8:103095549-103095571 CATGGGAGAAGGGTGGAGGAAGG + Intergenic
1045791867 8:105993031-105993053 GAGAGGAGAAAGCAGGAGGAAGG - Intergenic
1046408918 8:113813224-113813246 GAGTGAATAAATGAGGAGGATGG - Intergenic
1046731155 8:117727795-117727817 CAAGGGAAAAAGGATGAGGGAGG - Intergenic
1046823283 8:118659125-118659147 CAGGGCATGAAGTAGGTGGATGG - Intergenic
1047131286 8:122022772-122022794 GAGGGGAGAAAGGAGGAGAGAGG - Intergenic
1047153984 8:122296377-122296399 AAGGGGATAAAGGAAGGGAATGG + Intergenic
1047177644 8:122556593-122556615 AAGGGGACAAAGAAGAAGGAAGG + Intergenic
1047518689 8:125577790-125577812 AAGAAGAGAAAGGAGGAGGAAGG - Intergenic
1048846574 8:138608021-138608043 CAGGGCATCAAAGAGCAGGACGG + Intronic
1048983370 8:139715316-139715338 CAGGGCATCAGGGAGGAAGAGGG + Intergenic
1049109817 8:140635695-140635717 CGGGGGAGGAAGGAGGAGGGAGG + Intergenic
1049243495 8:141550281-141550303 CAGGTGAGCAGGGAGGAGGATGG + Intergenic
1049491724 8:142907458-142907480 TAAGGGAAAAAGGAAGAGGAGGG - Intronic
1049519277 8:143080024-143080046 GAGGGGAGAAGGGAGGAGAAGGG - Intergenic
1049554467 8:143275171-143275193 TAGGGGATGCAGGAGGAGGAGGG - Intronic
1049984997 9:942050-942072 CAGAGAATAAAGGAAGATGATGG - Intronic
1051097463 9:13483209-13483231 CATGGAAAAGAGGAGGAGGAAGG - Intergenic
1051136438 9:13927029-13927051 GAGAGGAGACAGGAGGAGGAGGG - Intergenic
1052764319 9:32625317-32625339 CAGAGGAGAAAGGAAGAGGCTGG - Intergenic
1052918204 9:33940000-33940022 GAGGGGAAAGAGGAGGGGGAGGG + Intronic
1053067354 9:35078078-35078100 CTGGAGAGAAAGGAGGAGGAAGG + Intronic
1053075215 9:35127289-35127311 CAGGGGCTCAAGGTGCAGGAGGG - Intergenic
1053158975 9:35800481-35800503 CAGGTGATGGAGGAGGAGGCAGG + Exonic
1053317495 9:37064325-37064347 CAGAGGGGAAAGGAGGAGAATGG - Intergenic
1053329341 9:37188888-37188910 GAGGGGAGAAGGGAGGGGGAGGG - Intronic
1054770240 9:69076819-69076841 CAAGGGAGAAAGGGGAAGGAGGG + Intronic
1054901158 9:70370779-70370801 GAGGGGAAAGGGGAGGAGGAGGG + Intergenic
1055053379 9:72001290-72001312 AAGGGGATGCAGAAGGAGGATGG + Intergenic
1055092221 9:72374559-72374581 CAGGGGATAGAGGGGAAAGAGGG + Intergenic
1055446984 9:76393950-76393972 AAGGGGATGCGGGAGGAGGAAGG + Intronic
1055624948 9:78166836-78166858 CAGGGAAAAAAGCAGGAAGAAGG - Intergenic
1055716407 9:79122756-79122778 AAGGAGAAGAAGGAGGAGGAGGG + Intergenic
1055752529 9:79522653-79522675 CAGGGGATATAAGAGGGAGAAGG + Intergenic
1055864785 9:80800054-80800076 CATCGGATAAAAGAAGAGGAGGG - Intergenic
1055928598 9:81536474-81536496 GAGGGCATAGAGGAGGAAGAGGG + Intergenic
1056011448 9:82335034-82335056 CAGAGGATAATGGGGGAAGAGGG - Intergenic
1056081902 9:83103742-83103764 CAGGGGTCTAAGGAAGAGGATGG - Intergenic
1056104263 9:83331433-83331455 CAGGGGTTAGGGGAGAAGGAGGG + Intronic
1056531629 9:87493156-87493178 CATGAGATGAAGGAGAAGGAAGG - Intergenic
1056868751 9:90256474-90256496 GAGGAGGTGAAGGAGGAGGAGGG + Intergenic
1057802134 9:98197085-98197107 GAGGGGAGAAAGGAGGAAGAAGG + Intergenic
1057813876 9:98279729-98279751 GAGGGAAGAAAGGAGGAGGGAGG - Intergenic
1057914016 9:99041696-99041718 AAGGGGATAGTGGAGGAGGCGGG + Intronic
1058069276 9:100585199-100585221 GAGGGAATGAAGAAGGAGGAGGG + Intronic
1058136524 9:101313820-101313842 CTGGGGATAAGGGAAAAGGAAGG - Intronic
1059489107 9:114652537-114652559 CAGGGGATACAGTATGAGAATGG + Intergenic
1059585066 9:115597163-115597185 AAGGAGAAAGAGGAGGAGGAGGG - Intergenic
1059718678 9:116937294-116937316 CAGGGAATAAGGAAGGAGGTGGG - Intronic
1059730289 9:117050450-117050472 CAGGGGAGGAAGCAGGAGTAGGG - Intronic
1059739974 9:117140635-117140657 GAGGAGGAAAAGGAGGAGGAGGG + Intronic
1059934105 9:119290640-119290662 TAGGTGATAATGGAAGAGGAGGG + Intronic
1059968999 9:119645194-119645216 GAGGAGGAAAAGGAGGAGGAGGG - Intergenic
1060055916 9:120412898-120412920 CAGGGGAGAGTGGAGGAAGATGG - Intronic
1060367531 9:123033607-123033629 GAGGAGATAAAGGAGTAGGAGGG - Intronic
1060992687 9:127857803-127857825 CAGAGGAGGCAGGAGGAGGAGGG + Intergenic
1061204814 9:129156750-129156772 CAGGAGGAAGAGGAGGAGGAGGG - Intergenic
1061967613 9:134025184-134025206 GAGGGGCTGGAGGAGGAGGAGGG - Intergenic
1061967640 9:134025266-134025288 GAGGGGCTGGAGGAGGAGGAGGG - Intergenic
1062003688 9:134229025-134229047 AAGGGGAGAAAGGAGGAAGGGGG - Intergenic
1062074738 9:134579769-134579791 AAGGGGGAAGAGGAGGAGGAGGG + Intergenic
1062074755 9:134579811-134579833 AAGGGGGAAGAGGAGGAGGAGGG + Intergenic
1062074773 9:134579854-134579876 AAGGGGGAAGAGGAGGAGGAGGG + Intergenic
1062245939 9:135566086-135566108 TGGGGGCTATAGGAGGAGGAAGG + Intronic
1062588676 9:137263357-137263379 CGGGGGAGAAGGGAGAAGGAGGG - Intronic
1185459862 X:328929-328951 AGGGGGAGAGAGGAGGAGGAGGG - Intergenic
1185603604 X:1354987-1355009 GAGGGGAGAGAGGAGGAGGGAGG + Intronic
1185608452 X:1380480-1380502 GAGGGGGGAAAGGAGGGGGAAGG + Intronic
1185688279 X:1948314-1948336 GAGGGGAGACAGGAGGAGGAGGG + Intergenic
1185688287 X:1948332-1948354 GAGGGGAGAGGGGAGGAGGAGGG + Intergenic
1185688295 X:1948350-1948372 GAGGGGAGAGGGGAGGAGGAGGG + Intergenic
1185688310 X:1948386-1948408 GAGGGGAGAGGGGAGGAGGAGGG + Intergenic
1185688580 X:2133890-2133912 GAGGGGAGACAGGAGGAGGAGGG + Intergenic
1185688588 X:2133908-2133930 GAGGGGAGAGGGGAGGAGGAGGG + Intergenic
1185834040 X:3328859-3328881 CAGGAGAGAAGGCAGGAGGAAGG + Intronic
1186239965 X:7555307-7555329 GAAGGGAGGAAGGAGGAGGAAGG + Intergenic
1186425411 X:9460956-9460978 CAGGGGTTCAAGGAGGAAGAAGG - Intergenic
1186731576 X:12416185-12416207 AAGGGAAGAAAGGAGGAGGAAGG - Intronic
1186899998 X:14043836-14043858 CAGGGGAGAAAGGAAGGAGAGGG + Intergenic
1187056230 X:15743748-15743770 CAGGGGATGCAGCAGGAGGTGGG - Intronic
1187163971 X:16787359-16787381 GAGGGGAAAAAAGAGGAGGGTGG - Intronic
1187188390 X:17009768-17009790 GAGGGTTTAAAGGATGAGGATGG - Intronic
1187783543 X:22857351-22857373 AAGGGGAGAAAAGAGGGGGAGGG - Intergenic
1189083082 X:37994760-37994782 GAGGAGAAGAAGGAGGAGGAAGG + Intronic
1189242005 X:39532565-39532587 TGGGGGAGAAGGGAGGAGGAAGG + Intergenic
1189454803 X:41176260-41176282 CAGACCATGAAGGAGGAGGAGGG - Intronic
1189497130 X:41518953-41518975 CAAGGGATACAGCAAGAGGAAGG + Intronic
1189514942 X:41704028-41704050 TAGGGGAAAAGGGAGGGGGAGGG - Intronic
1189898617 X:45682607-45682629 CTGAGGATAGAGGTGGAGGATGG - Intergenic
1189930759 X:46006717-46006739 CAGTTGATAAAGTAGGAGCAGGG - Intergenic
1190002726 X:46705155-46705177 CAGGGGAGAAAGGGGAAGGGTGG + Intronic
1190044390 X:47100627-47100649 CAGGGGAGAAAGGAGAAGAGAGG + Intergenic
1190360005 X:49639870-49639892 CAGAGGATAAAGGACGATAAAGG - Intergenic
1191006218 X:55714100-55714122 AAGAGGAAAAAGGAGGAAGAGGG - Intergenic
1191764488 X:64682365-64682387 CAGGGGACACAGGAGGAAGGGGG + Intergenic
1192073223 X:67962673-67962695 AAGGGGAGAAAAGAGTAGGAAGG + Intergenic
1192218390 X:69179817-69179839 CAGGGGAGAGAGGAGAAGGGGGG - Intergenic
1192398147 X:70805695-70805717 CAGGAGATTATGGAGGAGGCTGG - Intronic
1192738901 X:73874670-73874692 CAGGGAAGAAATGAGGAGGGAGG + Intergenic
1193819416 X:86144083-86144105 GAGGGGAGAAGGGAGGCGGAGGG + Intergenic
1194257454 X:91652407-91652429 AAGGGGAGAAAAGAGCAGGAAGG - Intergenic
1194596245 X:95862151-95862173 GAGGGTATCAAGCAGGAGGAAGG + Intergenic
1194806304 X:98332443-98332465 TAGGGGGCAGAGGAGGAGGAGGG + Intergenic
1195430048 X:104779013-104779035 GAGGGCATAAAGGAAGAGAAGGG - Intronic
1196237531 X:113299952-113299974 GAGGGGAGATAGGAGGGGGAGGG - Intergenic
1196392785 X:115226123-115226145 CAAGAGAAAAAGGAGGAGGGGGG + Intronic
1196485540 X:116203085-116203107 AAGGGGAGAAAAGAGTAGGAAGG - Intergenic
1196569512 X:117249065-117249087 CAAGGGAAATAGGAGGTGGAGGG - Intergenic
1196750450 X:119112141-119112163 CAGAGGATAAAGGGGAAGCAAGG - Intronic
1196834516 X:119802066-119802088 AAAGAGAAAAAGGAGGAGGAAGG - Intergenic
1197384079 X:125782274-125782296 TAGGGAATAAGGGAGAAGGAAGG - Intergenic
1197436508 X:126434838-126434860 GAGGAGATAGAGGAGGGGGAAGG + Intergenic
1197753342 X:129980231-129980253 GAGGGGAAGGAGGAGGAGGAAGG - Intergenic
1197936773 X:131747636-131747658 CAGGGGATAAATTCGGTGGATGG + Intergenic
1198015939 X:132610970-132610992 CAGGGGAAGAAAGAAGAGGAGGG + Intergenic
1199185252 X:144909042-144909064 CAGGGGGTCAAGGTGCAGGAGGG - Intergenic
1199280758 X:145996775-145996797 CAGGGGACAATGGTGGGGGATGG - Intergenic
1200374707 X:155767564-155767586 GAGGAGGTAAAGGAGGAAGAAGG + Intergenic
1200576112 Y:4891353-4891375 AAGGGGAGAAAAGAGCAGGAAGG - Intergenic
1201382097 Y:13392058-13392080 CAGGGGCTGAAGAGGGAGGATGG + Intronic
1201471155 Y:14336290-14336312 CAGAGGACAAAGGAGGAGAAAGG - Intergenic
1201637791 Y:16144488-16144510 GACGAGATAGAGGAGGAGGAGGG + Intergenic
1201701079 Y:16882896-16882918 GAGGGAAAAAAGGAGAAGGAAGG + Intergenic
1201755641 Y:17483224-17483246 AATGGGATAAAGCAGGAGAAAGG - Intergenic
1201845911 Y:18422761-18422783 AATGGGATAAAGCAGGAGAAAGG + Intergenic