ID: 954366816

View in Genome Browser
Species Human (GRCh38)
Location 3:50150895-50150917
Sequence GCTCTGAGCCGATCAAAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954366816_954366820 -7 Left 954366816 3:50150895-50150917 CCAGCTTTTGATCGGCTCAGAGC No data
Right 954366820 3:50150911-50150933 TCAGAGCCAGCCCCTGGGGCAGG No data
954366816_954366822 -2 Left 954366816 3:50150895-50150917 CCAGCTTTTGATCGGCTCAGAGC No data
Right 954366822 3:50150916-50150938 GCCAGCCCCTGGGGCAGGCTGGG No data
954366816_954366829 18 Left 954366816 3:50150895-50150917 CCAGCTTTTGATCGGCTCAGAGC No data
Right 954366829 3:50150936-50150958 GGGCAGGAGAAGGCTGCACACGG No data
954366816_954366828 8 Left 954366816 3:50150895-50150917 CCAGCTTTTGATCGGCTCAGAGC No data
Right 954366828 3:50150926-50150948 GGGGCAGGCTGGGCAGGAGAAGG No data
954366816_954366824 2 Left 954366816 3:50150895-50150917 CCAGCTTTTGATCGGCTCAGAGC No data
Right 954366824 3:50150920-50150942 GCCCCTGGGGCAGGCTGGGCAGG No data
954366816_954366821 -3 Left 954366816 3:50150895-50150917 CCAGCTTTTGATCGGCTCAGAGC No data
Right 954366821 3:50150915-50150937 AGCCAGCCCCTGGGGCAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954366816 Original CRISPR GCTCTGAGCCGATCAAAAGC TGG (reversed) Intergenic
No off target data available for this crispr