ID: 954363292

View in Genome Browser
Species Human (GRCh38)
Location 3:50133684-50133706
Sequence CCTGCTTTGCTGGTGGGGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954363292_954363304 -10 Left 954363292 3:50133684-50133706 CCCCACCCCACCAGCAAAGCAGG No data
Right 954363304 3:50133697-50133719 GCAAAGCAGGCTGGGACTAGGGG No data
954363292_954363305 -4 Left 954363292 3:50133684-50133706 CCCCACCCCACCAGCAAAGCAGG No data
Right 954363305 3:50133703-50133725 CAGGCTGGGACTAGGGGCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954363292 Original CRISPR CCTGCTTTGCTGGTGGGGTG GGG (reversed) Intergenic
No off target data available for this crispr