ID: 954357855

View in Genome Browser
Species Human (GRCh38)
Location 3:50097645-50097667
Sequence GACCAACTCCTTTTTCCAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 180}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954357855 Original CRISPR GACCAACTCCTTTTTCCAAA AGG (reversed) Intronic
905849413 1:41262375-41262397 GACCACCTCCTTTGGCCACATGG - Intergenic
907358953 1:53899350-53899372 GTCCAACTCCTTTGTATAAATGG - Intronic
908623077 1:66007563-66007585 GTTCCACTTCTTTTTCCAAATGG + Intronic
909803431 1:79844333-79844355 GACCAAATCTTCTCTCCAAAGGG + Intergenic
909815958 1:79994227-79994249 GACCCTCTGCCTTTTCCAAAGGG + Intergenic
910737610 1:90478142-90478164 GACCAAAACACTTTTCCAAATGG + Intergenic
910803004 1:91164200-91164222 TACCAACCCCATTTTACAAAGGG + Intergenic
912698781 1:111861009-111861031 CACCATCTCCCATTTCCAAAGGG + Intronic
912698792 1:111861059-111861081 CACCATCTCCCATTTCCAAAGGG + Intronic
914516712 1:148380265-148380287 AAGCAAGTCCTTTTGCCAAAAGG - Intergenic
916233870 1:162566200-162566222 GCTGAACTTCTTTTTCCAAAAGG + Exonic
920587502 1:207181259-207181281 ATCCAAATCCTTTTTCCATAGGG - Intergenic
920606417 1:207392340-207392362 GACCAACTCCTCACACCAAAAGG + Intergenic
921454775 1:215357328-215357350 CACCTACTTCTTTTTACAAATGG + Intergenic
924005765 1:239609565-239609587 GCCAAACTCTTTTTTCAAAACGG + Intronic
924547705 1:245045649-245045671 AACCAACTCCTGTTTGCACAGGG - Intronic
1065089854 10:22220721-22220743 CCCCCAGTCCTTTTTCCAAAGGG + Intergenic
1069216877 10:65831902-65831924 GACCAACTTCTCTTAGCAAATGG - Intergenic
1070770699 10:79080766-79080788 GACCCACTCCTTCTGCCTAAAGG - Intronic
1074670191 10:115781273-115781295 GACCAAATTGTTTTTCCAAATGG - Intronic
1074926979 10:118083516-118083538 GACCCACTCCTTTTACAAATGGG + Intergenic
1077033816 11:484180-484202 GCCCAAATTCTTTTGCCAAAAGG + Intronic
1077745473 11:4899493-4899515 AACCAGATCCTTTTTTCAAAGGG + Intronic
1078150495 11:8755625-8755647 GACCAACTCCATTTTATGAAGGG - Intronic
1078933030 11:15927713-15927735 CACCTCCTCCTTTTCCCAAATGG + Intergenic
1079647267 11:22881168-22881190 GATCAACTGCTTTTGTCAAAAGG + Intergenic
1083483414 11:62965146-62965168 AACCCACTCCTTATTCCATAAGG - Intronic
1083737356 11:64689061-64689083 GATCAGCTCCATTTTCCAGACGG - Intronic
1093269927 12:17047774-17047796 GGCCAAATACTTTTTCAAAAAGG - Intergenic
1093271067 12:17062662-17062684 GAGCATGTCCTTTTACCAAAAGG + Intergenic
1093787407 12:23208504-23208526 GAAAAACTCCATTTTACAAAGGG - Intergenic
1095861363 12:46921573-46921595 GACTCACTCCACTTTCCAAAGGG + Intergenic
1097513174 12:60568478-60568500 TAACTACTCCTTTTCCCAAAGGG - Intergenic
1097614435 12:61866555-61866577 GAACAACTACTTTTTCCATGGGG - Intronic
1099650658 12:85423937-85423959 TACCAACTCCTTTTTACACAGGG + Intergenic
1105517837 13:21106056-21106078 GAACAACTCCTTGTGCCAAGCGG + Intergenic
1105731572 13:23222933-23222955 GACTAACTCCTTATTCAGAATGG + Intronic
1106842307 13:33697047-33697069 GACCAAATGTTTATTCCAAATGG - Intergenic
1108628695 13:52258358-52258380 GGCTAACTCCTTCTACCAAATGG + Intergenic
1108646395 13:52433474-52433496 AACCAAAACCTTTTTCTAAAAGG - Intronic
1108657362 13:52548092-52548114 GGCTAACTCCTTCTACCAAATGG - Intergenic
1112814744 13:103259081-103259103 AACCAACTCGTTTTTCACAAAGG - Intergenic
1114367141 14:22041266-22041288 GCCCAGGACCTTTTTCCAAATGG + Intergenic
1118525681 14:66639014-66639036 GACCATCTCATTTTGCTAAAAGG + Intronic
1118683748 14:68269987-68270009 AACCACCCTCTTTTTCCAAAGGG + Intronic
1119131843 14:72179965-72179987 GAACAACTCCTTATTCTAATGGG + Intronic
1119828979 14:77683916-77683938 GAAAAACTCCGTTTTCTAAAAGG + Intronic
1122343468 14:101043882-101043904 AACCATCACCTTTCTCCAAAGGG - Intergenic
1122393385 14:101406224-101406246 GGCCAACTCCTTTCTCCAGCAGG - Intergenic
1124456937 15:29851838-29851860 GTCCAACTCTTTTTTCATAAAGG + Intronic
1125133801 15:36316265-36316287 TACCAACTCTTTTTTCTACAAGG - Intergenic
1125509625 15:40285971-40285993 AACCAACTGCTCCTTCCAAAGGG - Intronic
1127367066 15:58301028-58301050 GACCAATTCTTTTTTGCACATGG - Intronic
1127999136 15:64174700-64174722 GACCCACTACCTTTTCCATATGG + Intronic
1128462829 15:67884307-67884329 GACCATCTACGCTTTCCAAAGGG + Intergenic
1128677843 15:69624864-69624886 GACCAACTCTGTTCTCCCAAGGG + Intergenic
1131054225 15:89366082-89366104 GACACATTCCTTTTTCCAGAAGG - Intergenic
1131772437 15:95753477-95753499 GGACAACTCCTTATTTCAAATGG + Intergenic
1132073188 15:98797763-98797785 AGCCAACTCCATTCTCCAAATGG + Intronic
1132245951 15:100296484-100296506 GACCAAGTCATTTTTATAAAAGG + Intronic
1133569263 16:7025501-7025523 GAGCAACTCCATCTTCCATAGGG - Intronic
1134822738 16:17259673-17259695 GAACATCTCCTATTTCCAGATGG - Intronic
1137762001 16:50948427-50948449 CTCCAGCTCCTTTCTCCAAAGGG - Intergenic
1139351258 16:66337507-66337529 GACCTTCTGCCTTTTCCAAATGG - Intergenic
1144712458 17:17410815-17410837 GAGAAACTCCTTTTCACAAACGG + Intergenic
1146611075 17:34305444-34305466 GGCCAGCTCCTTTTTCCAAACGG + Intergenic
1147342636 17:39763057-39763079 GAGCAACTCCTCTTTCACAAAGG + Intergenic
1147343585 17:39771246-39771268 CAGCAACTGCTTTTTCCACATGG + Intronic
1149561508 17:57611002-57611024 GACCAACTGCTTATACCAGAAGG - Intronic
1155580315 18:27297623-27297645 GACCAACACCCTTTTCCAAATGG - Intergenic
1155911744 18:31512103-31512125 TACTAACTCCTATATCCAAAAGG + Intronic
1156282308 18:35651630-35651652 AACCAAGTCCTTGTTCCAAAAGG - Intronic
1158329055 18:56341422-56341444 GAACAACTCCTTATTCTAACAGG + Intergenic
1158337773 18:56432519-56432541 GTCCAACTCTTGTTTTCAAAAGG - Intergenic
1158343377 18:56489980-56490002 TAACACCTCCTTTTTGCAAAGGG + Intergenic
1159722701 18:71912884-71912906 GAACAACTCCCTATCCCAAAAGG - Intergenic
1166589113 19:43980494-43980516 GACTAACTCCTATTATCAAATGG + Intronic
926861174 2:17310661-17310683 AACCAACTCATTTTTCTAAATGG + Intergenic
928028660 2:27760425-27760447 GACCATCTCCCTTTTCAAGATGG - Intergenic
930273628 2:49285495-49285517 GAGAAAGTCCTTTTTCCACATGG + Intergenic
930860944 2:56071871-56071893 GACCAATTCCCTTTAACAAAAGG - Intergenic
931088119 2:58856591-58856613 AACGAACTCCGTTTTACAAATGG - Intergenic
931494959 2:62795486-62795508 GTCCAACTCCTTTCTCCATAAGG + Intronic
936761660 2:115792768-115792790 GAACATTTCCTTTTACCAAAGGG - Intronic
937342203 2:121098484-121098506 GACCATCTCCATTTTACAGATGG - Intergenic
938323693 2:130382829-130382851 AACCAAACTCTTTTTCCAAAAGG + Intergenic
938554280 2:132409968-132409990 GAACAACCCCATTTTCTAAATGG - Intergenic
938880788 2:135584965-135584987 GAGCTACTGCTTTTGCCAAAGGG - Intronic
940117180 2:150221881-150221903 GGCCATTTCCTTTTTACAAAGGG + Intergenic
940144077 2:150526430-150526452 TACTAACTCCTTTTTCCTCAAGG - Intronic
940756904 2:157693768-157693790 GCCCAACTTTTTTTTCTAAATGG + Intergenic
941984286 2:171494609-171494631 CACCAACTCCTGTTTCAAAGTGG - Intergenic
943858067 2:192824352-192824374 AACCAACTCCTTTTTGACAAAGG + Intergenic
943968685 2:194374162-194374184 CATCAAGTCCTTTTTCCCAAAGG + Intergenic
944399018 2:199304175-199304197 TACCAACTCCGTTTTACAATTGG - Intronic
946095858 2:217273574-217273596 GACCAGCACGCTTTTCCAAAAGG + Intergenic
947052074 2:226056688-226056710 TCCCATCTCCTTTTCCCAAATGG - Intergenic
947914639 2:233823341-233823363 GTCTATCTCCTTTTTACAAAGGG - Intronic
948355975 2:237377418-237377440 CACCAACTCCTGTTGTCAAATGG - Intronic
949030991 2:241797482-241797504 AATCATCTCCTTTCTCCAAAAGG + Intronic
1170051261 20:12148293-12148315 TGCCAACTCCCTTTTCAAAATGG + Intergenic
1171389994 20:24795161-24795183 GAGAAACTCCATTTTCCTAAAGG + Intergenic
1172990844 20:39035364-39035386 GCCCAGCTCCTTTTTTAAAAGGG + Intronic
1179533339 21:42034956-42034978 GACCAAAACCTTTCCCCAAAGGG - Intergenic
1179555747 21:42174480-42174502 AACCAACCCCTTTTCCCAAGAGG - Intergenic
1181298251 22:21859707-21859729 AATCAAATCCTTTTTCCAAATGG + Intronic
1185123950 22:48993587-48993609 GTCTCCCTCCTTTTTCCAAAGGG + Intergenic
1185309980 22:50148960-50148982 GACCAACCCCATTTTCTTAATGG + Intronic
950579367 3:13852506-13852528 GACCCACTCCTTGTTCCGACCGG - Intronic
952204427 3:31165932-31165954 GAACACCTCCGTTTTCCAAGAGG - Intergenic
952469087 3:33625914-33625936 GACCATCTGTTGTTTCCAAATGG + Intronic
952700283 3:36320522-36320544 GTCCAACTTCTATTGCCAAAGGG + Intergenic
953465216 3:43113986-43114008 TATCAACTCCTTTTCCCAAGAGG + Intergenic
953633205 3:44637746-44637768 GATCAACTGCTTTTTTAAAAGGG - Intronic
954357855 3:50097645-50097667 GACCAACTCCTTTTTCCAAAAGG - Intronic
955638547 3:61056684-61056706 GACCCACACCTTTTTCAAACTGG + Intronic
956585509 3:70860456-70860478 CATCATCTCCATTTTCCAAATGG - Intergenic
957744484 3:84321237-84321259 AACCCACTCCTTTTTCCTATTGG - Intergenic
962301015 3:134243163-134243185 GACCAACCACTTCTCCCAAAAGG + Intronic
964107171 3:153051686-153051708 AACCTAGTCCTTTTTCCAAGGGG + Intergenic
964217986 3:154309815-154309837 TACCAATTCCTATTTCAAAAGGG + Exonic
965197799 3:165622844-165622866 GACCAGCTCTGGTTTCCAAAAGG + Intergenic
966630851 3:182073129-182073151 GACCAACTCATTTTTGACAAAGG - Intergenic
967648536 3:191956683-191956705 GAACCACTCCATTTTCCAGATGG + Intergenic
969190485 4:5514415-5514437 AACCAACTCATTTTTCACAATGG + Intergenic
970713755 4:18895695-18895717 GAACAACTTCTTTTCCTAAATGG - Intergenic
971783534 4:31070455-31070477 GAGCAACTCCCTTTTACTAATGG - Intronic
972626045 4:40799960-40799982 AACAAAAGCCTTTTTCCAAATGG + Intronic
972993889 4:44855408-44855430 GACAAAATCCATTTTCCAAAAGG - Intergenic
973571157 4:52241208-52241230 GACCAACTCCTTCCTCCCTAGGG - Intergenic
974313093 4:60238723-60238745 TACCTACTCCTTTTTACAAGGGG - Intergenic
975907488 4:79231507-79231529 GACCAATACCTTTTTGGAAAAGG - Intronic
977392654 4:96431543-96431565 TATCCACTGCTTTTTCCAAAGGG + Intergenic
978120994 4:105079322-105079344 GACCAACTCTTTTGTCCCCAAGG + Intergenic
978625297 4:110678557-110678579 CACTAACTCCTTTATCCAAGGGG - Intergenic
980178723 4:129378438-129378460 GACAGACTCCTTTTTCAAAGTGG - Intergenic
986670184 5:10136531-10136553 CATCAAGTCCTTTTTCCAATGGG - Intergenic
990398443 5:55409342-55409364 GACCATCTCATTTTGCTAAAAGG + Intronic
991442256 5:66663246-66663268 CACCAACTCCTTTTTAGGAATGG + Intronic
991706644 5:69364495-69364517 GACCAACTGGTCTCTCCAAAGGG + Intronic
993252975 5:85552475-85552497 AGCCAACTCATTTTTACAAAAGG + Intergenic
998599728 5:143573175-143573197 CACCACCTCCATTTCCCAAATGG - Intergenic
1001799728 5:174532524-174532546 TTCCAACCTCTTTTTCCAAAGGG + Intergenic
1003736034 6:8878618-8878640 TACCTACTCCTTTTCCCCAAAGG + Intergenic
1004054489 6:12121858-12121880 CACCAACTCCCTTTGCCAGAAGG + Exonic
1005230795 6:23699640-23699662 GACCAACACTTTTTACAAAATGG + Intergenic
1007251281 6:40496783-40496805 GATCAACTCCTTGCCCCAAAGGG - Intronic
1007919954 6:45598021-45598043 GAGCCACTCCTTCTTCCAAAGGG + Intronic
1011068682 6:83358695-83358717 GATGAACTCTTTTTTCCAGAAGG + Intronic
1011657648 6:89566218-89566240 GGCCAATTCCTTGTTCCAAGTGG - Intronic
1013763007 6:113540078-113540100 CACCAGCTCCTGTTTCCTAAAGG + Intergenic
1014707885 6:124770365-124770387 TACCACCTCCTTTTTCAGAAAGG - Intronic
1015997175 6:139007072-139007094 GATCAACTCCTGATTCCCAAAGG - Intergenic
1018310124 6:162499997-162500019 GACCAAGTCCTTGTTCTAGATGG - Intronic
1019885573 7:3901587-3901609 GACCAACAGGTTTGTCCAAAGGG + Intronic
1021165415 7:17333672-17333694 GAACCACTCCTTGTTCCTAATGG - Intronic
1024837268 7:53536519-53536541 GACCTCCTCCTTTTTTCTAATGG + Intergenic
1025977276 7:66378953-66378975 GTCCAACTCCTGCTTCCCAATGG - Intronic
1027708840 7:81571274-81571296 GACCTACTCTTTTTGCCTAAAGG + Intergenic
1030101260 7:105947505-105947527 GACCACCCCACTTTTCCAAAGGG + Intronic
1030901882 7:115134816-115134838 CACCAAGTCCTTTTTGGAAATGG + Intergenic
1030942697 7:115674245-115674267 GACCTACTTCTTTTAGCAAAAGG - Intergenic
1033004237 7:137543632-137543654 GAACAACTCTTTTTTACAGATGG - Intronic
1033312774 7:140273749-140273771 GATGCACTCCTCTTTCCAAATGG + Intergenic
1033541744 7:142362865-142362887 GCCAAAGTACTTTTTCCAAATGG + Intergenic
1035053625 7:156019060-156019082 GACCAAGACCTGGTTCCAAATGG - Intergenic
1035309907 7:157960429-157960451 ACCCAACTCCTTTTTCAGAAAGG - Intronic
1035349233 7:158233826-158233848 AACCAACTCATTTTTCACAAAGG + Intronic
1035452964 7:158990462-158990484 GACCTACTTCATTTTCCTAACGG - Intergenic
1036989209 8:13572765-13572787 GACCAACTGATTTTTCACAAGGG - Intergenic
1037506591 8:19536865-19536887 GTCCAACTGCTTTTTCACAAAGG + Intronic
1039229047 8:35422804-35422826 TTCCATCCCCTTTTTCCAAAAGG - Intronic
1043685251 8:83076560-83076582 GACCAAATGCTTTTTCCCTAAGG + Intergenic
1045060689 8:98408165-98408187 AACTACCCCCTTTTTCCAAATGG - Intronic
1045731425 8:105246371-105246393 GACGAAATCCTCTTTCCAGAGGG - Intronic
1047281723 8:123451773-123451795 GAACAACTCCTGTCACCAAAGGG + Intronic
1048033534 8:130655162-130655184 CACCAACTCCTTTTACCCATAGG - Intergenic
1048941514 8:139404375-139404397 TGCCAACTTCTTTTTCCAAGGGG + Intergenic
1049282099 8:141754798-141754820 GACCAACTTGTTTTTCAGAATGG + Intergenic
1050162610 9:2734058-2734080 GACCATCTCCATTATTCAAATGG + Intronic
1050599458 9:7235532-7235554 AACCAACTTCTCTTTCCAACAGG - Intergenic
1052352619 9:27472763-27472785 CTCCACCACCTTTTTCCAAAAGG - Intronic
1058244497 9:102606111-102606133 AACAAACACCTTTTTACAAAAGG + Intergenic
1059390322 9:113995738-113995760 GAACAACTCCTTTTTTGAATCGG - Intronic
1190459956 X:50662599-50662621 AAGCAACTACTATTTCCAAAGGG + Intronic
1193201866 X:78701001-78701023 GACTAACTCATTTTCCTAAATGG - Intergenic
1194659356 X:96612371-96612393 GACCCACTCTTTTCTCCATATGG - Intergenic
1195721862 X:107875834-107875856 GACCAACCCCAGTGTCCAAAAGG + Intronic
1196273714 X:113741669-113741691 GACCAATTCCTTTTTTCAGAGGG - Intergenic
1196418297 X:115496705-115496727 AACCAATTCCTTTGTCCATAGGG + Intergenic
1198531166 X:137550619-137550641 AACCTTCTCGTTTTTCCAAAAGG - Intergenic
1199727951 X:150603555-150603577 GTTCAACTCCATCTTCCAAATGG - Intronic
1201539302 Y:15089076-15089098 GACCAACTGCTGTTTACAAATGG - Intergenic