ID: 954358333

View in Genome Browser
Species Human (GRCh38)
Location 3:50102124-50102146
Sequence ACTATCAAACAGATTTAAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 195}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954358333 Original CRISPR ACTATCAAACAGATTTAAGT AGG (reversed) Intronic
903612393 1:24625286-24625308 ATAATCTAACAGATATAAGTTGG + Intergenic
906696409 1:47826313-47826335 AATATGAAATATATTTAAGTGGG + Intronic
908369117 1:63462858-63462880 ACTATTAAAAAGATTTTATTTGG + Intronic
911705828 1:101011649-101011671 TCTATAAAACAGATTTATATGGG + Intronic
914696526 1:150087007-150087029 ACTATTATACAGATTACAGTTGG - Intronic
916439824 1:164813033-164813055 ACGATCAAACATATTTAAATTGG - Intronic
917604700 1:176614984-176615006 ACTTTCAAACAAAAATAAGTCGG + Intronic
918646076 1:186906345-186906367 CCTATCAAACATATTGAAGGAGG - Intronic
920897673 1:210073896-210073918 ACTATCACAAAGCTTTAATTTGG + Intronic
922035318 1:221842031-221842053 ACTAGGGAAAAGATTTAAGTTGG + Intergenic
1064133275 10:12729332-12729354 CCTATAGAACAGATTAAAGTGGG + Intronic
1069157444 10:65048676-65048698 TCTATCATAAAGAATTAAGTGGG - Intergenic
1069322677 10:67192212-67192234 AAAAGCAAAAAGATTTAAGTGGG + Intronic
1070050657 10:72886407-72886429 ATTATTAAACAGTTATAAGTTGG - Exonic
1072226506 10:93375019-93375041 ACTGTCAAATACATTTATGTTGG + Intronic
1079418285 11:20261215-20261237 ACTATCTTACATAGTTAAGTAGG - Intergenic
1080097373 11:28425148-28425170 TTCATGAAACAGATTTAAGTAGG - Intergenic
1081007430 11:37763066-37763088 ATCATTAAACACATTTAAGTAGG - Intergenic
1083959322 11:66005543-66005565 ACTGGCAAACACTTTTAAGTTGG + Intergenic
1085639541 11:78184296-78184318 CCAATCAAACATATTTAAATAGG + Intronic
1088177477 11:107070229-107070251 ACTATAAACCAGATCTCAGTAGG - Intergenic
1089020195 11:115205809-115205831 ACTATAAAACAGTTTTAGATTGG - Intronic
1091952412 12:4605402-4605424 ACTATCAGATAGATTTTAATGGG - Intronic
1092440996 12:8503114-8503136 ACTTTCAAAGAGATTTATGGAGG + Intergenic
1092931695 12:13321530-13321552 AGTGTCAAACAGATTCAAGAAGG - Intergenic
1093009315 12:14088016-14088038 ACTATAAAACAGCTTCAGGTAGG - Intergenic
1095226481 12:39683853-39683875 ACTTTCAAACAGCTCTCAGTGGG + Intronic
1095361382 12:41345086-41345108 AAAATGAAACAGATTAAAGTTGG - Intronic
1096889457 12:54753224-54753246 ACAAGCAAACAGATTACAGTAGG + Intergenic
1098027673 12:66222182-66222204 ACTGTCAAACTTATTTTAGTAGG - Intronic
1100688739 12:97015582-97015604 CCTAACAAACAGATTTGAGACGG + Intergenic
1107050514 13:36042884-36042906 ACATTCAAACACATTTAAGGTGG + Intronic
1109772159 13:66990034-66990056 ACTAACAAAGATATTTAAGATGG + Intronic
1109875143 13:68392607-68392629 GCTAGAAATCAGATTTAAGTAGG - Intergenic
1110003452 13:70235290-70235312 AATATCAAACCTATTTAAGAAGG + Intergenic
1110045228 13:70819567-70819589 AGTTTCAAACAAAATTAAGTTGG + Intergenic
1113089775 13:106605073-106605095 ACAATCAAAAAGATGTAAGGTGG - Intergenic
1113314729 13:109166588-109166610 ACCAGGAAACAGATTTAAGTTGG + Intronic
1113541547 13:111113778-111113800 AGTATCAAACCGAATTTAGTAGG + Intergenic
1116839892 14:49809490-49809512 ATTATCATACAGATTTAGTTTGG - Intronic
1116986985 14:51231077-51231099 GCCATTAAACAGTTTTAAGTAGG + Intergenic
1118422242 14:65619354-65619376 ACTAGGAAACAGCTTCAAGTGGG - Intronic
1119903238 14:78279864-78279886 ATAATCAACCAGACTTAAGTAGG + Intronic
1124199435 15:27665636-27665658 AATATAAAACACATTTATGTGGG - Intergenic
1126285006 15:47000325-47000347 AAAATCCAACAGATGTAAGTAGG + Intergenic
1126937850 15:53731141-53731163 ACTATAGAGGAGATTTAAGTTGG - Intronic
1129104144 15:73294211-73294233 ATTATCAAACAGTTTTAAGGAGG + Intronic
1130029818 15:80302293-80302315 ACTAGCAAACAAAATTCAGTGGG - Intergenic
1130058855 15:80555156-80555178 ACTATGCATCAGCTTTAAGTGGG - Intronic
1130440557 15:83948653-83948675 ATTATCCTACAGATTTAATTTGG + Intronic
1132165896 15:99589072-99589094 ACTTTCTAACACATTTAAGGAGG - Intronic
1133654279 16:7844785-7844807 AGTAGGAAATAGATTTAAGTGGG + Intergenic
1135978745 16:27129778-27129800 ACAATCAAACTGACTTAACTAGG + Intergenic
1136422529 16:30144430-30144452 ACTATAAAACAGAATTAGGCTGG + Intergenic
1137910357 16:52372077-52372099 ACAATGTAACAGATTTAAATGGG - Intergenic
1139622731 16:68159779-68159801 CCTATAAAACAGATTTCAGCTGG + Intronic
1139962290 16:70724944-70724966 TCTAGCAAACAGACTTAGGTTGG + Intronic
1141936196 16:87239919-87239941 ATTATAAAACAGTTTGAAGTGGG + Intronic
1149265827 17:54926443-54926465 ACAAACAAAAAGATTAAAGTGGG - Intronic
1153909973 18:9698203-9698225 ACTATCCAAGAGATTTGAGAAGG - Intergenic
1154082587 18:11273104-11273126 GCTAGCAAAGAGATTTAAGCAGG + Intergenic
1154480967 18:14824195-14824217 ACTCTAAAACACATTTAATTAGG + Intronic
1155881643 18:31156665-31156687 ACAATCAAAAAGAATTTAGTTGG + Intronic
1156167237 18:34436911-34436933 ACTTTTAAAAACATTTAAGTAGG - Intergenic
1156185143 18:34653879-34653901 AATATCAAACAGCTTTGAATTGG + Intronic
1157993880 18:52531442-52531464 ACTTTCAAATATATTTAAATTGG - Intronic
1158021798 18:52851393-52851415 ATTCACAAACAGAATTAAGTAGG - Intronic
1160037502 18:75315516-75315538 ACAAACAAACAAATTTAAGATGG + Intergenic
1164134279 19:22398664-22398686 ACATTCAAATAGATTTAAGATGG + Intronic
1168453661 19:56487073-56487095 TCTATCTTAGAGATTTAAGTTGG - Intergenic
926895550 2:17683824-17683846 AATCTCAAACAGATTTAACTGGG + Intronic
928813228 2:35254711-35254733 ACAATCAAAAATATTTAAATAGG + Intergenic
929888543 2:45900049-45900071 AATCTATAACAGATTTAAGTGGG + Intronic
931573461 2:63695634-63695656 TCTATTAAAAAAATTTAAGTAGG - Intronic
931857969 2:66323758-66323780 TGTATCAAACAGGTTTAAGGAGG - Intergenic
934577132 2:95410013-95410035 ACTATAAAATAGATATAATTTGG - Intronic
934639435 2:96018679-96018701 ACTATAAAATAGATATAATTTGG - Intergenic
934794218 2:97086706-97086728 ACTATAAAATAGATATAATTTGG + Intronic
935866278 2:107391192-107391214 ACTATAAAACAGCCTGAAGTGGG + Intergenic
937503189 2:122505955-122505977 ACAAACAAACAGATTTGTGTTGG - Intergenic
940324841 2:152414358-152414380 ACTATGAGAGAGATTCAAGTAGG - Intronic
940449453 2:153818887-153818909 ACTTTCAAGCAGGGTTAAGTAGG - Intergenic
940794886 2:158067029-158067051 ACTTTCAAACAAAAATAAGTTGG - Intronic
941111956 2:161426006-161426028 ACTATAAAACAAATTTAAGGGGG - Intronic
944526566 2:200625876-200625898 ACTATCACAAAGATTTAATCTGG + Intronic
945454841 2:210038656-210038678 ACTTTAAAACAAATTTAAGGTGG - Intronic
1170308179 20:14963003-14963025 ACTATCTTAAAAATTTAAGTAGG - Intronic
1170451376 20:16487581-16487603 ATTATAAAACAGATATAAGCTGG + Intronic
1171511861 20:25692551-25692573 ACTATGAAAAATATTGAAGTAGG - Intronic
1174893200 20:54420391-54420413 ACTATGAAAAAGAATAAAGTGGG + Intergenic
1175271645 20:57738190-57738212 ACTAACAAACAAACTTAACTGGG + Intergenic
1176799638 21:13412420-13412442 ACTCTAAAACACATTTAATTAGG - Intergenic
1177362587 21:20092417-20092439 ACTATCAAACATATATAGATTGG + Intergenic
1177423479 21:20892504-20892526 CCTATCAAAGAGTTTGAAGTAGG - Intergenic
1177708872 21:24744705-24744727 ACTATCAAACATATTATGGTAGG + Intergenic
1178175104 21:30087691-30087713 ACTATCTAACAGAATGTAGTTGG + Intergenic
953669552 3:44951223-44951245 ATTTTAAAACAGATTTAAATTGG - Intronic
954358333 3:50102124-50102146 ACTATCAAACAGATTTAAGTAGG - Intronic
956893626 3:73637769-73637791 CCTATTAAACAGCTTTAAGCAGG - Intergenic
956896065 3:73661184-73661206 ACTATCAAACAGCCTCAGGTAGG - Intergenic
958724181 3:97883506-97883528 AAAATCAAACAGATTTAATCTGG + Intronic
959388443 3:105742179-105742201 TATAGCCAACAGATTTAAGTTGG - Intronic
959449021 3:106476283-106476305 ACTTTCAAACACATTTTAGTAGG - Intergenic
960498067 3:118399828-118399850 ACTATCAAAGACTATTAAGTTGG + Intergenic
962509268 3:136082721-136082743 TCTTTCAAACAGATTTAAACAGG - Intronic
964708266 3:159644334-159644356 ACTATCAAACATGTTAAAATTGG + Intronic
965472077 3:169106501-169106523 ATTATAAAACAGATATTAGTAGG - Intronic
967661558 3:192116781-192116803 AATGTAAAACAGATTTTAGTAGG + Intergenic
970176070 4:13340716-13340738 TCTAGCAAACAGATTTCTGTGGG - Intergenic
970275815 4:14399399-14399421 ATACTCCAACAGATTTAAGTAGG + Intergenic
971122154 4:23716633-23716655 ACTGTAATACAGATTTAACTAGG - Intergenic
971691714 4:29845261-29845283 AATATAAAATAGATTTAACTGGG - Intergenic
972245114 4:37238101-37238123 ACTATCAAAGAAAGTTATGTGGG + Intergenic
972582736 4:40409248-40409270 AATATCAAAAAGAATGAAGTTGG + Intergenic
972923100 4:43968064-43968086 AATATGCAACAGATATAAGTGGG - Intergenic
974265058 4:59576382-59576404 ACTATCAAATAAATTTTAGCTGG - Intergenic
974828505 4:67160202-67160224 ATTTTCAAACAGCTTAAAGTTGG - Intergenic
977126785 4:93179198-93179220 GATATCAAACTGATTTATGTGGG - Intronic
977402552 4:96551154-96551176 TCTATGAAACAGCTTTAATTTGG + Intergenic
977768696 4:100831228-100831250 ACAATAAATCATATTTAAGTAGG + Intronic
978262444 4:106776389-106776411 ACTATCATACAGTTGTAAGTAGG + Intergenic
979279943 4:118855716-118855738 ACTAAGAAACTGATTGAAGTAGG + Intronic
980240325 4:130165049-130165071 ACTTTCAAACAGGTTTGACTTGG + Intergenic
981860140 4:149345075-149345097 ATTATAGAACAGATTTGAGTAGG + Intergenic
982514755 4:156331095-156331117 AGTATTTAATAGATTTAAGTGGG + Intergenic
987686836 5:21215511-21215533 AATATCAAACAGATTTTAAATGG + Intergenic
987875800 5:23679278-23679300 ACTGTGAGACAAATTTAAGTGGG + Intergenic
988419282 5:30986217-30986239 ACAATCAAACAAACTTATGTAGG + Intergenic
989089566 5:37715939-37715961 ACTATCCAACACATTTGAATGGG - Intronic
990255977 5:53969580-53969602 ATTATCAAACAGATAAAAGCAGG + Intronic
990284914 5:54291796-54291818 ACTATTAAATAGTTTTAAGCAGG - Intronic
990735361 5:58854860-58854882 AATATGAATAAGATTTAAGTAGG - Exonic
991564162 5:67987530-67987552 ACTATAAAACACATTTAAAGTGG + Intergenic
993297587 5:86161984-86162006 ACTACCAATCAGATTTAGTTAGG + Intergenic
993986753 5:94606759-94606781 ACAAACAAACATATTAAAGTGGG + Intronic
994585224 5:101699472-101699494 ACTGTAAAACAGACTTAAGCAGG + Intergenic
994880901 5:105494166-105494188 AATATCAAATAGAGTTAAGAAGG - Intergenic
996494658 5:124139949-124139971 ATTATAAAACAGTTTTCAGTAGG + Intergenic
999009984 5:148025546-148025568 ACTATCAAAAAGATCTGAGTAGG - Intergenic
999908860 5:156174226-156174248 ACTATAAAATAAATTGAAGTCGG + Intronic
1000077290 5:157802848-157802870 ACTACCAAACATATTTAAAGAGG - Intronic
1002384876 5:178859110-178859132 ACTATCAAAAGGATGTAAATTGG - Intergenic
1002588571 5:180270312-180270334 ACTTTAAAACAGATTGAATTAGG - Intronic
1002972640 6:2039781-2039803 ACTATAAAACAGCTTTAGGCGGG - Intronic
1003804108 6:9706139-9706161 ACTATGAAACAGCTTTACATAGG - Intronic
1007388878 6:41538353-41538375 ACTATCAACCTGATTTAGGCTGG + Intergenic
1009414301 6:63398232-63398254 ACTATAAAACAGATTCAGGCAGG + Intergenic
1009432481 6:63581116-63581138 ACTTTCAAACAAAAATAAGTTGG - Exonic
1009772659 6:68163012-68163034 AATATTAAACATATTGAAGTTGG - Intergenic
1009823552 6:68837073-68837095 TCTATCAAAAATATTTGAGTAGG - Intronic
1010883775 6:81212402-81212424 ACTGGCAAACTGATTTAATTAGG - Intergenic
1011177041 6:84575225-84575247 ACTAGAAAACAGAATTAAGCGGG - Intergenic
1012286577 6:97397284-97397306 ACTCAAAAGCAGATTTAAGTTGG + Intergenic
1012415999 6:99014525-99014547 CATATCAAACTCATTTAAGTAGG - Intergenic
1013347588 6:109277104-109277126 TATATAAAACAGATGTAAGTGGG + Intergenic
1013952854 6:115805875-115805897 AATATCAAACAATTTTTAGTTGG - Intergenic
1014093827 6:117437780-117437802 ACTATAAAACGGCTTTAGGTAGG + Intronic
1014859850 6:126452159-126452181 ATTTTCAATGAGATTTAAGTAGG + Intergenic
1015024273 6:128514726-128514748 AATTTCAACCAGAGTTAAGTGGG + Intronic
1016170470 6:141008493-141008515 ATTATGATACAGATTGAAGTGGG - Intergenic
1017796132 6:157846258-157846280 ACTGCCAAAGAGAGTTAAGTTGG - Intronic
1018735991 6:166687709-166687731 ACGTTCAAACAAATTTAAGTTGG + Intronic
1020151183 7:5682970-5682992 TCCATCACACAGATTTATGTTGG - Intronic
1020883166 7:13788859-13788881 AATATAAAACAGATTTGAATGGG + Intergenic
1021173504 7:17423195-17423217 ACTATTAAAAAGATCTGAGTGGG + Intergenic
1021697775 7:23290658-23290680 AATATCAAAAAGATGAAAGTGGG - Intergenic
1022550079 7:31229760-31229782 ACATTCAAACAGATTTAGATTGG + Intergenic
1022688560 7:32621598-32621620 ACTTCCAAAAAGATTTAATTTGG - Intergenic
1022714494 7:32886644-32886666 TCTATGCAACAAATTTAAGTTGG + Intronic
1022916145 7:34955894-34955916 ACTTCCAAAAAGATTTAATTTGG - Intronic
1028684050 7:93573562-93573584 ACTATCATACAGACTTTATTTGG - Intronic
1028766591 7:94566546-94566568 ACTATGAAACAGCCATAAGTTGG - Intergenic
1029628930 7:101738309-101738331 ACTATCAAAAAGTTGTAAGCAGG + Intergenic
1030187892 7:106781026-106781048 GCTATCAAACAGCTAGAAGTTGG + Intergenic
1030866087 7:114703453-114703475 TCTATCAAACATATTTAATGGGG + Intergenic
1033381308 7:140822261-140822283 ACAAACAAACAGATTTATCTAGG + Intronic
1037104711 8:15092865-15092887 ATTAGCAAATAGTTTTAAGTGGG - Intronic
1038906536 8:31910399-31910421 ACTATCAAAGAGTTTTAAGCAGG + Intronic
1041366530 8:57111771-57111793 ACTATCATACAGATTTCACTTGG + Intergenic
1042008375 8:64209211-64209233 ACTCTCAGACAGATAAAAGTAGG + Intergenic
1042257572 8:66821237-66821259 TATATCAAACACATTAAAGTGGG - Intronic
1043342324 8:79255275-79255297 GCTATAAAACAGATCTGAGTTGG - Intergenic
1046127598 8:109929486-109929508 GTTCTCAAACAGCTTTAAGTAGG + Intergenic
1046283459 8:112064058-112064080 ACAATTAAAAAGATTTCAGTGGG + Intergenic
1046829498 8:118728999-118729021 ACTCTCAAACTGTTTTAAATTGG + Intergenic
1047553504 8:125902752-125902774 AATATTAAACAGCATTAAGTTGG - Intergenic
1049516729 8:143063128-143063150 ACTATTAAACATACTCAAGTGGG - Intergenic
1051088233 9:13376967-13376989 TTTATAAAACAGATTAAAGTAGG - Intergenic
1053554337 9:39119637-39119659 AGTAGCAAAAAGATGTAAGTGGG + Intronic
1053818432 9:41939787-41939809 AGTAACAAAAAGATGTAAGTGGG + Intronic
1054108694 9:61083435-61083457 AGTAACAAAAAGATGTAAGTGGG + Intergenic
1054612163 9:67247690-67247712 AGTAACAAAAAGATGTAAGTGGG - Intergenic
1055699747 9:78930427-78930449 ATTATCATACAGAGTAAAGTGGG - Intergenic
1057099378 9:92343567-92343589 AATATCAAACAGATTTTCTTTGG - Intronic
1058268505 9:102937965-102937987 GCTGTCAAACATATTTAAGAAGG + Intergenic
1058639062 9:107065417-107065439 ACTATCAAAGAGCTTTAAGCAGG + Intergenic
1058757022 9:108092260-108092282 AATATAAAACAGATTTGAGGGGG - Intergenic
1060569348 9:124623843-124623865 TCTGTCAAACAGATGTTAGTGGG - Intronic
1186730106 X:12401074-12401096 AATTTCAAATACATTTAAGTTGG - Intronic
1188683981 X:33046322-33046344 AGTATCACACAAATTTAAGTGGG - Intronic
1188809975 X:34641781-34641803 ACTATCATGCAGAGTTGAGTGGG - Intronic
1191860545 X:65663387-65663409 ACAATCTAACAGATGTAAGGTGG + Intronic
1194178680 X:90686378-90686400 AATTTCAAACAGATTTTAGCAGG + Intergenic
1195010320 X:100727386-100727408 AGTATCTAACTGATTTAACTTGG - Intronic
1195804743 X:108751708-108751730 ACTTTGAAAAATATTTAAGTAGG + Intergenic
1197494148 X:127156297-127156319 ACTAATAAACAGATTTGAGCAGG - Intergenic
1198486752 X:137095049-137095071 ATGATCAAACAGATTTAATAGGG + Intergenic
1200525348 Y:4268540-4268562 AATTTCAAACAGATTTTAGCAGG + Intergenic
1200969216 Y:9132335-9132357 ACTTTCAAAAATATTTAAATTGG + Intergenic