ID: 954367120

View in Genome Browser
Species Human (GRCh38)
Location 3:50152107-50152129
Sequence TACTCTCAGCTCCTCTGGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954367120_954367127 14 Left 954367120 3:50152107-50152129 CCAGTCCAGAGGAGCTGAGAGTA No data
Right 954367127 3:50152144-50152166 CTCCCTGAGTCTTGGCTTCTTGG No data
954367120_954367126 6 Left 954367120 3:50152107-50152129 CCAGTCCAGAGGAGCTGAGAGTA No data
Right 954367126 3:50152136-50152158 GGAGTTGACTCCCTGAGTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954367120 Original CRISPR TACTCTCAGCTCCTCTGGAC TGG (reversed) Intergenic
No off target data available for this crispr