ID: 954363312

View in Genome Browser
Species Human (GRCh38)
Location 3:50133748-50133770
Sequence AGTTACCTGCAGATGAGGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954363312_954363318 9 Left 954363312 3:50133748-50133770 CCAGTCCTCATCTGCAGGTAACT No data
Right 954363318 3:50133780-50133802 CTTGACTTGTCTCTAGCAGTCGG No data
954363312_954363319 25 Left 954363312 3:50133748-50133770 CCAGTCCTCATCTGCAGGTAACT No data
Right 954363319 3:50133796-50133818 CAGTCGGATTCTCCCACAAATGG No data
954363312_954363320 26 Left 954363312 3:50133748-50133770 CCAGTCCTCATCTGCAGGTAACT No data
Right 954363320 3:50133797-50133819 AGTCGGATTCTCCCACAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954363312 Original CRISPR AGTTACCTGCAGATGAGGAC TGG (reversed) Intergenic
No off target data available for this crispr