ID: 954367376

View in Genome Browser
Species Human (GRCh38)
Location 3:50153892-50153914
Sequence GAGGGTAAAGAGCAGGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1308
Summary {0: 1, 1: 1, 2: 6, 3: 122, 4: 1178}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954367376 Original CRISPR GAGGGTAAAGAGCAGGAAGA AGG Intergenic
900032047 1:379284-379306 GAGACTCAAGAGGAGGAAGAGGG - Intergenic
900052596 1:607470-607492 GAGACTCAAGAGGAGGAAGAGGG - Intergenic
900166094 1:1244908-1244930 GAGGGGGAAGAGGAGGAGGAGGG - Intronic
901787041 1:11631638-11631660 GAGTGGAAAGAACACGAAGATGG + Intergenic
902101372 1:13992687-13992709 GAAGGTAAAGAGCAGGGGAACGG + Intergenic
902289008 1:15424655-15424677 GAGGGCACAGAGCAGGACGGGGG - Intronic
902458646 1:16554456-16554478 GAGGGGAAAGAGCAGACAGGAGG + Intergenic
902493511 1:16853460-16853482 GAGGGGAAAGAGCAGACAGGAGG - Intronic
902594378 1:17498263-17498285 GAGGGCAAGGAGTAGGTAGAAGG + Intergenic
902605658 1:17567910-17567932 GAGGGTCAAGGACAGGAAGGGGG - Intronic
903071822 1:20730539-20730561 GAGGCTAAGGACCAGGGAGATGG - Intronic
903151831 1:21415216-21415238 GAGGGGAAAGAGCAGACAGGAGG + Intergenic
903352610 1:22727117-22727139 GAGGGAAAGGTTCAGGAAGATGG + Intronic
903600381 1:24534042-24534064 GAAAGTAAAGAGAAGGAAAAAGG - Intronic
903847985 1:26289826-26289848 GAGGGTCAAGGGCAGGCACATGG - Intronic
904000371 1:27335438-27335460 GAGGTTAAAGACCAGGCTGACGG - Exonic
904295393 1:29516937-29516959 GAGGAGAAGGAGAAGGAAGAAGG - Intergenic
904295740 1:29518748-29518770 GAGGAGAAGGAGAAGGAAGAAGG - Intergenic
904295752 1:29518808-29518830 GAGGAGAAGGAGAAGGAAGAAGG - Intergenic
904323386 1:29711136-29711158 GAGGGGAGAAAGGAGGAAGAGGG + Intergenic
904617633 1:31758500-31758522 GAGTCTAAACAGCAGGCAGAGGG + Intronic
904900051 1:33849980-33850002 AAGGGTAAAGAGGAGGAGGCAGG - Intronic
904982309 1:34516833-34516855 GAGGGTGAAGAGTGGGAAGAGGG - Intergenic
905154521 1:35964267-35964289 GAGGGTAGAGGGTAGGAGGAGGG - Intronic
905269752 1:36779826-36779848 GAGGGTAAAGAGTGGGAGGAGGG - Intergenic
905300399 1:36982795-36982817 GAGGGAAGTGAGCAGGAAGTGGG + Intronic
905442004 1:38001593-38001615 CAGGGAAAAGGGCAGGGAGAGGG - Intronic
905543062 1:38775467-38775489 TAGGGTAAAGAAGAGGAGGAAGG - Intergenic
905589096 1:39146662-39146684 GAGGATAGAGAGTAGAAAGATGG + Intronic
905707544 1:40072766-40072788 GAGGATTAAGAGCAAGAAGTTGG - Exonic
905851433 1:41277798-41277820 GTGGGGAAAGAGCAGAAAGTAGG + Intergenic
906180868 1:43817697-43817719 GAGGAGAAGGAGAAGGAAGAAGG - Intronic
906180881 1:43817743-43817765 GAGGAAGAAGAGGAGGAAGAAGG - Intronic
906201162 1:43961215-43961237 GGAGGTGACGAGCAGGAAGAGGG - Exonic
906367852 1:45225821-45225843 GAAGGAAAAGAGAAGGAAAAGGG + Intronic
906990756 1:50734903-50734925 GAGGGTAGATATCAGGGAGAAGG + Intronic
907494665 1:54835949-54835971 GTGGGGTAAGGGCAGGAAGATGG - Intronic
907909252 1:58812875-58812897 CAGGGAAAAGAGGAGGATGATGG - Intergenic
907960134 1:59271473-59271495 GAGGGTAAAGGGTGGGAGGAGGG + Intergenic
908378092 1:63566346-63566368 GAGGGTGAAGAGTACGAGGAGGG + Intronic
908852042 1:68386489-68386511 TAGAGCAAAGAGCAGGAGGATGG - Intergenic
908897662 1:68918680-68918702 GAAGGTGAAGAGGAGGAAGAGGG + Intergenic
909020547 1:70426294-70426316 GGAAGAAAAGAGCAGGAAGAAGG - Intronic
909095523 1:71283027-71283049 GAGGGTGAAGGGTGGGAAGAGGG - Intergenic
909127701 1:71695519-71695541 GAGGGAAAACAGTAGGAAAAAGG - Intronic
909442886 1:75717461-75717483 GAGGGTGGAGGGTAGGAAGAGGG + Intergenic
909686539 1:78355188-78355210 GAGGGAGAAGAGGAGGAAGAGGG - Intronic
910018353 1:82554391-82554413 GAGGGTGGAGAGCAGGAGAAGGG - Intergenic
910049072 1:82955774-82955796 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
910355977 1:86355673-86355695 GAGGGTGGAGAGTGGGAAGAGGG - Intronic
911047233 1:93638673-93638695 CATGGTAAACAGCAGGAGGAAGG + Intronic
911167599 1:94738094-94738116 GAGGGAGAAGGGTAGGAAGATGG - Intergenic
911306276 1:96236360-96236382 GAGGAAATAGAGCAGTAAGAAGG - Intergenic
911340214 1:96627131-96627153 GAGGGTAGAGGGTGGGAAGAAGG + Intergenic
911548589 1:99252089-99252111 GAGGGTGAAGGGTGGGAAGAGGG + Intergenic
912016350 1:105041432-105041454 GAGGGAATTGAGCAGGAAAACGG + Intergenic
912151882 1:106869635-106869657 GAGGGTGAAGAATGGGAAGAGGG - Intergenic
912255745 1:108056190-108056212 GAGGGTAGAGGGTGGGAAGAGGG + Intergenic
912308442 1:108595284-108595306 AAGAATAAAGAGAAGGAAGAAGG + Intronic
912520834 1:110243614-110243636 GAAGATGAAGAGGAGGAAGAGGG + Intronic
912569809 1:110613235-110613257 GTGGGTGGAGACCAGGAAGAGGG - Intronic
912744977 1:112238644-112238666 GAAGGAAATGAGGAGGAAGATGG - Intergenic
912776700 1:112510066-112510088 GATGGGAAAGAATAGGAAGAAGG - Intronic
912804009 1:112741785-112741807 GAGGGGAAGGAGGAGGATGAGGG + Intergenic
912869106 1:113287596-113287618 GAAGGTACACTGCAGGAAGAAGG + Intergenic
912957154 1:114163329-114163351 GAGGGTAAAGAGTGGGAGGAGGG + Intergenic
913461212 1:119087843-119087865 AAAAGTAAAGAGCAGAAAGAAGG + Intronic
913534239 1:119755990-119756012 GAGGAACAGGAGCAGGAAGATGG - Intronic
913607005 1:120475910-120475932 GAGGGGAAAGAGCAGACAGGAGG - Intergenic
913988337 1:143585697-143585719 GAGGGGAAAAAGCAGACAGAAGG + Intergenic
914209428 1:145564234-145564256 GAGGGGAAAGAGCAGACAGGAGG + Intergenic
914268348 1:146056602-146056624 GAGGGGAAAGAGCAGACAGGAGG + Intergenic
914368747 1:147004259-147004281 GAGGGGAAAGAGCAGACAGGAGG - Intergenic
914584187 1:149045928-149045950 GAGGGGAAAGAGCAGACAGGAGG + Intronic
915647802 1:157286283-157286305 GAGGGTGAGGAACAGGGAGAAGG + Intergenic
915818302 1:158993675-158993697 GAGGGTAGAGAGTTGGAGGAGGG - Intergenic
915984337 1:160448749-160448771 GAGGGCAAGGAGGAGGAGGAGGG - Intergenic
915989870 1:160503145-160503167 GAGGGTAAAGGGGAAGAAGTTGG + Intronic
916124176 1:161554536-161554558 GAGGGTGGAGGGTAGGAAGAGGG + Intergenic
916180125 1:162076213-162076235 GAGGGTAGACAGCAGGACAAGGG - Intronic
916722682 1:167496571-167496593 GCGGGCAGAGAGTAGGAAGAAGG + Intronic
916881241 1:169021492-169021514 GAGGGTGAAGGGTAGGAGGAGGG - Intergenic
916946839 1:169737809-169737831 GAGGGGAAAGAGCAAGCAGGAGG - Intronic
917149229 1:171927389-171927411 GAGGGTGGAGAGTGGGAAGAGGG - Intronic
917193912 1:172446704-172446726 GAGGGTGGAGATCAGGGAGAAGG + Intronic
917236713 1:172900565-172900587 GGTGGTAAAGAGAAGGAAGTTGG - Intergenic
917253072 1:173083608-173083630 CAGGGTAGAGAGTAGGAGGAGGG + Intergenic
917268121 1:173243351-173243373 GAGGGTAAGGGGCTGGAAAATGG - Intergenic
917881328 1:179339488-179339510 GAGGATAAAGAGAATGAGGAGGG - Exonic
917921850 1:179757261-179757283 GAGGGGAAAGCACAGGCAGAGGG + Intronic
918302695 1:183218602-183218624 GAGGACAGAGAGCAGGAAGAAGG - Intronic
918714690 1:187770692-187770714 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
918735755 1:188061020-188061042 GAGGGAAGAGAGAGGGAAGACGG - Intergenic
919626976 1:199920676-199920698 GAGGGTGAAGGGTAGGAGGAGGG - Intergenic
919728418 1:200898360-200898382 GAGGGCACAGAGCAGGGAGGGGG - Exonic
919728576 1:200899151-200899173 GAAGGAAAAGAGGAAGAAGAAGG + Intronic
919931102 1:202222135-202222157 GAGCGTGCAGAGCTGGAAGAGGG - Intronic
919968447 1:202553607-202553629 GAGTGTACAGAGGAGGAGGATGG + Intronic
919995525 1:202745174-202745196 GAGGGTGGAGGGCAGGAGGAGGG + Intronic
920087644 1:203429434-203429456 GAGGGCAAGGAGCAGGTACAAGG - Intergenic
920360875 1:205415270-205415292 GAAGGGAAAGAGAAGGAAAAGGG + Intronic
920492889 1:206431755-206431777 GAGGGGATGGAGAAGGAAGAGGG + Intronic
920632538 1:207666701-207666723 GAGGGTAGAGGATAGGAAGAGGG + Intronic
920687787 1:208122721-208122743 GGGGGAAGAAAGCAGGAAGAAGG + Intronic
920815043 1:209323456-209323478 GAGGGTAAGGAGAAGAAAGGTGG - Intergenic
921012362 1:211155102-211155124 GAGGGTAGAGAGCGGGAGGAGGG - Intergenic
921236648 1:213138501-213138523 GAGGGTAAAGGGTGGGAGGAGGG - Intronic
921501733 1:215912798-215912820 GAGGGTGAAGGGTGGGAAGATGG - Intronic
921933583 1:220775669-220775691 GAGGGTGGAGAGTAGGAAGAGGG - Intronic
921963693 1:221064804-221064826 GAGGGGAAGGAAGAGGAAGAAGG - Intergenic
921975592 1:221199536-221199558 GAGGACAAAGAGTAGGAGGAGGG + Intergenic
922071532 1:222199308-222199330 GAGGGTAGAGAGTCGGAGGAGGG - Intergenic
922334456 1:224607366-224607388 AAGGGAAAAGAGCAGGCAGCAGG + Intronic
922606730 1:226894240-226894262 GAGGGACAAGAGCAGGGAGCGGG + Intronic
922993771 1:229939841-229939863 GAGGGTAAAGAACGGAGAGAGGG + Intergenic
923688079 1:236167850-236167872 GAAGGTGAAGAGGAGGCAGAAGG - Intronic
924184705 1:241475957-241475979 GAGGGCAAAGATCAAGAAGGAGG - Intergenic
924205736 1:241709691-241709713 GAGGGTAAAGAGAAATAAAAAGG + Intronic
924350001 1:243105707-243105729 AAGGGGAAAGAGCAGCAGGAGGG + Intergenic
924388844 1:243528465-243528487 GAGGGTGGAGGGCAGGAGGAAGG - Intronic
924454326 1:244206486-244206508 GTGGGTGGAGAGGAGGAAGAAGG - Intergenic
924819737 1:247477332-247477354 GAGGGTGAAGGGTAGGAAGAGGG + Intergenic
924944391 1:248836612-248836634 GGGGGGAAAGAACAGGAAGCTGG - Intergenic
924952193 1:248895372-248895394 AAGGACAAAGAGGAGGAAGAAGG + Intergenic
1063273811 10:4541587-4541609 CAGGCTCAAGAGCAGCAAGAGGG - Intergenic
1063407948 10:5813954-5813976 GAGGGCACAGAGCGGGAAAAAGG - Intronic
1064218208 10:13417933-13417955 GACAGCAAAGAGAAGGAAGAGGG - Intergenic
1064231182 10:13529856-13529878 GAGGGTAAAGAGTCGGGGGATGG + Intergenic
1065305784 10:24367239-24367261 GAGGGAAAGGTGCAGGATGAGGG - Intronic
1065406646 10:25373286-25373308 GAAGGTGGAGAGCGGGAAGATGG + Intronic
1065862681 10:29885097-29885119 GAGGGTGGAGGGCAGGAGGAGGG - Intergenic
1065916592 10:30358524-30358546 GAAGGGAAAGGGGAGGAAGATGG - Intronic
1066214399 10:33272497-33272519 GAGGAGAAAGAGGAGGAGGAGGG + Intronic
1066540398 10:36440569-36440591 GAGGGCAAAGAGGATGAAAAAGG - Intergenic
1066694879 10:38068822-38068844 GAGGATAAAGAGGAGGAGTACGG + Intergenic
1067574311 10:47398775-47398797 GAGTGTAAAGAGAAGGAAATTGG + Intergenic
1067716411 10:48694284-48694306 GAGGGATATGAGCAGGAACAGGG - Intronic
1067924531 10:50494626-50494648 GAGGGTAGAGGGTAGGAGGAGGG + Intronic
1067935446 10:50608339-50608361 GAGGGGAAAGAGAAGGAAAAGGG + Intronic
1068354328 10:55891028-55891050 GAGGCTGAAAAGCAGGAAAACGG + Intergenic
1069344381 10:67450630-67450652 GAGGGTAGAGAGTAGGAGGAGGG + Intronic
1069811083 10:71160258-71160280 TAGACTAAAGAGCATGAAGAAGG - Intergenic
1069816968 10:71203243-71203265 GAGGAAACAGAGCAGGAACATGG + Intergenic
1070270298 10:74947661-74947683 AAGGGTAAACTGTAGGAAGAAGG - Intronic
1070476810 10:76836841-76836863 GAGGGCAAAGAGGATGAGGAAGG - Intergenic
1070767072 10:79062916-79062938 GGGGGTTAAGACAAGGAAGACGG + Intergenic
1071163195 10:82776521-82776543 GAGGGTAAAGAGATGGAAAAAGG - Intronic
1071203798 10:83251655-83251677 GAGAGAAAAGAGGAAGAAGAAGG + Intergenic
1071229785 10:83572110-83572132 GAGAGGAAAGAGAGGGAAGAAGG + Intergenic
1071290351 10:84184634-84184656 GAGGGACAAGGACAGGAAGATGG - Intronic
1071441609 10:85702880-85702902 GAAGGAAAAGAGGAGGAAGACGG + Intronic
1071472216 10:85991687-85991709 GAGGGGAAAGAGCAGAAAATTGG + Intronic
1071476594 10:86030904-86030926 GCTGGCAAAGAGAAGGAAGATGG - Intronic
1071771561 10:88734607-88734629 GAGGGTAAAGGACATCAAGAAGG + Intronic
1071877793 10:89861436-89861458 GAGGGGGAAGAGGAGGAGGAGGG - Intergenic
1072284754 10:93903489-93903511 CAAGGTAAAGAACTGGAAGAGGG - Intronic
1072306866 10:94116090-94116112 GAGAGGAAGGAGCAGGAGGAAGG - Intronic
1072367996 10:94733946-94733968 GAGGGGAAAGCGCAGGATGTTGG + Intronic
1072639587 10:97201878-97201900 GAGGGTGAAGAGGAGGGAGCAGG - Intronic
1072881966 10:99236627-99236649 TAGGGCAAAGAGTAGCAAGAAGG + Intergenic
1072889127 10:99306271-99306293 GAGGGTAAAATGGAGGAGGAGGG - Intergenic
1073371645 10:102995153-102995175 GAGGGGGAGGAGGAGGAAGAGGG - Intronic
1073371652 10:102995171-102995193 GAGGGGGAGGAGGAGGAAGAGGG - Intronic
1073511896 10:104047719-104047741 CAGGTAACAGAGCAGGAAGAGGG - Exonic
1073542269 10:104323883-104323905 CACAGTAAAGAGCAGGAAGGTGG - Intronic
1073547196 10:104360624-104360646 GAGGGTGAAGAGTAGGAGGAGGG - Intronic
1073809010 10:107132150-107132172 GAGAGAAAAGAGAAAGAAGAGGG - Intronic
1074163931 10:110858384-110858406 GAAGGTTGAGAGCAGGCAGAGGG - Intergenic
1074189668 10:111124788-111124810 GAGGGAAGAGAGCAGGAAACTGG + Intergenic
1074220844 10:111436385-111436407 GAGGGGAAGGAGCACCAAGATGG - Intergenic
1074390765 10:113056392-113056414 GAGGGTAGAGGACAGAAAGAAGG + Intronic
1074614545 10:115054103-115054125 GAGGGCAAAGAGGAAGAGGAGGG - Intergenic
1074732160 10:116390739-116390761 GAGGAGAAGGAGGAGGAAGAAGG + Intergenic
1074813929 10:117130893-117130915 AAGGAGAAAGAGCAGGAAGCTGG + Intronic
1075638790 10:124049622-124049644 GAGGGTGGAGTGGAGGAAGAGGG + Intronic
1076074326 10:127521287-127521309 GAGGGTGGAGGTCAGGAAGAGGG + Intergenic
1076077507 10:127547154-127547176 GAAGGTAAAGAGAAGGAATCAGG - Intergenic
1076114608 10:127886585-127886607 GAGAGAAAAGGGCAGGAGGAGGG + Intronic
1076209953 10:128632409-128632431 GAGGGTGCGGAGCAGGTAGAAGG + Intergenic
1076318900 10:129564261-129564283 GAGGGGGAAGAGGAGGAGGAAGG - Intronic
1076368900 10:129939248-129939270 GAGGGTGGAGGGCAGGAAGGAGG - Intronic
1076556383 10:131324230-131324252 GATGATAAAGAACATGAAGAGGG + Intergenic
1076882374 10:133245810-133245832 GAGGGGAAAGATCAGGCAGCAGG - Intergenic
1077010468 11:377047-377069 GAGGGCGAAGAGGAGGAGGAAGG + Exonic
1077150767 11:1072172-1072194 GAGGGAAAGGAGGAGGAGGAAGG - Intergenic
1077159991 11:1108314-1108336 GAGGGAAAAGGGCAGGCTGAAGG - Intergenic
1077546917 11:3175915-3175937 GAGGGAGAAGGGCAGGAAGTAGG + Intergenic
1078128137 11:8588049-8588071 GAGAGGACAGAGCAGGAAGATGG - Intronic
1078593369 11:12665212-12665234 GAGGAGGAAGAGGAGGAAGAAGG + Intergenic
1079097010 11:17517480-17517502 CAGGGAAAAGAGGAGGAAGCTGG + Intronic
1079562274 11:21836923-21836945 GAGGGCCAAGAGCAGAAACAGGG + Intergenic
1079986974 11:27209885-27209907 GTGTGTAAAGAGGAGGAAGATGG + Intergenic
1080018675 11:27535234-27535256 GAGGGTAGAGAGTGGGAAGCGGG - Intergenic
1080091315 11:28352618-28352640 CAGGGTAAGGAGCAGGAATAAGG - Intergenic
1080246951 11:30189980-30190002 GAGGGTAGAGATCAGGAGGAGGG - Intergenic
1080425893 11:32154018-32154040 TAGTGTACAGGGCAGGAAGAAGG + Intergenic
1080944632 11:36957886-36957908 TAGGGTGAAGAGGAGAAAGATGG + Intergenic
1082101753 11:48178576-48178598 GAGGGTGAAGGGTAGGAGGAGGG + Intergenic
1082717676 11:56634947-56634969 GAGGGAGAAGAGGAGGAACAAGG - Intergenic
1082992728 11:59222181-59222203 GAGGGTTAGGAACAGGGAGAGGG - Intergenic
1083337386 11:61931655-61931677 GAAGGCAAGGAGGAGGAAGAAGG + Intergenic
1084470413 11:69356174-69356196 GAGGATGAAGAGAAGGAAGGAGG + Intronic
1084859528 11:72009217-72009239 GAGGTTGAAGGGCAGGAGGAAGG + Intronic
1084863872 11:72040349-72040371 GAGGGTCCAGATCAGGATGATGG + Intronic
1085649979 11:78259015-78259037 GAGGGTAGAGGGTAGGAGGAGGG - Intronic
1086020530 11:82224152-82224174 GAGGGTGAAGAGTGGGAGGAGGG - Intergenic
1087261780 11:96020238-96020260 GAGGGGAAAAAGCAGCAAAAGGG - Intronic
1087296001 11:96374753-96374775 GAGGGTGGAGAGTAGGAGGAGGG - Intronic
1087498734 11:98923655-98923677 GAGGGAAAGGAAGAGGAAGAAGG - Intergenic
1087666361 11:101053624-101053646 GAGGGAAGAAAGGAGGAAGAAGG - Intronic
1087673159 11:101129112-101129134 GAGGGAAAAGGGAAGGAGGAGGG + Exonic
1088178349 11:107080448-107080470 GAGGGTAAAGGGTGGGAAGAGGG - Intergenic
1088442428 11:109886209-109886231 GAGGGTAAAGGGTGGGAGGAGGG + Intergenic
1088508291 11:110548360-110548382 GAGGGTGAAGGGTAGGAGGAGGG + Intergenic
1088618795 11:111661345-111661367 GAGGGAAAAGAAAAGGAAGCAGG + Intronic
1088762995 11:112949857-112949879 GAGGGTAAGGAGCAAGAGGTGGG + Intergenic
1088934206 11:114382515-114382537 GAGGGTAGAGGGTGGGAAGAGGG - Intergenic
1089162471 11:116449923-116449945 AGGGGTAAAGAACAGGGAGAAGG + Intergenic
1089240216 11:117071559-117071581 AAGGATAAATAGAAGGAAGAAGG + Intronic
1089445068 11:118545433-118545455 GAGGGAAAAGAGCAGATGGAGGG + Exonic
1089730742 11:120517299-120517321 GAGGGTGAAGAGCAGCCAGAGGG + Intronic
1089748330 11:120632594-120632616 GAGCTGCAAGAGCAGGAAGAAGG - Intronic
1089759879 11:120715556-120715578 GAGGGGAAAGAGGAGAGAGAGGG - Intronic
1089763985 11:120749654-120749676 GAGGACAGACAGCAGGAAGATGG + Intronic
1090244442 11:125205822-125205844 GAGGGTAAAGTCCTTGAAGATGG - Intronic
1090445754 11:126763413-126763435 GGGGGAGAAGAGCAGGGAGAGGG + Intronic
1090529377 11:127574839-127574861 CAGGGAAAAGACCAGAAAGACGG + Intergenic
1090541866 11:127715526-127715548 AAAAATAAAGAGCAGGAAGAAGG - Intergenic
1090705207 11:129329878-129329900 GAGAGGAGAGAGCAGGAAGAGGG + Intergenic
1090887603 11:130892967-130892989 GAGGGGAAAGGGCAGGGAGAGGG + Intronic
1090952262 11:131484050-131484072 AAAGGTAATGAGCAGGAGGAGGG + Intronic
1091123316 11:133075014-133075036 GAGGGCAGAGAGCAGAAAGAAGG + Intronic
1091545077 12:1496178-1496200 GAGGGTAGAAAGAAGGAAAAAGG - Intergenic
1091603128 12:1929918-1929940 GAGGGGGAGGAGGAGGAAGAGGG + Intergenic
1091779839 12:3206914-3206936 GAGGGTCCAGGGCAGGGAGAAGG + Intronic
1092158882 12:6304188-6304210 GAGGGGGAAGATCAGGAAGAGGG + Intergenic
1092207034 12:6621030-6621052 GAGGGTGAAGAGCAGGTCGCTGG + Exonic
1092245260 12:6860518-6860540 GCGAGTAAATTGCAGGAAGATGG - Intronic
1092601748 12:10073781-10073803 GAGGGAAAAGTGCAGGAATGAGG + Intronic
1093182974 12:15988192-15988214 GCAGGTAACGAGAAGGAAGAAGG - Intronic
1093268289 12:17026861-17026883 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
1093466656 12:19456465-19456487 GTTGGTAAAAAGCTGGAAGATGG - Intronic
1093530403 12:20155046-20155068 GAGGGGGAAGAGAAAGAAGAAGG + Intergenic
1094205197 12:27832276-27832298 GAGGGTGAAGAGCGGGAGGAGGG - Intergenic
1094262288 12:28514866-28514888 GAGGGTAGAGGGTGGGAAGAGGG + Intronic
1094321599 12:29189988-29190010 GAGGGGAAATAGAAGGATGAAGG + Intronic
1094404834 12:30106433-30106455 GAGGCTACAGAGAAGGAAGCTGG - Intergenic
1094478149 12:30858295-30858317 GAGGGTGAAGGGCGGAAAGAGGG - Intergenic
1095463866 12:42470226-42470248 GAGGTAAAATAGCAGGAAGAAGG - Exonic
1095519545 12:43046291-43046313 GAGAGTAGAGGGCAGGAGGAGGG + Intergenic
1095585295 12:43843163-43843185 GAGGGGGAAGAGGGGGAAGAGGG - Intronic
1096183234 12:49562516-49562538 GTGGGAAAAGAAGAGGAAGAAGG + Intronic
1096400651 12:51303511-51303533 GAGGGTTCAGAGAAAGAAGAAGG - Intronic
1096638281 12:52975036-52975058 GAGGAGAAGGAGCAGGGAGAGGG + Intergenic
1096665179 12:53159784-53159806 GAGGGAAAAGGGCAGGGAGAGGG - Intronic
1096912092 12:54994695-54994717 GAGGGTAATGAGTGGGAGGAGGG - Intergenic
1096929519 12:55191155-55191177 GAGGGTAGAGGGTAGGAGGAGGG - Intergenic
1097052025 12:56229411-56229433 GAGGAAAGAGAGCAGGCAGAGGG - Exonic
1097220853 12:57450208-57450230 GAGGGTAGTGGTCAGGAAGATGG - Exonic
1097384640 12:58934754-58934776 GAGTGGGAAGAGCAGGAGGAGGG - Intergenic
1097426633 12:59453787-59453809 CAGGAGAAAGAGCAGGAATAAGG + Intergenic
1097996785 12:65896547-65896569 CAGGGAGAAGAGGAGGAAGAAGG - Intronic
1098035478 12:66297518-66297540 GAGGGAGAAGAGAAGGAAGGAGG + Intergenic
1098196331 12:68005692-68005714 GATGGGAAAGAGTGGGAAGAAGG + Intergenic
1098519207 12:71416735-71416757 GAGGTTGAAGAGTAGGGAGAGGG + Intronic
1098574564 12:72026621-72026643 GAGAAGAAAGAGCAGGAGGAAGG - Intronic
1099079426 12:78157810-78157832 GAGGAGAAAAAGAAGGAAGAGGG + Intronic
1099185206 12:79508780-79508802 AAGCGAATAGAGCAGGAAGATGG + Intergenic
1099393736 12:82112275-82112297 GAGGGTGAAGCGCGGGACGAGGG + Intergenic
1099421506 12:82467882-82467904 GAAGGAAAAGAGAAGGAAAAGGG - Intronic
1099438614 12:82672960-82672982 GAGGAGGAAGAGCAGGAAGAGGG - Intergenic
1099680112 12:85816154-85816176 GAGGGTAGAGAGTGGGAGGAGGG + Intronic
1099868076 12:88309543-88309565 GAGGAGAAAGAGAAGGAGGAGGG - Intergenic
1100344003 12:93709403-93709425 GAGGGGAGAGGGTAGGAAGAGGG - Intronic
1100804521 12:98267579-98267601 GAGGGAAAAGAGCAAGAGAAAGG + Intergenic
1100845218 12:98651513-98651535 TAGGGTAATGAGCAGTAAAATGG - Intronic
1101241968 12:102848068-102848090 CAGGGTAATGAGCAGATAGATGG + Intronic
1101703752 12:107200412-107200434 GAGGCTGAAGTGCAGGAGGATGG - Intergenic
1101759104 12:107644720-107644742 GAGGGTAAAGGGTGGGAGGAGGG - Intronic
1103037339 12:117667198-117667220 CAGGGGAAAGAGCAGGAACTGGG + Intronic
1103164029 12:118754817-118754839 GAGGGTAGAGAGCAGAAAGCTGG - Intergenic
1103617313 12:122162514-122162536 GAGGGAAAAGAGGAGGGAGCAGG - Intergenic
1103661931 12:122527080-122527102 GAGTGTAAAGACCGTGAAGAGGG + Intergenic
1103819955 12:123689653-123689675 GAGGGTAGTGAGTAGGAGGAGGG - Intronic
1103826507 12:123743288-123743310 CAGGGTCAAGAGCAGCCAGAGGG - Intronic
1103896614 12:124277667-124277689 GAGGAGAAAGAGGAGGAAGGGGG - Intronic
1103896677 12:124277903-124277925 GAGGCAGAAGAGGAGGAAGAGGG - Intronic
1104239601 12:126975078-126975100 CAGGGTGCAGAGCAGGAAGTAGG + Intergenic
1104298038 12:127536392-127536414 GAGGGTGGAGGGCAGGAGGAGGG + Intergenic
1104619199 12:130298119-130298141 GAGGGTAGAGGGTAGGAAGAGGG - Intergenic
1104665300 12:130643365-130643387 GAGGATGAAGGGCAGGAAGGCGG + Intronic
1104693670 12:130847161-130847183 GAGGGTAGAGGGTAGGAGGAGGG - Intergenic
1104753633 12:131255473-131255495 GAAGGTAAAGAGCAGGGAAGAGG - Intergenic
1104768688 12:131346580-131346602 GAGGGAAAAGAGCCGGACTACGG + Intergenic
1104844070 12:131838170-131838192 GAGGGCAGAGAGCAGGGTGAGGG - Intronic
1105322377 13:19340045-19340067 TAGGGTAAAGGGCAGCAATAGGG - Intergenic
1105387384 13:19943955-19943977 GAGGGGAATGAGAAGGGAGATGG + Intergenic
1105875294 13:24547086-24547108 TAGGGTAAAGGGCAGCAATAGGG + Intergenic
1106041360 13:26096840-26096862 AAGGAGAAAGAGAAGGAAGAGGG - Intergenic
1106206766 13:27604417-27604439 GAGGGTAAAGAATAAGAATAAGG + Intronic
1106255579 13:28019607-28019629 GTGGGCAAAGTGCAGGTAGATGG - Intronic
1106299927 13:28454088-28454110 CTGGGGAAAGAGCAGTAAGAGGG - Intronic
1106481212 13:30138316-30138338 GAGGGTAAAAAGAGGGAAAAGGG + Intergenic
1106776084 13:33011157-33011179 CAGAGTAACGAGCAGGGAGATGG + Intergenic
1106865809 13:33962361-33962383 GAGAGTAAAGAACAGAAAAATGG - Intronic
1107002376 13:35564026-35564048 GAGGGTAGAGGGAAGGAGGAAGG - Intronic
1107230987 13:38110213-38110235 GAGGGTAAAGAGCGGGAGAAGGG + Intergenic
1107287834 13:38815733-38815755 GAAGGTAAAGAGGAGCCAGAAGG + Intronic
1107336550 13:39361913-39361935 GAGGGAAAAGGGCAGGAGGGAGG + Intronic
1107533764 13:41308866-41308888 GAGGGTGGAGAGTAGGAGGAGGG - Intergenic
1107651797 13:42552439-42552461 GAGGAGAAAGAACAGGGAGAGGG + Intergenic
1107671390 13:42749941-42749963 GATGGTAAACAGCAGCAGGATGG - Intergenic
1107930618 13:45304318-45304340 GGGGTGCAAGAGCAGGAAGATGG + Intergenic
1108141650 13:47428922-47428944 CAGGCTGAAGAGCAGGAAGGAGG + Intergenic
1108426207 13:50303975-50303997 GAGGGTAGAGAGCAGGAGGAAGG - Intronic
1109038365 13:57296456-57296478 GAGGGTGGAGGGTAGGAAGAGGG + Intergenic
1109374818 13:61478603-61478625 GAGGGTAAAGGGAGGGAGGAAGG - Intergenic
1109476913 13:62891423-62891445 GAGGGTAAAGGGGAGAAAGAAGG - Intergenic
1110281402 13:73698193-73698215 GAGGGGAAAGGGAAGGAGGAGGG + Intronic
1110442721 13:75543175-75543197 GAGGGTAGAGAGTGGGAGGAAGG + Intronic
1110582494 13:77147552-77147574 AAGGGTAGAGAGAAGGAAGGGGG - Intronic
1110811548 13:79816799-79816821 GAGGGTAGAGAGTGGGAGGAAGG - Intergenic
1111232216 13:85358460-85358482 GAGGGTAAAAGGTAGGAGGAGGG + Intergenic
1111639159 13:90946353-90946375 GAGGAGGAAGAGGAGGAAGATGG + Intergenic
1112059991 13:95729314-95729336 GAGGGAAAAGGACAGGGAGAGGG - Intronic
1112214173 13:97413025-97413047 GAGCTTAAAGAGGAAGAAGAGGG - Intergenic
1112523913 13:100124672-100124694 GAGGGTAATGATCAGGTAAATGG + Intronic
1112682441 13:101782529-101782551 GAGGGTGAAGGGTAGGAGGAGGG - Intronic
1112782695 13:102918575-102918597 GAGGGTAAAGGGTGGGAGGAGGG - Intergenic
1113206025 13:107917028-107917050 GAGGGTGGAGAGTAGGAGGAGGG - Intergenic
1113350809 13:109527379-109527401 GAGGGAAAAAAGAAGGAAAAGGG - Intergenic
1113909876 13:113836721-113836743 GAGGGGAATGAGGAGGAGGAGGG + Intronic
1114161118 14:20168792-20168814 GAGGATAAAGAGGAGGGAGATGG + Intergenic
1114231332 14:20785664-20785686 GGGGGGGAAGAACAGGAAGAAGG + Intergenic
1114455149 14:22849160-22849182 AAGGGGAAAGAGGTGGAAGATGG + Intergenic
1114563734 14:23612549-23612571 GAGGGGAAAGTGCAGTAGGATGG + Intergenic
1114654406 14:24307563-24307585 GAGTGTAAAGGGCATGATGAGGG + Exonic
1114901924 14:27072279-27072301 GAGGGGAGAGGGCAGGAGGAGGG + Intergenic
1114906408 14:27133272-27133294 GAGGGTAAGGAGAAGGGGGATGG - Intergenic
1115350948 14:32395171-32395193 GAGGTGAAAGAGAAAGAAGATGG - Intronic
1115353685 14:32424644-32424666 GAGGGTAGAGAGTAGGGGGAGGG - Intronic
1115940556 14:38603746-38603768 GAGGGTAGAGAGTGGGAGGAGGG - Intergenic
1116475137 14:45331204-45331226 GAAGGAGAAGAGGAGGAAGAAGG - Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1116967041 14:51025774-51025796 TAGAGTAAAGAACAGGATGAAGG + Intronic
1117033343 14:51699185-51699207 GAGGCTAAAGAGCATGGAGCAGG + Intronic
1117251178 14:53940279-53940301 GTGGTTAAAGAACAGAAAGAAGG + Intergenic
1118041566 14:61922531-61922553 GAGGGTAGAGAGTAGGAGGAGGG + Intergenic
1118428039 14:65688872-65688894 GAAGGTAAACACCAGGAAGAAGG - Intronic
1118509354 14:66453958-66453980 GAGGGTAGAGAGCAAGGGGAGGG + Intergenic
1118581808 14:67308078-67308100 GAGGGTAGAGGGCAGGGGGAGGG + Intronic
1118583170 14:67325242-67325264 GAGGGTGAAGAGGAAGAGGAAGG - Intronic
1118656244 14:67952706-67952728 GAGGAAAAGGAGAAGGAAGAGGG + Intronic
1118766363 14:68912175-68912197 GATGGCAAAGCGCAGGATGATGG + Exonic
1118979071 14:70701601-70701623 TAGGGAAAAGAGGGGGAAGAGGG + Intergenic
1119180390 14:72601062-72601084 GAGGGGGAGGAGGAGGAAGAAGG + Intergenic
1119230748 14:72977578-72977600 GAGGAAAAAAAGCAGGAAAAAGG + Intronic
1119276589 14:73362379-73362401 GAGGGAAAAGAGGAGGAAAAGGG + Intronic
1119316864 14:73703820-73703842 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
1119557111 14:75561751-75561773 GAGGGTGGAGGGCAGGAAGAGGG - Intergenic
1119833119 14:77721612-77721634 GAGGGTAAAGTACATGTAGAAGG - Intronic
1119856980 14:77908269-77908291 GAGAGAGAAGGGCAGGAAGAGGG - Intronic
1119996831 14:79262438-79262460 GAGGAGAAAGAGGAGGAGGAAGG + Intronic
1120030877 14:79639358-79639380 GAGGGTAGAGGGTAGGAGGAAGG - Intronic
1120111021 14:80556512-80556534 GAGGGAAAAGTTGAGGAAGACGG + Intronic
1120484852 14:85100230-85100252 GAGGCTAAGGAGGAGGAAGAGGG + Intergenic
1120525162 14:85568918-85568940 GAGGGAAAAGAGGAGACAGACGG - Intronic
1120827511 14:88969058-88969080 AAGGGGAAACAGCAGGAACAAGG - Intergenic
1120901770 14:89581577-89581599 GAGGGAAAAGAGCAGGTACCGGG - Intronic
1120913673 14:89690743-89690765 AAGGGCAAAGAGGAGGAAGCAGG + Intergenic
1121343463 14:93118330-93118352 GAGGGAAATGGGAAGGAAGATGG + Intergenic
1121676998 14:95761515-95761537 GAGGGTGAAGAACACGAAGTGGG + Intergenic
1121724925 14:96140274-96140296 GAGGGTAAAGAGAAGGGAGATGG - Intergenic
1122996416 14:105267735-105267757 GAGGGAGAGGAGCAGGAACAAGG + Intronic
1123009150 14:105338849-105338871 GAGGGAGAAGAGCGGGGAGATGG - Intronic
1123626708 15:22232160-22232182 GAGGGGAAGGCGCATGAAGATGG + Intergenic
1123684287 15:22786532-22786554 GTGGGGGAGGAGCAGGAAGAGGG - Intronic
1124490271 15:30151093-30151115 GAAGGGAAAGGGGAGGAAGATGG + Intergenic
1124534071 15:30529389-30529411 AAGGCTAAAAAGAAGGAAGAGGG - Intergenic
1124647668 15:31450426-31450448 GAAGGGAAAGGGAAGGAAGACGG + Intergenic
1124653281 15:31488154-31488176 AAGGGTAAACACCAGGCAGAAGG + Intronic
1124753262 15:32387236-32387258 GAAGGGAAAGGGGAGGAAGATGG - Intergenic
1124764576 15:32478221-32478243 AAGGCTAAAAAGAAGGAAGAGGG + Intergenic
1124877942 15:33613157-33613179 GTGAGGAAAGAACAGGAAGAAGG - Intronic
1124902615 15:33838359-33838381 GCGGGTGAAGAGGAAGAAGACGG + Exonic
1124957730 15:34370763-34370785 AAGGGAAAGGAGGAGGAAGAAGG - Intergenic
1124971975 15:34496588-34496610 GAAAGGAAAGAGGAGGAAGACGG - Intergenic
1124975002 15:34522936-34522958 GAAGGGAAAGGGGAGGAAGATGG - Intergenic
1125511840 15:40296408-40296430 GAGGGCAAAGAAGAGGAGGATGG + Intronic
1125622961 15:41080932-41080954 GACGGACAAGAGCAGCAAGATGG + Intronic
1125635878 15:41188318-41188340 GAGGGGGAAGAGGAGGGAGAGGG - Intronic
1125850127 15:42895343-42895365 GAGGGTACAGGGTAGGAAGTGGG + Intronic
1126227125 15:46284042-46284064 GAGGGTAGAGGGCCGGAGGAGGG - Intergenic
1126442502 15:48705106-48705128 GAGGGTGAAGAGTGGGAAAAGGG + Intergenic
1126778656 15:52119925-52119947 GAGGTAGAAGAGCGGGAAGAGGG + Exonic
1126860701 15:52879974-52879996 GAGCAGAAAGAGAAGGAAGAGGG - Intergenic
1126872997 15:53009764-53009786 TAGGGGAAAGAGCAGAAACATGG + Intergenic
1127269885 15:57390893-57390915 GAGGGCAAAGAGGACAAAGAAGG + Intronic
1127343118 15:58066605-58066627 GAGGGGAAACAGCCGGAAGAGGG - Intronic
1127490026 15:59453775-59453797 AAGGGAGAAGAGCTGGAAGAGGG + Intronic
1127996568 15:64156375-64156397 AAGGGTGAGGAGGAGGAAGAGGG + Exonic
1128142710 15:65313459-65313481 CAGGGAAAAGAACATGAAGATGG - Intergenic
1128408031 15:67363701-67363723 GAGGGTGGAGGGTAGGAAGAGGG - Intronic
1128613838 15:69094264-69094286 GAGGGAAAAAGGAAGGAAGAAGG + Intergenic
1128698172 15:69784450-69784472 AGGGGGAAAGAGTAGGAAGAGGG - Intergenic
1128982775 15:72198775-72198797 GATGGGAAAGAGCAGGGACAAGG - Intergenic
1129210437 15:74064983-74065005 GAAGGAAAAGGGGAGGAAGATGG - Intergenic
1129403578 15:75300390-75300412 GAAGGAAAAGGGGAGGAAGATGG + Intergenic
1129727630 15:77909614-77909636 GAAGGGAAAGGGGAGGAAGATGG - Intergenic
1129840257 15:78739356-78739378 GAAGGGAAAGGGGAGGAAGATGG + Intergenic
1129983997 15:79900322-79900344 GAAGGGAAAGAGGAAGAAGAGGG - Intronic
1130243461 15:82220520-82220542 AAAGGCAAAGAACAGGAAGAAGG + Intronic
1130275938 15:82476398-82476420 GAAGGGAAAGGGGAGGAAGATGG - Intergenic
1130408507 15:83624421-83624443 AAGCGCAAAGAGCAGGAAGCGGG + Intergenic
1130457006 15:84120760-84120782 AAAGGCAAAGAACAGGAAGAAGG - Intergenic
1130468299 15:84203790-84203812 GAAGGGAAAGGGGAGGAAGATGG - Intergenic
1130485450 15:84395964-84395986 GAAGGGAAAGGGGAGGAAGATGG + Intergenic
1130490299 15:84426028-84426050 GAAGGGAAAGGGGAGGAAGATGG - Intergenic
1130495967 15:84469752-84469774 GAAGGGAAAGGGGAGGAAGATGG + Intergenic
1130590592 15:85208388-85208410 GAAGGGAAAGGGGAGGAAGATGG - Intergenic
1130637899 15:85642606-85642628 GAGGGAAAAGTACAGAAAGAAGG - Intronic
1130732155 15:86507602-86507624 GAGGGTAATGAGCAGGTGAAAGG + Intronic
1130993203 15:88889047-88889069 GAGAGGGAAGAGGAGGAAGACGG + Intronic
1131035666 15:89220519-89220541 GAGTGGAAAGAGCAGGAAATGGG - Intronic
1131124868 15:89851065-89851087 GATTGTTAAGAGCTGGAAGAAGG + Intronic
1131171476 15:90181903-90181925 GAGGAGAAGGAGCAGGAAAAGGG + Intronic
1131216408 15:90539660-90539682 GCTGGAAAAGAGCATGAAGAAGG + Intronic
1131217149 15:90547677-90547699 GAGGGCAGAGAGGAGGAAGTGGG + Intronic
1132140093 15:99385167-99385189 GGGGCTGAAGGGCAGGAAGAAGG - Intronic
1132549438 16:548304-548326 GAGGCTCAGGAGCAGGAAGAGGG - Intronic
1133087125 16:3373545-3373567 GAGGGTAGAGAGTGGGAGGAGGG - Intronic
1133520118 16:6549103-6549125 GGGAGGAAAGAGAAGGAAGAGGG + Intronic
1133569621 16:7027916-7027938 AAGGGAAAAGAGAAGGAAGGAGG + Intronic
1134081025 16:11325083-11325105 CAGGGGGAAGAGCAGGCAGAAGG + Intronic
1134340859 16:13344439-13344461 AAGGGCATAGAGGAGGAAGAAGG - Intergenic
1134657302 16:15956797-15956819 GAGGCTAAGGAGGAGGAGGAAGG + Intronic
1135178887 16:20255763-20255785 GTGGGCAAGGAGGAGGAAGAAGG - Intergenic
1135269059 16:21053343-21053365 GAGGGTATAGGGCAGGAGTATGG + Intronic
1135836289 16:25828667-25828689 GAGGGCAGAGGGTAGGAAGAGGG - Intronic
1135891777 16:26363797-26363819 GAGGAGAAAGAGAAAGAAGAAGG - Intergenic
1135951688 16:26920158-26920180 ATTGGTAAAGGGCAGGAAGAAGG + Intergenic
1136054489 16:27678364-27678386 GAGGGAAAAGAAGACGAAGAGGG - Intronic
1136580248 16:31147263-31147285 GAGGGTACATTGCAGGAAGATGG - Intronic
1136595596 16:31247366-31247388 GAGGGTCAAGGGCAGGAGGATGG - Intergenic
1137016069 16:35376682-35376704 GAGGTTAAGGAGTAGGGAGATGG + Intergenic
1137751282 16:50862905-50862927 GAGGGAACAGAGCAGTAAGGGGG - Intergenic
1137871043 16:51950613-51950635 GAGGGAAAAGAGCATGAGAAGGG + Intergenic
1137969330 16:52968417-52968439 GAGGGTAGAGTGTGGGAAGAGGG - Intergenic
1138001080 16:53280517-53280539 GGGGGGAAAGGGCAGGAAGGGGG + Intronic
1138153982 16:54685917-54685939 GAGGGAGAAGAAGAGGAAGAAGG - Intergenic
1138299266 16:55912630-55912652 CAGGGAAAAGACCAGGAGGAGGG + Intronic
1138495594 16:57407207-57407229 GACAGTAAAGAGCTAGAAGATGG + Intronic
1138535761 16:57659544-57659566 CAGGGAGAAGTGCAGGAAGATGG - Exonic
1138680767 16:58682242-58682264 TGGGAGAAAGAGCAGGAAGAAGG + Intronic
1138686441 16:58730325-58730347 GAGGGTAGAGAATGGGAAGAGGG - Intronic
1138700622 16:58858953-58858975 GAGGGCAGAGAATAGGAAGAAGG + Intergenic
1138756338 16:59490605-59490627 GGGGTTAAAGAGCAGGAAAAAGG + Intergenic
1138774411 16:59704291-59704313 GTGGGTGAAGGGCAAGAAGAGGG - Intergenic
1138835410 16:60428870-60428892 GAAGGGAAAGAGAAGGAGGATGG + Intergenic
1138948576 16:61882721-61882743 GAGGGTGAAGGGTGGGAAGAAGG + Intronic
1139605158 16:68013028-68013050 GAGAGAAAAGAGGAAGAAGAAGG + Intronic
1139649911 16:68357028-68357050 TAGGAAGAAGAGCAGGAAGATGG - Intronic
1140400320 16:74666062-74666084 GAGGGGGAAGAGGAGGGAGAGGG + Intronic
1140656474 16:77145479-77145501 GAGGGTGAAGGGTGGGAAGAGGG - Intergenic
1140684748 16:77422609-77422631 GAGAGAAAAAAGGAGGAAGAAGG + Intronic
1140830425 16:78745748-78745770 GGGGAAAAAGAGGAGGAAGAGGG - Intronic
1141065878 16:80913266-80913288 GATGGAAAAGAGCAGGTGGATGG + Intergenic
1141178172 16:81734372-81734394 GAGTGTGAGGAGCAGGAGGAGGG + Intergenic
1141185464 16:81784004-81784026 GCGGGCAGAGAGCAGCAAGAAGG - Intronic
1141272005 16:82549681-82549703 GATGGGAATGAGCAGGAAGCAGG + Intergenic
1141421538 16:83921019-83921041 GAGGGTGGATAGAAGGAAGATGG + Exonic
1141456017 16:84142975-84142997 GAGCCTAAAGAGCAGCAACATGG + Intronic
1141977278 16:87525256-87525278 GAGGGGAAGGTGCATGAAGATGG - Intergenic
1142118339 16:88372813-88372835 GATGGTAAAGATCATGATGATGG - Intergenic
1143091264 17:4450253-4450275 GAGAGAAAAGAGGAGGAAGGAGG - Intronic
1143391328 17:6560950-6560972 GAGGAGGAAGAGGAGGAAGAGGG - Intergenic
1143514469 17:7412966-7412988 AAAGGGAAGGAGCAGGAAGAGGG - Intronic
1144279619 17:13712409-13712431 GAGGGAAAAGAAGAGGAAGGTGG + Intergenic
1144725411 17:17499432-17499454 GAGGGCAAAGAGCAATTAGAAGG + Intergenic
1144741414 17:17584608-17584630 AAAGGTAAAGAAAAGGAAGATGG - Intronic
1145103307 17:20094501-20094523 GATGAAAAACAGCAGGAAGAGGG - Intronic
1145253557 17:21310411-21310433 GAAGGAAAACAGCAGGAACAAGG - Intronic
1145841176 17:27996181-27996203 CAGGGTCAGGAGCAGGTAGAAGG + Intergenic
1146329063 17:31912458-31912480 CAGGGCAAAGTGCAGGAAAAAGG + Intergenic
1146806398 17:35868392-35868414 GAGGGTAAAGAGCAGGGTACAGG + Intronic
1146817666 17:35956135-35956157 AAGGGTGGAGAGTAGGAAGAGGG - Intergenic
1146821518 17:35986602-35986624 GATGGTGATGAGGAGGAAGAAGG + Exonic
1148676086 17:49445838-49445860 AAGGACAGAGAGCAGGAAGAGGG - Intronic
1148745138 17:49913903-49913925 GAGGAGGAAGAGGAGGAAGATGG + Intergenic
1149393463 17:56215489-56215511 AAGGGACAAGAACAGGAAGATGG + Intronic
1149404982 17:56339451-56339473 GAGGGTGAAGGATAGGAAGAGGG - Intronic
1149426256 17:56557622-56557644 GAGGGTTATGAGCAGGCAGAAGG - Intergenic
1149712560 17:58756277-58756299 GAGGGTGAGGAGGAGGAGGAGGG + Exonic
1149983452 17:61329741-61329763 GAGGGTGAGGAGGAGGAAAAGGG + Intronic
1150105649 17:62460705-62460727 GAGAGGAAAAAGGAGGAAGAAGG - Intronic
1150266748 17:63837218-63837240 CAGGTTAAAGAGGAGGAAGATGG - Exonic
1151185616 17:72361893-72361915 GAGGGAAAAGAGGAGGGAGCTGG - Intergenic
1151458942 17:74243382-74243404 CAGGATAAAGAGCAGGAGGTAGG - Exonic
1151590665 17:75042115-75042137 GTGGGTAGGGAGCAGGAACAGGG - Intronic
1152146138 17:78570029-78570051 GAGGGAAAAGAAAGGGAAGACGG - Intronic
1152193807 17:78904398-78904420 GAAGGTAAACAGCAGGAATTCGG + Intronic
1152559808 17:81072291-81072313 GAGGTGAAGGAGCAGGAAGCCGG - Intronic
1152928375 17:83098228-83098250 GAGGGAAAAGGGCAGGTGGAGGG - Intergenic
1152947607 17:83206430-83206452 GAGACTCAAGAGGAGGAAGAGGG + Intergenic
1153187700 18:2503050-2503072 GAGAATAAAAAGGAGGAAGAAGG + Intergenic
1153321243 18:3776104-3776126 GAGGGAAAAGACGGGGAAGATGG + Intronic
1153396732 18:4630513-4630535 GAGGAGAAAGAGGAGGAGGAGGG + Intergenic
1153589366 18:6657150-6657172 GAGGGTAGAGAGTGGGAGGAGGG + Intergenic
1154092404 18:11378098-11378120 GAGGGCAAAGAGGAGAAGGAGGG + Intergenic
1155262513 18:24058160-24058182 GAGGGTGGAGGGTAGGAAGAGGG + Intronic
1155464077 18:26116121-26116143 GAGGGTAAAGGGTGGGAGGAGGG + Intergenic
1155479861 18:26273693-26273715 GAGGGTAAAAAATGGGAAGAAGG - Intronic
1155576403 18:27252505-27252527 GGGGGGAAAGAGGAGGAGGAAGG + Intergenic
1155657249 18:28206609-28206631 GAGGGTGGAGAGTGGGAAGAGGG - Intergenic
1155697326 18:28698377-28698399 TGGAGTAAAGAGCAGGAGGACGG + Intergenic
1156352366 18:36312043-36312065 GAGGGTACAGGGCAGGGGGAAGG - Intronic
1156924849 18:42563856-42563878 CAGGAGACAGAGCAGGAAGAAGG + Intergenic
1157543875 18:48534181-48534203 GGGGGGAAAGAGGAGGGAGAGGG - Intergenic
1157660980 18:49443671-49443693 GAGAGCAATGAGCAGGAAAATGG + Intronic
1157708283 18:49827724-49827746 GAAGGAAAAGAGCAAGAAGGGGG + Intronic
1157729055 18:49988158-49988180 TTGGGTGAAGAGGAGGAAGAAGG + Intronic
1157731959 18:50011694-50011716 GAGGGAAAGGAGGAGGAACAGGG - Intronic
1157772150 18:50358633-50358655 GAGGGAAAAGAAAGGGAAGATGG - Intergenic
1157838682 18:50933806-50933828 AAGGGTAGAGGGCGGGAAGAGGG - Intronic
1158063179 18:53372457-53372479 GAGGGTAAAGGGTAGGGGGAGGG + Intronic
1158275190 18:55759216-55759238 GAGGAGAAAGAGGAGGAGGAGGG + Intergenic
1158789361 18:60758093-60758115 GAGGGTAGAGAGTAAGGAGAAGG + Intergenic
1158990724 18:62865881-62865903 GAGGCTGGAGGGCAGGAAGAAGG + Intronic
1159079756 18:63724063-63724085 GAGGAGGAAGAGAAGGAAGAAGG - Intronic
1159518036 18:69483032-69483054 GAGGGTGGAGGGCAGGAGGAGGG - Intronic
1159752650 18:72322018-72322040 GAGGTTAAAGAGCAGGACAATGG + Intergenic
1159865773 18:73702973-73702995 GACAGTAAAGAGCTGGGAGAGGG - Intergenic
1160590192 18:79940230-79940252 GGGGGTGGAGAGCAGGAGGAGGG + Intronic
1160819718 19:1052362-1052384 GAGGGGGAAGAGGAGGAGGAGGG + Intronic
1160821128 19:1058693-1058715 TAGTGTGAAGAGAAGGAAGAGGG - Exonic
1160991389 19:1861744-1861766 GAGGGTGGAGAGCAGGAGGGCGG - Intronic
1161209479 19:3058721-3058743 GAGGGAAGAGAGCAGGCAGGAGG + Intronic
1162151873 19:8651869-8651891 AAGGGTAGTGAGGAGGAAGAGGG - Intergenic
1162200841 19:9018853-9018875 GGGGATAAAGAGAAGGAACAAGG + Intergenic
1162227638 19:9237199-9237221 AAGGGAAAAGAGAAGTAAGAAGG - Intergenic
1162502076 19:11059837-11059859 GAGAGTGAGGAGGAGGAAGAGGG + Exonic
1162527169 19:11213053-11213075 GAGCATAATGAGCAGGAGGAGGG - Intronic
1163061291 19:14763985-14764007 GAGGATAAAGAGGAAGAAAAAGG - Intronic
1163350974 19:16776993-16777015 GAGGGAAAGGAGAGGGAAGAGGG + Intronic
1163596025 19:18221333-18221355 GTGGGTAAAAAGCTGGAAGATGG - Intronic
1163611552 19:18304451-18304473 GAGGGGAATGGGGAGGAAGATGG + Intergenic
1164083352 19:21879660-21879682 GAGGGCAAGGACCAGGTAGAAGG - Intergenic
1164292696 19:23881842-23881864 GAGGAGAAGGAGGAGGAAGAGGG + Intergenic
1164398420 19:27886379-27886401 GAAGGTAGAGAGTAGAAAGATGG - Intergenic
1164501441 19:28823631-28823653 GAAGGTAAGGAGAAGGAAGGAGG - Intergenic
1164574853 19:29399925-29399947 AAGGGGAAAGAGCAGCAGGAGGG + Intergenic
1164918094 19:32067955-32067977 AAGGGTAAGGAGAAGCAAGAAGG - Intergenic
1165332947 19:35151444-35151466 GAAGGTGAAGTGCAGGAAGGCGG + Exonic
1165925645 19:39324531-39324553 GAGGAGAAGGAGGAGGAAGAAGG + Intergenic
1166960294 19:46492923-46492945 GAAGGGAAAGAGGAGGAGGAGGG - Exonic
1167046877 19:47054903-47054925 CAGAGCAAAGAGCAGGAGGATGG + Intergenic
1167191252 19:47991625-47991647 GAGGGGAAGGAGGAGGAGGAGGG - Intronic
1167528711 19:50001542-50001564 GGGGGTAAGGAGCAGGAGGTGGG - Intronic
1167608200 19:50492902-50492924 GAGGGAAAGGAGGAGGAAGGAGG + Intergenic
1167749360 19:51370641-51370663 CAGGGTGAAGGGCAAGAAGAAGG - Intergenic
1167918080 19:52758619-52758641 GAGGGTAGAGAGTGGGAGGAAGG + Intergenic
1168143879 19:54408430-54408452 GAGGGGAAAAGGAAGGAAGAAGG + Intergenic
1168409811 19:56132640-56132662 GAGAGTAAAGGGCTGGAAGTGGG + Intronic
1168642003 19:58037051-58037073 GGGGGTGGAGACCAGGAAGAGGG - Intronic
1202708895 1_KI270714v1_random:5654-5676 GAGGGGAAAGAGCAGACAGGAGG - Intergenic
925032198 2:659626-659648 GAGGGAGAAAAGAAGGAAGAAGG + Intergenic
925169091 2:1740149-1740171 GAGGGTGCAGAGGAGGAGGAGGG + Intronic
925595601 2:5552824-5552846 AAGGGTGAAGAGCATGAAGGTGG - Intergenic
925643401 2:6009571-6009593 GAAGGCAAAGAGAAGGAACAGGG + Intergenic
925822927 2:7818225-7818247 GCGGGTAAAGGGTAGGAAGGCGG + Intergenic
925927586 2:8681666-8681688 GAGGGGAAGGAGGAGGGAGAAGG - Intronic
927045687 2:19275955-19275977 CAGGGCAGAGAGCAGAAAGAAGG - Intergenic
927501762 2:23588049-23588071 GAGGTTACAGAGAAGGATGAGGG - Intronic
927716760 2:25358258-25358280 GAGGGGGAAGAACAGGAAAAAGG - Intergenic
928015299 2:27650597-27650619 CAGGGTCAAGAGCAAGAAGCTGG - Exonic
928704334 2:33931410-33931432 CAGGAAAAAGAGCAGCAAGATGG - Intergenic
928704497 2:33933378-33933400 CAGGCAAAAGAGCAGCAAGATGG - Intergenic
929135645 2:38621429-38621451 GAGGGTGAAGAGTGGGAGGAGGG + Intergenic
929789928 2:45014648-45014670 GGGAGGAAAGAGGAGGAAGAGGG - Intergenic
930021517 2:47004659-47004681 GAGGGGAATGAGCAGGAGAAGGG + Intronic
930068570 2:47347003-47347025 GAAGGTAAAGCGCAGGCAGCAGG + Intronic
931052722 2:58431751-58431773 GAGGGTAAAGAAGAAGAAGATGG + Intergenic
931131467 2:59341174-59341196 GAGGGTGGAGATCTGGAAGATGG + Intergenic
931716659 2:65034197-65034219 GTGTTTAAAGAGCAGAAAGAAGG + Intergenic
931884379 2:66599776-66599798 GAAGGAAAAGAGCAAGGAGAGGG - Intergenic
931944664 2:67292298-67292320 GAGGGTGGAGAGTGGGAAGAGGG + Intergenic
932168282 2:69528650-69528672 GAGGGTAAAAAGAAGGAAGGAGG + Intronic
932588134 2:73044927-73044949 GAGGGGAAAGGGTGGGAAGAGGG + Intronic
933329825 2:80879722-80879744 GGGAGCAAAGAGCAGGAGGACGG + Intergenic
933441107 2:82315400-82315422 GAGGGGGAGGAGAAGGAAGAGGG - Intergenic
934149114 2:89128581-89128603 GAGAGTAAAGAGGAAGATGATGG - Intergenic
934218181 2:90053461-90053483 GAGAGTAAAGAGGAAGATGATGG + Intergenic
934475541 2:94591092-94591114 GAGGGTACAGACTAAGAAGAGGG - Intronic
934475975 2:94593785-94593807 GAGGATAAAGAGGAAGAAGAGGG - Intronic
934579400 2:95426563-95426585 AAGGGACAAGAGCAGGAAGGAGG - Intergenic
934600043 2:95650161-95650183 AAGGGACAAGAGCAGGAAGGAGG + Intergenic
934655709 2:96116069-96116091 GATGGTAAAGAGAATGAGGAAGG + Exonic
934670035 2:96206375-96206397 GAGGAGAAAGACCAGGAAAAGGG - Intronic
935665961 2:105512968-105512990 GAGGGTGGAGGGTAGGAAGAGGG - Intergenic
936276681 2:111103972-111103994 GAGGGTAAAGGAAGGGAAGAGGG - Intronic
936373853 2:111924548-111924570 GAGGAAGAAGAGCAGGAAGTGGG - Intronic
936533388 2:113292165-113292187 AAGGGACAAGAGCAGGAAGGAGG + Intergenic
936605254 2:113945785-113945807 GAGGGTGGAGAGTGGGAAGAGGG - Intronic
936684202 2:114808751-114808773 GAGAGGAAAGAGCAGGTACAAGG - Intronic
936746887 2:115587372-115587394 GAGGCTAAGGAGTAGGAAAAAGG - Intronic
936870350 2:117129181-117129203 GAGAGAAGAGAGAAGGAAGAAGG - Intergenic
936960037 2:118063258-118063280 GAGGGTGAAGAGTGGGAGGAGGG - Intergenic
937241296 2:120464252-120464274 AAAGGGAAAGAGCAGGAAAAGGG + Intergenic
937264484 2:120607292-120607314 CAGGGCATAGAGCAGGAGGATGG + Intergenic
937425917 2:121798226-121798248 GAAGGAAAAGAGAAGGAAGGGGG + Intergenic
937884654 2:126891553-126891575 GAGGATAAAGAGCAGGGAGGAGG + Intergenic
937946058 2:127338475-127338497 GAGGGTGGAGGGCAGGAGGAGGG - Intronic
938395018 2:130939046-130939068 GAGGGTGGAGGGCAGGAGGAGGG - Intronic
938561612 2:132477026-132477048 GAGGCAGAAGAGCAGGCAGAGGG - Intronic
938871092 2:135477411-135477433 GAGGTTATACAACAGGAAGAAGG + Intronic
939156410 2:138529963-138529985 GAGGGTAAAGCGTGGGAGGAGGG - Intronic
939175119 2:138739489-138739511 GAGGGTGTAGAACAGGAGGAAGG + Intronic
939175630 2:138744641-138744663 GAGGCTCAAGAAAAGGAAGAAGG - Intronic
939385788 2:141495352-141495374 CATGGTAATGAGCAGGAAAATGG + Intronic
939820063 2:146946643-146946665 GAGGGTGGAGAGAAGGAGGAGGG + Intergenic
939885393 2:147675999-147676021 GAGGGCCAAGGACAGGAAGATGG - Intergenic
940539107 2:154988074-154988096 GAGGGTAGAGGGTAGGAGGAGGG + Intergenic
940686164 2:156853678-156853700 GAGGGTGAAGGGTAGGAAGAGGG + Intergenic
940907558 2:159183033-159183055 GAGAGGAAAGAGCTGGCAGAAGG + Intronic
941748521 2:169111833-169111855 GAGAGTAAAGGGCTGGGAGATGG - Intergenic
942632358 2:177964530-177964552 GAGGGTGAAGGGTTGGAAGAGGG - Intronic
943325551 2:186493391-186493413 AAGAGAAAAGAGCAGGTAGAAGG - Intronic
943342268 2:186694707-186694729 GAGGGTAGAATTCAGGAAGAAGG - Intronic
943482493 2:188437920-188437942 GAGGGTAGAGAGTGGGAAGAGGG + Intronic
943549105 2:189316589-189316611 GAGGGTAAAGAGTGGGAGGAGGG + Intergenic
943619821 2:190136567-190136589 GAGGGCAAAGAGTAGGTACAAGG - Intronic
943758410 2:191583221-191583243 GAGGGTGGAGAGTGGGAAGAGGG + Intergenic
943795468 2:191987245-191987267 GAGGGAAATGAGGAGGAGGAAGG + Intronic
944727939 2:202490745-202490767 AAGGGTAAAGAGTAGGATTAGGG + Intronic
945396450 2:209324610-209324632 GAGGGTAGAGGGTAGGAGGAGGG + Intergenic
946025459 2:216669299-216669321 AAGGATTAAGAGAAGGAAGAGGG + Intergenic
946226980 2:218269477-218269499 GAGGAAGAAGAGGAGGAAGAGGG - Exonic
946422668 2:219573513-219573535 GAGGGGGAAGAGAAGGAGGAGGG - Intronic
946447863 2:219755008-219755030 GAGGGTTTATAGCAAGAAGATGG - Intergenic
946876842 2:224138004-224138026 GAGGGCAAAGAGAAGGAAGAGGG - Intergenic
947248341 2:228074976-228074998 GAGGAAAAAGAGAAGGAGGAAGG + Intronic
947389486 2:229624268-229624290 AAGAGAAAAAAGCAGGAAGATGG + Intronic
947483042 2:230520800-230520822 TAGGGTCAGGAGAAGGAAGAGGG + Intronic
948261003 2:236604450-236604472 GAGGTCAAAGTGGAGGAAGATGG - Intergenic
948462515 2:238137200-238137222 CAGGGGAAAGAGCAGGAGCAGGG + Intergenic
948556046 2:238812122-238812144 GAGGATGACGAGAAGGAAGAAGG - Intergenic
949045986 2:241872873-241872895 GAAGGCAAAGAGAAGGAAGGTGG + Exonic
1170146896 20:13185423-13185445 GAGGGTGACAAGGAGGAAGAAGG - Intergenic
1170596033 20:17806634-17806656 CAGGGTAAGGAGGAGAAAGAAGG + Intergenic
1170697246 20:18670041-18670063 GAGAGAAGAGGGCAGGAAGAAGG - Intronic
1170706499 20:18749010-18749032 CAGGCAAAAGAGGAGGAAGAGGG + Intronic
1170912259 20:20584538-20584560 GAAGGTAAAAAGTGGGAAGATGG + Intronic
1170920525 20:20674716-20674738 GAGGGTAAAAAGCATGTCGAAGG + Intronic
1171151431 20:22829501-22829523 GAGGGGAGAGAGCGGGAGGAGGG - Intergenic
1171936919 20:31283527-31283549 GAGGGTGGAGGGCAGGAGGAGGG + Intergenic
1172250855 20:33478121-33478143 TATGGAAAAGAGCAGGATGAAGG - Intergenic
1172591296 20:36119901-36119923 GAGGGTACAGAGGAGGAGGGCGG - Intronic
1172595535 20:36148761-36148783 GTGGGTATAGAAGAGGAAGAGGG + Intronic
1172853526 20:37983667-37983689 GAGGGTACAGAGAGGGAAGGCGG + Intronic
1172873293 20:38148892-38148914 GGGGGAAAAGAGCAGACAGAAGG - Intronic
1173044898 20:39500680-39500702 GGGGGCAAAGAGCAAAAAGATGG + Intergenic
1173322163 20:41997992-41998014 GAGGGCAAGGAGGAAGAAGAGGG - Intergenic
1173486974 20:43448292-43448314 GAGGGGAGAAAGCAGGGAGAGGG + Intergenic
1174216519 20:48920743-48920765 GAGGGGAAAGAGTAGGAGAAAGG - Intergenic
1174282958 20:49452608-49452630 GAAGGGAAAAGGCAGGAAGATGG + Intronic
1174434980 20:50499846-50499868 GAGGGTGAAGACCAGCAGGAAGG - Intergenic
1174469351 20:50744648-50744670 GAGGGTGAAAAGCAGGAGGGAGG - Intronic
1174641774 20:52050482-52050504 GAGGAGAAAGAGGAGGAGGAAGG - Intergenic
1175526961 20:59641512-59641534 GACTGAATAGAGCAGGAAGACGG - Intronic
1175571525 20:60026424-60026446 GAGGGAGAAGAGGAGGCAGAAGG + Intronic
1175638853 20:60609829-60609851 GAGGGTGAAGAGGGGGAAGAGGG + Intergenic
1176066913 20:63202620-63202642 GACGCTGAAGAGCAGGTAGACGG + Exonic
1177259182 21:18706909-18706931 GAGGGTGAACAGGGGGAAGAGGG - Intergenic
1177507366 21:22036192-22036214 GAGGGTGAAGGGTAGGAAGAGGG - Intergenic
1177758344 21:25373784-25373806 GAGGGGAAGGAGGAGGAGGAGGG - Intergenic
1178016745 21:28355542-28355564 GAGGGTGAAGAGTGGGAGGAGGG + Intergenic
1178881008 21:36450092-36450114 GAGGGGAAAGGGCACGAAAAGGG - Intergenic
1179713965 21:43278395-43278417 GGGGGTACAGGGCAGGAAGGTGG + Intergenic
1181180568 22:21065251-21065273 GAAGGTAAATAGAAGGGAGAAGG - Intergenic
1181317366 22:21979280-21979302 GAGGCACAAGAGCAGGAAGTGGG + Intronic
1181619246 22:24077185-24077207 GAGGGGAAAGCACAGGAAGATGG - Intronic
1181866016 22:25855982-25856004 GAGGGTAAAGAGTGGGAGGAGGG - Intronic
1182988674 22:34745301-34745323 GAGGGTGAAGGGTGGGAAGAGGG - Intergenic
1183177729 22:36236924-36236946 GAGTGAACAAAGCAGGAAGAAGG - Intronic
1183784865 22:40023437-40023459 GAGGGGAAGGAGGTGGAAGAGGG + Intronic
1183806934 22:40219620-40219642 GAGTGTGAAGCGCAGGAAGGAGG - Intronic
1184041181 22:41945074-41945096 GAGGGTGGAGGGCAGGAAGAAGG - Intronic
1184381502 22:44147592-44147614 GAAGGTAAAAAGCAGGTGGAAGG + Intronic
1184449723 22:44575799-44575821 GAGGAGAAAGAGGAGAAAGAAGG + Intergenic
1184509013 22:44921212-44921234 CAGGGTAAGGAGAAGGGAGATGG + Intronic
1184657042 22:45947084-45947106 GGGAGTCATGAGCAGGAAGAGGG - Intronic
1184746842 22:46461156-46461178 GAGGGAAAAGGGGAGGAAGAGGG + Intronic
1184770837 22:46595612-46595634 GAGGGTTCAGGGCAGGAAGAGGG - Intronic
1184822619 22:46921230-46921252 GAGGGTGGAGAGCGGGAGGAGGG - Intronic
1184997343 22:48217993-48218015 GAGTGCAAACAGCAGGAAGGAGG - Intergenic
949163559 3:910516-910538 AAGGGCAAAGAGGAGGTAGAAGG + Intergenic
949225876 3:1695240-1695262 GAGGAGAAAGAGTAGGAAGTGGG + Intergenic
949365718 3:3278428-3278450 AAGGGGAAAGAGCAGGCAGTAGG - Intergenic
949680708 3:6511372-6511394 GAGAGTAAAGAAAAGGAAGTAGG + Intergenic
949750259 3:7344235-7344257 GAGGGTAGAGGGTGGGAAGAGGG - Intronic
950117110 3:10458261-10458283 GATGTTAAACAGCAGGAAAAAGG - Intronic
950369977 3:12520929-12520951 GAGGGTGAAGAGAGGGAGGAGGG - Intronic
950456964 3:13098497-13098519 GAGGGTCAAGAGGAGGGTGAGGG + Intergenic
950637526 3:14325224-14325246 GTGGCTACAGAGCAGGGAGAGGG - Intergenic
950806969 3:15613513-15613535 GAAGGTAAGGAGGGGGAAGAGGG - Intronic
950861773 3:16154061-16154083 AAGGCTATAGTGCAGGAAGAAGG + Intergenic
951558556 3:23945012-23945034 GAGAGGAAAGAGGAGGAGGAGGG + Intronic
951661840 3:25075420-25075442 GTGGCAAAAGAGCAGAAAGATGG + Intergenic
952213328 3:31251330-31251352 GAGGATAAAGAGAAGGAAGAAGG + Intergenic
952623587 3:35376311-35376333 GAGGGAAAAGAACGGTAAGAAGG + Intergenic
953142043 3:40238145-40238167 GAAGGGAAGGAGAAGGAAGAAGG - Intronic
953578950 3:44136135-44136157 AAGGGTAAAGGGGAGGAAGCAGG - Intergenic
953644570 3:44742203-44742225 GAGGAGAAAGAGCAGACAGAAGG - Intronic
953783644 3:45894283-45894305 CAGGGTAAAGAGGAGAAAGGTGG + Intronic
954095380 3:48322268-48322290 GAGGGGAAATAGTTGGAAGAGGG - Intronic
954367376 3:50153892-50153914 GAGGGTAAAGAGCAGGAAGAAGG + Intergenic
954495477 3:50955680-50955702 GAGGGTGAAGAGTGGGAGGAAGG + Intronic
954522196 3:51238600-51238622 GAGGGTAGAGGGTAGGAGGACGG - Intronic
955100641 3:55846138-55846160 GAAGGTAAAGTGTAGGATGAGGG - Intronic
955307446 3:57848530-57848552 GAGGAAAAAGGGAAGGAAGAAGG - Intronic
955366043 3:58311054-58311076 GAGGGTAGAGAGGATGAAGGAGG - Intronic
955956763 3:64298127-64298149 GAGGGTAAAGGGTGGGAGGAGGG - Intronic
956065819 3:65396074-65396096 GAGGCTTAGGAGCAGGAGGATGG + Intronic
956447366 3:69338682-69338704 GAGGGTAGAGGGTAGGAGGAGGG + Intronic
956751064 3:72344236-72344258 GAGGAAAAAAAGCAAGAAGAAGG + Intergenic
956832460 3:73065120-73065142 GAGGATGAAGAGGAAGAAGAAGG + Exonic
956846536 3:73188825-73188847 GAGGGGGAGGAGGAGGAAGAAGG - Intergenic
957459467 3:80497766-80497788 GAGGGTAGAGGCCAGGAAGGGGG + Intergenic
957525580 3:81374904-81374926 GTAGGTAACTAGCAGGAAGAAGG - Intergenic
957733602 3:84177521-84177543 GAGGGCAGAGAGTAGGAGGAAGG + Intergenic
957764872 3:84610526-84610548 AAGGGGAAAAAGAAGGAAGAGGG + Intergenic
957888310 3:86320313-86320335 GAGGGTGAAGGGAAGGAGGAGGG - Intergenic
958454989 3:94319665-94319687 CAGGCTAAAGAGCAGTTAGAAGG + Intergenic
958536608 3:95412012-95412034 GAGAGGACAGAGGAGGAAGAAGG - Intergenic
958952646 3:100433207-100433229 GAGGGTAGAGGGCAAGGAGAGGG - Intronic
959111774 3:102131269-102131291 GAGGGTAAAGGGTGGGAGGAGGG + Intronic
959268749 3:104177321-104177343 GAGAGTGGAGAGCAGGAGGAGGG - Intergenic
959911853 3:111772407-111772429 GAAGGAAAAGAAGAGGAAGAAGG + Intronic
960036893 3:113111004-113111026 GAGGGCAAAGAGTAGTAAAAAGG + Intergenic
960328544 3:116327275-116327297 GAAGGTAAAATGCAGGAACATGG - Intronic
960425550 3:117502586-117502608 GATTGTTAAGAGAAGGAAGAAGG + Intergenic
960611909 3:119562509-119562531 CAAGGTCAAGAGCAGAAAGATGG - Intergenic
960681786 3:120255710-120255732 GAGGGTGAAGAGTGGGAAGAGGG + Intronic
960926924 3:122803559-122803581 GAGGGTTATGAGCAGGGAAAAGG + Intronic
960979385 3:123208077-123208099 GAAGATAAAGAGAAGGAAAAAGG - Intronic
961747877 3:129077143-129077165 GAGAGGAATGAGAAGGAAGAGGG - Intergenic
962089297 3:132226455-132226477 AAGGGGAAAGAGCAGGCAGTAGG - Intronic
962613149 3:137097998-137098020 GAAACTAAAGAGCAGGAAGAAGG - Intergenic
962991109 3:140578211-140578233 GTGGGGAGAGGGCAGGAAGATGG - Intergenic
963096290 3:141544989-141545011 GAGGGTGGAGAGTAGGAGGAGGG + Intronic
963329531 3:143898733-143898755 GAGAGTAGAGGGCAGGAGGATGG + Intergenic
963351389 3:144156114-144156136 GAGGGTGGAGGGTAGGAAGAGGG + Intergenic
963397754 3:144755460-144755482 GACTGTAAAGAGCATGAATAAGG + Intergenic
963471082 3:145742658-145742680 GAGGGGAAAGAGAAAGAAGCAGG - Intergenic
964444597 3:156745446-156745468 GAAGGGAAAGAGGAGGAAGCAGG - Intergenic
964776928 3:160289301-160289323 GAGGGTGAAGAGTGGGAGGAGGG + Intronic
965307224 3:167081414-167081436 GTGGGAAAAGAGAAGGAACAGGG + Intergenic
965524525 3:169702004-169702026 AAAGGAAAAGAGGAGGAAGAAGG - Intergenic
966258956 3:177952493-177952515 GAACGTAAAGAGCAGCATGAGGG - Intergenic
966319891 3:178690516-178690538 GAGGAGAATGAGAAGGAAGAAGG + Intronic
966450161 3:180050034-180050056 GAGGGTGAAGAGGGGGAAGGAGG - Intergenic
966450319 3:180051463-180051485 GAGGTCAAGGAGCAGCAAGAAGG - Intergenic
966551996 3:181215624-181215646 GAGGGGAAGGCCCAGGAAGAGGG - Intergenic
966651840 3:182310211-182310233 GAGGGTAGAGGGTGGGAAGAGGG - Intergenic
966774131 3:183529147-183529169 GAGGGTAGAGGGTGGGAAGAGGG + Intronic
966863549 3:184243805-184243827 GAGGGCAAACAGCAGGAGCAGGG + Exonic
966954355 3:184858607-184858629 GAGAGCAATGAGCAGGAACATGG + Intronic
967122753 3:186397983-186398005 GAGGGTGAAGGGTAGGAGGAGGG - Intergenic
967287595 3:187888642-187888664 GAGGGTGAAGGGTAGGAGGAGGG - Intergenic
967369133 3:188723532-188723554 GATGGTCAAGAGCAGGGAGACGG + Intronic
967633503 3:191774713-191774735 GAGGGTAGAGAGAAGCAAAAGGG - Intergenic
968713591 4:2138400-2138422 GAGGGATGAGAGCAGGAAGGTGG + Intronic
968840934 4:3005355-3005377 GAGGTTAAAGAGAGGGAAGATGG + Intronic
970209920 4:13698516-13698538 GAGGGTGGAGAGTAGGAGGAGGG - Intergenic
970730283 4:19095137-19095159 GAGAAGAAAGAGAAGGAAGAGGG + Intergenic
970914891 4:21321580-21321602 GAGGGGTAGGAGGAGGAAGAGGG + Intronic
971180275 4:24323767-24323789 CAGAGCAAAGAGCAGGAGGATGG - Intergenic
971216333 4:24665545-24665567 GAGGGAAAAGAGAAAGAACAAGG - Intergenic
971464412 4:26940222-26940244 GAAAGGCAAGAGCAGGAAGAAGG - Intronic
971570946 4:28210010-28210032 GAGGGGAAGGAGGAGGAAGAGGG - Intergenic
971570952 4:28210028-28210050 GAGGGGGAGGAGGAGGAAGAGGG - Intergenic
971570959 4:28210046-28210068 GAGGGGGAGGAGGAGGAAGAGGG - Intergenic
971622324 4:28871421-28871443 GAGGAAAAAGAGCAAGGAGAAGG - Intergenic
971961031 4:33487300-33487322 GAGGGAAAAGAGAAGAATGAGGG + Intergenic
972153227 4:36122603-36122625 GAGGGTGAAGAGTGGGAAGAGGG + Intronic
972453930 4:39233238-39233260 GAGGGCCTAGAGCAGGATGAAGG + Intronic
972866515 4:43239897-43239919 GAGAATAAAGAAGAGGAAGAAGG + Intergenic
973582369 4:52357054-52357076 GAAGGAAAAGAGAGGGAAGACGG - Intergenic
973765973 4:54163242-54163264 GAGGGGAAGGAGAAGGAAGTGGG - Intronic
974274891 4:59705876-59705898 GAGGGTAAAGCACAGAAGGACGG + Intergenic
974309996 4:60192911-60192933 GAGGGTGAAGGGTAGAAAGAGGG + Intergenic
974567927 4:63602337-63602359 GAGGGTAGAAGGCAGGAGGAGGG - Intergenic
974797379 4:66770353-66770375 GAGGGTAGAGGGCAGGAGGTGGG - Intergenic
975022668 4:69508703-69508725 GAGGCTGAAGAGCGGGAGGAGGG + Intronic
975090534 4:70397386-70397408 GATGGTGTAGAGCAGGAGGAGGG + Intergenic
975248960 4:72154712-72154734 GAGGGCAAAAACCATGAAGAGGG - Intergenic
975442029 4:74421808-74421830 GAGGGGAAGGGGAAGGAAGATGG + Intergenic
975545480 4:75556277-75556299 GTGGTTAAAGAGAAGGAAGTTGG + Intronic
975660444 4:76683433-76683455 GAGGGTAAAGGCAAGGAAGGAGG - Intronic
975954535 4:79821896-79821918 CATAGCAAAGAGCAGGAAGAAGG + Intergenic
976572751 4:86632627-86632649 GAGGAGAAAGAGAAAGAAGAAGG - Intronic
976626972 4:87195599-87195621 AAGGGTAGAGAGAAGGCAGAAGG + Exonic
976687450 4:87830578-87830600 GAGGGTGAAGGGTGGGAAGAAGG + Intronic
976757437 4:88513454-88513476 TAGGAAAAAGAACAGGAAGAAGG - Intergenic
977088957 4:92645650-92645672 GGGGGTAGTGAGCAGGGAGATGG - Intronic
977428175 4:96896370-96896392 GAGGAGAAAGAGCAGGGAGTTGG + Intergenic
977667943 4:99662690-99662712 GAAGGTACAGAGAAGGAAAAAGG - Intergenic
978400971 4:108330355-108330377 GAGTGGGAAGAGCAGGAAGGAGG - Intergenic
978689445 4:111488796-111488818 GAGGGTAGAGGGTAGGAGGAGGG + Intergenic
978921793 4:114192890-114192912 GAAGGGAAAGTGCAGGATGATGG - Intergenic
978995226 4:115143275-115143297 AAGGGAAAAGAGCAGCAAAAAGG + Intergenic
979251941 4:118574840-118574862 AAGGGGAAAGAGCAGCAGGAGGG - Intergenic
979370513 4:119880460-119880482 GAGGGTGAAGTGTAGGAAGAGGG + Intergenic
979616262 4:122746162-122746184 TAGGCTGAAGAGAAGGAAGAGGG + Intergenic
979742136 4:124165338-124165360 TAGGGGAGAGAGAAGGAAGAGGG - Intergenic
979756456 4:124346098-124346120 GGAGGATAAGAGCAGGAAGAGGG - Intergenic
979879118 4:125931727-125931749 GAGGGTGAAGGGTAGGAGGAAGG - Intergenic
980104947 4:128578688-128578710 GACGGGAAAGACGAGGAAGAGGG + Intergenic
980137320 4:128871360-128871382 GAGGAGGAGGAGCAGGAAGAAGG - Exonic
980533694 4:134087797-134087819 GAGGGAAAAGGCCAGGAGGAAGG - Intergenic
980564196 4:134517370-134517392 AATGGTAAAGGTCAGGAAGAAGG + Intergenic
980575925 4:134683072-134683094 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
980612083 4:135172615-135172637 GGGAGCAAAGAGCAGGAGGATGG + Intergenic
980726579 4:136769633-136769655 GAGGGTGAAGAGAAGGAAGTGGG - Intergenic
980879368 4:138693949-138693971 GAGGGTAAAGAGGGAGAAGGAGG + Intergenic
981091640 4:140738468-140738490 AAGGGGAAAGAGCAAGAAGGAGG - Intronic
981182763 4:141765094-141765116 GAGGATGAAGGGCAGGAGGAGGG - Intergenic
981254382 4:142644238-142644260 GAGGAGAAAGAGAAGGAAGGGGG + Intronic
981406450 4:144375280-144375302 GAGGTTAAGGAGGAGGGAGATGG - Intergenic
981488944 4:145319177-145319199 GAGGGCAAAGAAGAGGAACAGGG - Intergenic
982810389 4:159818461-159818483 GAGGGTAGAGGGTAAGAAGAGGG + Intergenic
983522074 4:168719721-168719743 GAGGGTGGAGAGCGGGAGGAGGG - Intronic
983523415 4:168734943-168734965 GAGGAGAAAGAGGAGGGAGAGGG + Intronic
984125407 4:175803131-175803153 GAGGAGAAAGAGAAGGAAGAGGG - Intronic
984153540 4:176165024-176165046 GAAGGTAAAAAGCAGTAAAAGGG + Intronic
984337157 4:178407589-178407611 GAAGGTGGAGGGCAGGAAGAGGG + Intergenic
984456661 4:179977686-179977708 GAGGGAGAAGAGGATGAAGAGGG - Intergenic
984700316 4:182814793-182814815 TGGAGTAAAGAGCAGGAGGACGG - Intergenic
984703495 4:182833193-182833215 GAGGGGAGAGAGAAGGAGGAGGG - Intergenic
984868762 4:184308999-184309021 GAGGCTGAAGAGGAGGAAGAGGG + Intergenic
985214615 4:187637641-187637663 GAGGGTGAAGAGAGGGAGGAGGG - Intergenic
985507144 5:289409-289431 GAGGATGAAGAGGAAGAAGAAGG - Intronic
985644058 5:1076816-1076838 CAGGGAGAAGGGCAGGAAGATGG + Intronic
985699341 5:1361121-1361143 GAGGGCAGAGGGCAGGAGGAGGG + Intergenic
985991024 5:3561432-3561454 GAGGGTAGGGAGTGGGAAGAGGG - Intergenic
986129375 5:4912731-4912753 GAGAGAAAGGAGAAGGAAGAAGG + Intergenic
986178992 5:5376121-5376143 GAGGGTAAACAGCAAGAGCAAGG + Intergenic
986183621 5:5416959-5416981 GAGGGTGAGGAGGAGGGAGAGGG + Intergenic
986286068 5:6360068-6360090 GAGGGGAGAGAGCTGGAAGGAGG + Intergenic
986353986 5:6906204-6906226 GAGGGCAAGAAGCAAGAAGACGG - Intergenic
986709233 5:10476012-10476034 GAAGGTGAAGAGCAGGGAGGAGG + Intergenic
986857832 5:11891633-11891655 GTGAGGAAAGAGCAGGAAGGCGG + Intronic
986896653 5:12379157-12379179 GAGGGTGAAGGGTAGGAGGAGGG - Intergenic
987032876 5:13991569-13991591 GAGGAGAAAGAGGAGGAGGAGGG + Intergenic
987032882 5:13991587-13991609 GAGGGGGAAGAGGAGGAGGAAGG + Intergenic
987231823 5:15902095-15902117 GAAGGTTAAGAGCAACAAGATGG - Intronic
987571689 5:19671163-19671185 GAGGGTAAAGTTCAGGGACAGGG + Intronic
987619677 5:20324687-20324709 GAGGGTAAAATGTAGTAAGAAGG + Intronic
987835134 5:23150874-23150896 GAGAGTAAATAGCTGGAATAGGG - Intergenic
988154372 5:27431038-27431060 GAGGGTAGAGAGTGGCAAGAGGG + Intergenic
988253666 5:28795151-28795173 GAGGCCAAAGAGCATGAAGCTGG - Intergenic
988340852 5:29969156-29969178 GAGGGTGGAGGGCAGGAGGAGGG + Intergenic
988347688 5:30059908-30059930 GAGGGCAAAGGGTGGGAAGAGGG - Intergenic
988680359 5:33479150-33479172 GAGGCTAAAGCCCAGGAGGAGGG - Intergenic
989193739 5:38695674-38695696 ATGGGGAAAGAGGAGGAAGAAGG - Intergenic
989474128 5:41855277-41855299 GACTGGAAGGAGCAGGAAGAGGG + Intronic
989504518 5:42211719-42211741 GAGGGTGAAGGGTAGGAAGAAGG - Intergenic
989576312 5:42991714-42991736 GAGGGAAAGGAGCTGGAATAAGG - Intergenic
989579369 5:43017641-43017663 GAGGGAAAGGAGCTGGAATAAGG - Intergenic
990805953 5:59662094-59662116 CAGGGTAAAGAGCAAGAGGCTGG - Intronic
990829955 5:59944841-59944863 AAGGAGGAAGAGCAGGAAGAGGG - Intronic
990919030 5:60942630-60942652 GAGGGTAAAGCAGAGAAAGAAGG + Intronic
991130426 5:63116520-63116542 GAGGGTACAGAGCACCATGATGG + Intergenic
991474270 5:67003473-67003495 GAGGATAAAGAGAAGGAAGAGGG - Intronic
991947647 5:71915238-71915260 CAGGGGAAAGAGCAGGAAGGAGG - Intergenic
992024260 5:72654939-72654961 GAGGGAAAAGAGGAGGAAAATGG - Intergenic
992154772 5:73944462-73944484 AAGGATAAAGAGCAGGAGTAGGG + Intergenic
992520159 5:77542273-77542295 GAGGGTAAAGGGTGGGAGGAGGG + Intronic
993420949 5:87700535-87700557 GAGGCTACAGAACAGAAAGATGG + Intergenic
993677959 5:90840156-90840178 GAGAGTAGAGAGAAGGCAGAGGG - Intronic
994030510 5:95136456-95136478 GAGGGAGAGGAGAAGGAAGATGG + Intronic
995002310 5:107148869-107148891 GAGGGGAAAGGAAAGGAAGAAGG + Intergenic
995008960 5:107236239-107236261 CAGAGTATAGAGCAAGAAGAGGG - Intergenic
995308315 5:110680971-110680993 GAGGGAAAAGAGAAGGGTGAGGG + Intronic
995443801 5:112220781-112220803 CAGGGGAAAAAGGAGGAAGAAGG - Intronic
995482412 5:112606321-112606343 GAGGTGAAAAAGCAGGAACAAGG + Intergenic
995701891 5:114945414-114945436 GAGGGTAGAGAGTAGGAGGAGGG - Intergenic
995772096 5:115681905-115681927 GAAGGGAAGAAGCAGGAAGAAGG - Intergenic
995992893 5:118264106-118264128 GAGGGTAGAGGGTAGGAAGAGGG - Intergenic
996046523 5:118879802-118879824 GAGGGTAGAGAGTGGGAGGAGGG + Intronic
996537845 5:124596827-124596849 AGGGGTGAGGAGCAGGAAGAAGG + Intergenic
996985149 5:129552992-129553014 GAGAGTCAACAGTAGGAAGATGG - Intronic
997746126 5:136301885-136301907 TGGAGCAAAGAGCAGGAAGACGG - Intronic
997793110 5:136780557-136780579 GAGGATTAAGAGCAGTAAGATGG + Intergenic
998648287 5:144089066-144089088 GAAGAGAATGAGCAGGAAGAAGG - Intergenic
998658102 5:144205104-144205126 GGAGGTAAAGACAAGGAAGAAGG + Intronic
998718775 5:144917932-144917954 AAGGGTAAAGAAGAAGAAGACGG + Intergenic
999000241 5:147912920-147912942 GAGGGGAAAGAGAAGAGAGAAGG + Intergenic
999050953 5:148523421-148523443 GAGAGAAAAGGGGAGGAAGAGGG + Intronic
999220934 5:149976950-149976972 GAATGTAAAGGGCATGAAGAGGG - Intronic
999241748 5:150131937-150131959 GAGGGGAAGGAGCAGGGACATGG + Intronic
999309360 5:150541829-150541851 GAGGGGAAAGAGGTGGAGGAGGG + Intronic
999445025 5:151632469-151632491 GAGGTTAGAGAGGAGGAAGGTGG + Intergenic
999743407 5:154574024-154574046 GAGGGAAAAGATCAGGGCGAGGG + Intergenic
999863948 5:155679939-155679961 AAGGGAATAGTGCAGGAAGAAGG - Intergenic
1000489833 5:161897672-161897694 GAGAGAAAAGAGGGGGAAGATGG + Exonic
1000495357 5:161976243-161976265 GAGGGTAAAGGGTGGGAGGAGGG - Intergenic
1000643129 5:163729018-163729040 GAGGGTGGAGAGAGGGAAGAGGG - Intergenic
1000692425 5:164340010-164340032 GAGAAGAAAAAGCAGGAAGAGGG + Intergenic
1001044735 5:168363081-168363103 GAGGGTAGAGAACAAGAGGAAGG + Intronic
1001626514 5:173140327-173140349 AAAGGTTCAGAGCAGGAAGAAGG + Intergenic
1001724890 5:173888448-173888470 GAGGAGGAAGAGGAGGAAGAAGG + Exonic
1001801502 5:174548234-174548256 GAGGGTGAGGAGAAGGAAGAAGG - Intergenic
1001893818 5:175361913-175361935 GAGGAAAAAGAGAAGGAAGAGGG + Intergenic
1002091490 5:176809454-176809476 GAGGGGAATGAGCAGGGTGAGGG - Intergenic
1002381331 5:178831950-178831972 GAGGGGAAAGAGCAGGTTGGGGG - Intergenic
1002741773 5:181439584-181439606 GAGACTCAAGAGGAGGAAGAGGG + Intergenic
1002822963 6:745436-745458 GAGGGTAAAGGGTGGGAGGAGGG + Intergenic
1002855605 6:1035539-1035561 GATGGTAAACAGCACCAAGAAGG + Intergenic
1003285943 6:4734138-4734160 GAGGGGAAACAGCAGAGAGAGGG - Intronic
1003477610 6:6498538-6498560 GAGGATAAAGGGGAGGAAGAGGG - Intergenic
1003523874 6:6882501-6882523 GGAGGAAAAGAGCAGGAGGATGG - Intergenic
1003759690 6:9162771-9162793 GAGGGGAAAGAGAGAGAAGAAGG + Intergenic
1003872812 6:10415276-10415298 GTTGGTAAAGAGCTGGAAAAGGG - Intronic
1003990338 6:11480551-11480573 GAGGGAAATGGGCAGGGAGAAGG + Intergenic
1004278498 6:14258882-14258904 GAGGAGAAAGAGGAGGAGGAGGG + Intergenic
1004634995 6:17458277-17458299 CAGGATAAAGAGAAAGAAGATGG + Intronic
1004721030 6:18267209-18267231 GAGGGGAAAGTGCAGGAGGTGGG + Intergenic
1004945601 6:20609326-20609348 GAGGGAAAAGAGAGGGAGGAGGG - Intronic
1005083457 6:21980603-21980625 CAGGTTCCAGAGCAGGAAGAAGG - Intergenic
1005083557 6:21981131-21981153 CAGGTTCCAGAGCAGGAAGAAGG - Intergenic
1005116354 6:22342317-22342339 GAGGGTGGCGAGTAGGAAGAAGG - Intergenic
1005896928 6:30186321-30186343 GAGGGGGATGAGGAGGAAGAGGG - Exonic
1005921528 6:30406213-30406235 CAGGGGAAAGAGCAGGCAGAAGG - Intergenic
1005996044 6:30932058-30932080 GAGGGTCAAGAGGAGGACAAGGG + Exonic
1006250787 6:32781915-32781937 GAGGGTGGAGAGTGGGAAGAGGG - Intergenic
1006263169 6:32894165-32894187 GAGGGGAAAGAGGGGGAAGGGGG - Intergenic
1006457095 6:34138182-34138204 GAGGGCCAAGAGCAGGAACCAGG - Intronic
1006640372 6:35486405-35486427 GAGGGCAGAGAGCAGGGGGAAGG + Intronic
1006809096 6:36808422-36808444 GTGGGTGATGAGGAGGAAGAAGG - Intronic
1006824328 6:36923321-36923343 GAGGGGAAATAGCAAGAGGAAGG - Intronic
1007012984 6:38435579-38435601 GAGGGAAAAGAAAAGAAAGAAGG - Intronic
1007428815 6:41764474-41764496 GGGGGTAAAGTGCAGGGAGAAGG + Intergenic
1007482333 6:42158348-42158370 GAGGTGGAAGAGGAGGAAGAGGG - Intronic
1007666317 6:43515412-43515434 GATGGAAAAGAAGAGGAAGATGG + Intronic
1007772648 6:44203474-44203496 AAGGGGAAAGAGCAGCAGGAGGG + Intergenic
1008228433 6:48952576-48952598 GAGGAAAAAGAAGAGGAAGATGG + Intergenic
1008372064 6:50744189-50744211 GAGGGTAAAAAGTAGGAGGGTGG - Intronic
1008827051 6:55708748-55708770 GAGGGAATGGGGCAGGAAGAAGG - Intergenic
1008929820 6:56927009-56927031 GAGGGAAAAGAGCAGGTAAGAGG + Intronic
1008970636 6:57363844-57363866 GAGGAGAAAGAACAGGTAGAGGG - Intronic
1009159599 6:60265653-60265675 GAGGAGAAAGAACAGGTAGAGGG - Intergenic
1009362624 6:62834378-62834400 GAGGGTAAAGAATAGGAGGAAGG - Intergenic
1009485233 6:64213087-64213109 GAGGGTGCAGAGTGGGAAGAGGG + Intronic
1009554066 6:65139433-65139455 GAGGGTGAAGGGAAGGAAGAGGG + Intronic
1009887442 6:69640612-69640634 CAAGATAAAGACCAGGAAGAGGG + Intergenic
1010389279 6:75319069-75319091 GAGGATGAAGAGGAGGAAGAAGG - Intronic
1010414607 6:75599647-75599669 GAGGGGAAAGAGGAGAGAGAAGG + Intergenic
1010659025 6:78547313-78547335 GAGGGTAGAGAGTGGGAGGAGGG - Intergenic
1010703858 6:79083985-79084007 GAGGAAAGAAAGCAGGAAGAGGG - Intergenic
1010791771 6:80073566-80073588 GATGGAAAAGAGAAGGAAAATGG - Intergenic
1011213608 6:84981226-84981248 AAGAGTAAAGAGCATGGAGAAGG + Intergenic
1011417446 6:87137328-87137350 GAGGAGAAAGAGGAGAAAGAGGG - Intergenic
1012088358 6:94858949-94858971 TAGGGGAAAAAGCAGAAAGAGGG + Intergenic
1012121192 6:95368648-95368670 AAGGGGAAAGAAGAGGAAGAAGG + Intergenic
1012140007 6:95614874-95614896 CAGGGAAAAGAGAAGGAGGAGGG - Intergenic
1012266173 6:97145976-97145998 CTGGCTAAAGAGCAAGAAGATGG + Exonic
1012464239 6:99499935-99499957 GAGGCTAAAGATCTGAAAGAAGG - Intronic
1012840526 6:104323874-104323896 GAGGGTAAAGAACGGGAGGAGGG + Intergenic
1013046697 6:106492752-106492774 GAGGTAAAAGGGAAGGAAGAAGG - Intergenic
1013340697 6:109212730-109212752 GAAGGAGAAGAGCTGGAAGAAGG - Intergenic
1013670914 6:112401512-112401534 GAGGGTAGAGAATAGGATGAGGG - Intergenic
1013768887 6:113605049-113605071 GAGGGGCAAGAGAAGGAGGAAGG - Intergenic
1014525552 6:122497415-122497437 GAAGGCAAAGAGCAGCAAGTTGG + Intronic
1014653125 6:124065992-124066014 GAGATTAAAGAGAAGGAAGTGGG + Intronic
1014662278 6:124187778-124187800 GAGGGTCAAGAGGAAAAAGAAGG - Intronic
1014982582 6:127962581-127962603 GAGAGTAAAGGGAAGGAAAATGG - Intergenic
1015098209 6:129442670-129442692 GAGGGTGGAGAGCAGGAGGAGGG - Intronic
1015238932 6:131002344-131002366 GAGGGGAGAGAGAAGAAAGAAGG + Intronic
1015304956 6:131697106-131697128 AAGGGTAAAGAGAAGGAGGCAGG + Intronic
1015463097 6:133516235-133516257 GAGGGTGAAGGGTAGGAGGAGGG + Intronic
1015536432 6:134271754-134271776 GAGGGTGAAGAGTGGGAGGAGGG - Intronic
1015863018 6:137700132-137700154 GGGAGTAAACAGCAGGAAGGAGG + Intergenic
1016054025 6:139559708-139559730 GAGGGTAGAGAGTGGGAGGAGGG - Intergenic
1016369367 6:143356615-143356637 AAGGGGAAAGAGAAGGGAGAGGG - Intergenic
1016650662 6:146455964-146455986 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
1016771432 6:147856716-147856738 GACGGTTAAAAGGAGGAAGATGG - Intergenic
1016784306 6:147993271-147993293 GGGAGTAAAGAGAAGGGAGAGGG + Intergenic
1017276849 6:152579662-152579684 GAGGGTAGAGGATAGGAAGAGGG - Intronic
1017678269 6:156837716-156837738 GAGGGTGCAGAGGAAGAAGATGG + Intronic
1017928130 6:158928120-158928142 GAGGGTGGAGAGTGGGAAGAGGG - Intergenic
1018002218 6:159589387-159589409 GTGTGTAAAGAGCAGGAGGCTGG - Intergenic
1018415943 6:163602133-163602155 GAGGACAAAGAGGAGGAAGAGGG + Intergenic
1018735491 6:166684634-166684656 GAGGGCAGAGAGCAGGGTGAAGG - Intronic
1018789355 6:167134751-167134773 CAGGGAAAAGAGGAGGAAGATGG + Intronic
1018818770 6:167356443-167356465 GAGTATAAAGGGCTGGAAGATGG - Intronic
1019246913 6:170715341-170715363 GAGACTCAAGAGGAGGAAGAGGG + Intergenic
1019535385 7:1526534-1526556 GAGGGGGAAGAAGAGGAAGAGGG + Intergenic
1019656768 7:2200118-2200140 GAGGGTGAAGAGCGGGACCAAGG + Intronic
1019826028 7:3285114-3285136 GAGGGAAGGCAGCAGGAAGAGGG - Intergenic
1020922997 7:14288637-14288659 GAAGGCAAAGAGTAGGAATAAGG - Intronic
1021132687 7:16930153-16930175 AAGGGGAAAGAGCAGGCAGAAGG - Intergenic
1021134120 7:16944859-16944881 AAGGGGAAAGAGCAGGCAGGAGG + Intergenic
1021290233 7:18834572-18834594 AGGAGAAAAGAGCAGGAAGAAGG + Intronic
1021327973 7:19297752-19297774 GAGGGTAGAGAGTGGGAGGAGGG + Intergenic
1021982567 7:26068901-26068923 GAGGCTGGAGGGCAGGAAGAGGG - Intergenic
1022043001 7:26598112-26598134 GAGGGTGGAGAGTAGGAGGAGGG - Intergenic
1022066492 7:26864344-26864366 GCAGGTAAAGAGCGGGAAGGCGG - Exonic
1022095337 7:27137246-27137268 CAGGGGAAAGAGCAGGAGAAAGG + Intronic
1022177638 7:27887124-27887146 GAGGGTAAAGGGTGGGAGGAGGG + Intronic
1022431424 7:30326278-30326300 GAGGGTGGAGAGTAGGAGGAAGG - Intronic
1023031743 7:36095642-36095664 GAGGGAAGAGAGAAGGAAGCGGG + Intergenic
1023229604 7:38012815-38012837 AAGGGTGAAGAGTGGGAAGAGGG - Intronic
1023814339 7:43938166-43938188 CAAGGTACAGAGCTGGAAGAGGG - Intronic
1024124909 7:46283980-46284002 GAGAGTAAAGAACAGCGAGACGG + Intergenic
1024173252 7:46811519-46811541 GAGGGTGAAGAGCAGTGGGAGGG - Intergenic
1024218298 7:47266518-47266540 CAGGGCAAAGGGCAGAAAGAGGG + Intergenic
1024323099 7:48089055-48089077 GAGGGTGGAGAGGAGGAAGGCGG + Intronic
1024329788 7:48144370-48144392 GAGGGCAAAGAGTAGGTACAAGG + Intergenic
1024423322 7:49196199-49196221 GAGGGTAGAGAGTGGGAGGAAGG - Intergenic
1024634365 7:51275320-51275342 GAGGGAAAAAACCAGGAGGATGG - Intronic
1024690458 7:51796058-51796080 GAGGGTGGAGAGTGGGAAGAGGG - Intergenic
1025198730 7:56949510-56949532 GAGGGAGAAGAGGAGGGAGAGGG - Intergenic
1026023738 7:66729467-66729489 GAGGATGGAGAGCAGGAGGAAGG - Intronic
1026191930 7:68136553-68136575 GAGGGGAAGGAGGAGGATGAGGG + Intergenic
1026297958 7:69072298-69072320 GAGCCAAAAGAGGAGGAAGAAGG + Intergenic
1026672854 7:72404761-72404783 GACTGTAGAAAGCAGGAAGAAGG + Intronic
1027624205 7:80527783-80527805 GAGGCTAGATAGCAGCAAGATGG + Intronic
1028150318 7:87364733-87364755 GAGGATCAAGAGCAGAAAGGTGG + Intronic
1028342122 7:89734632-89734654 GAGGGTAGAGAGTTGGAGGAAGG + Intergenic
1028389737 7:90301471-90301493 GATGGTAGAGAGTAGGAGGAGGG - Intronic
1028606496 7:92661669-92661691 GAGGGTAAAGGGGAAGAAGAGGG + Intronic
1028762291 7:94509782-94509804 GAGGCTAAAGAGGAGGAGGAAGG + Exonic
1028911881 7:96216745-96216767 GAGGGTAAAGGGTGGGAGGAGGG + Intronic
1028940663 7:96519030-96519052 GAAAGTAGAGAGCAGGGAGAAGG + Intronic
1029195147 7:98800274-98800296 GAGGGTGGAGGGCAGGAGGAGGG - Intergenic
1029309633 7:99650706-99650728 GAAGGTAGAGAGGAGGAGGAGGG - Intronic
1029901394 7:104044065-104044087 GAGGGTGGAGGGAAGGAAGAGGG + Intergenic
1030047197 7:105508250-105508272 GAGGAAGAAGAGGAGGAAGATGG - Exonic
1030376853 7:108762325-108762347 GAGGGTTGAGGGCAGGAGGAGGG + Intergenic
1030379001 7:108789993-108790015 GAGAGTGAAGGGCAGGAGGAGGG - Intergenic
1030560999 7:111085966-111085988 GAGGGTTAAGAGTGGGAGGAGGG + Intronic
1030562483 7:111107194-111107216 GAGGAAAGAGAGAAGGAAGAAGG - Intronic
1031181739 7:118427302-118427324 GAAGATGAAGAGCAGGAATAAGG - Intergenic
1031258068 7:119482063-119482085 GAGGGGATGGAGCAGGAAGGTGG - Intergenic
1031289672 7:119917209-119917231 GAGGGTAAAGAGTGGGAGGAGGG + Intergenic
1031647740 7:124247460-124247482 GAGGGTAGAGGGAAGGAGGAGGG - Intergenic
1031663860 7:124460864-124460886 GAGGGTAGAGAGTGGGAGGAGGG - Intergenic
1031697388 7:124874819-124874841 GAGAGTAAAGGGGAGAAAGAAGG + Intronic
1031865478 7:127034524-127034546 GAGGGAAAAGGGAAGGAACAGGG - Intronic
1031893043 7:127317226-127317248 GAGGGTTGAGAGTGGGAAGAGGG + Intergenic
1032034807 7:128513905-128513927 GAGAGGAAAAAGGAGGAAGAAGG - Intergenic
1032198529 7:129803678-129803700 GTGGGTCAAGAGCAGCTAGAGGG + Intergenic
1032275830 7:130454439-130454461 GAAAGTAGAGAGAAGGAAGATGG + Intergenic
1032439760 7:131933401-131933423 GAGGAAAAAGAGGAAGAAGAAGG + Intergenic
1032466793 7:132151238-132151260 GAGGATGAAGAGGAAGAAGAAGG + Intronic
1032523852 7:132564393-132564415 GAGGGGGAGGAGCAAGAAGAGGG - Intronic
1032655946 7:133929714-133929736 GAGGGTGAAGGGTAGGAGGAGGG - Intronic
1033143486 7:138849707-138849729 GAGGGTAGAGGGTGGGAAGAGGG - Intronic
1033229320 7:139584159-139584181 GAGGGGAGAGGGCAGGAACAGGG + Intronic
1033399270 7:141006436-141006458 AAGGGAAAAGAGCAGCAAAAAGG - Exonic
1033454330 7:141488947-141488969 GAGGAGAAAGAGAAGGAGGAGGG + Intergenic
1033540718 7:142353377-142353399 GAGGTTTATGAGCAGGAAGGAGG - Intergenic
1033544154 7:142384860-142384882 GAGGTTTATGAGCAGGAAGGAGG - Intergenic
1034168277 7:149042643-149042665 GAGGGGGGAGAGGAGGAAGAGGG + Intergenic
1034453579 7:151151363-151151385 GAGGGGAAAGAACAGGCTGATGG - Intronic
1035501228 8:92612-92634 GAGACTCAAGAGGAGGAAGAGGG - Intergenic
1036193308 8:6691489-6691511 GAGGGTAAAGAGTGGGAGGAGGG - Intergenic
1036472852 8:9066175-9066197 GAGGACAAAGAAGAGGAAGAAGG - Intronic
1036504804 8:9345590-9345612 GAGGGAAAAGAGCAGCCAAAAGG + Intergenic
1036585855 8:10122677-10122699 GAGTGTAGAGGGCAGGAGGAAGG - Intronic
1036639160 8:10571533-10571555 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
1037100362 8:15036403-15036425 GAGGGTATAGAGTTGGAGGAGGG + Intronic
1037103088 8:15072126-15072148 GAAAATAAAGACCAGGAAGATGG - Intronic
1037172909 8:15914724-15914746 GAGGGGAAAGGACATGAAGAGGG + Intergenic
1037300254 8:17444021-17444043 GAGGAGAAGGAGGAGGAAGAAGG - Intergenic
1037583465 8:20260730-20260752 GAGGGTCAAGAGGTAGAAGATGG + Intronic
1037689435 8:21170186-21170208 GAGGGAAAAGGGAAGGAGGATGG - Intergenic
1037954287 8:23042135-23042157 CAGGGTCAAGACCAGGAAGCAGG - Intronic
1038022117 8:23559429-23559451 GAGGGTGGAGAGGAGGAAAAAGG - Intronic
1038163165 8:25059833-25059855 GAGGGTAAAGGGCAAGAAGATGG - Intergenic
1038461285 8:27719379-27719401 GAGGGTGAAGAGTGGGAGGAGGG + Intergenic
1038483747 8:27919182-27919204 GAGGGGAAAGAGGAGGAGGAGGG + Intronic
1038510600 8:28130879-28130901 GAGGCTGAAAAGCAGGCAGAGGG + Intronic
1038990825 8:32865852-32865874 GAGGGTGGAGGGTAGGAAGAGGG + Intergenic
1039108228 8:34012837-34012859 AAGGGAAAAGAGCAAGCAGAAGG + Intergenic
1039226373 8:35392736-35392758 GGGGGTAAAGGGGTGGAAGATGG + Intronic
1039335004 8:36579111-36579133 GAGGGTAAAGGGCAGGAAGAGGG + Intergenic
1039383794 8:37112123-37112145 GAGGGTAAATGGCAGGAGGAGGG + Intergenic
1039918191 8:41875122-41875144 GAAGAGAAAGGGCAGGAAGAGGG - Intronic
1039966420 8:42287305-42287327 GAGGTTAAAGCCCATGAAGATGG + Intronic
1040024645 8:42770565-42770587 AAGGGTGCAGAGCAGGAGGATGG + Intronic
1040520593 8:48172961-48172983 GAGGGTGGACAGGAGGAAGAGGG - Intergenic
1040619152 8:49070242-49070264 GAGGGTGAAGGGCGGGAGGAGGG + Intronic
1040748758 8:50679896-50679918 GAGGGTCAAGATCAGAAATAAGG + Intronic
1041029582 8:53723386-53723408 GAGGGAAAAGACCAGTAAGGAGG - Intronic
1041067041 8:54092087-54092109 GAGGAAAAGGAGAAGGAAGAGGG + Intronic
1041577839 8:59420398-59420420 GAGGGTGAAGGGTGGGAAGAAGG + Intergenic
1041755173 8:61305699-61305721 GAGGGTAGAGAGTGGGAGGAGGG - Intronic
1042217474 8:66440562-66440584 GAGGCTAAAGAACAAGAACAAGG + Intronic
1043023525 8:75036888-75036910 GATGATTGAGAGCAGGAAGAAGG + Intergenic
1043189177 8:77195405-77195427 GAGGGTGAAGGGTAGGAGGAGGG + Intergenic
1043320639 8:78981284-78981306 TAAGGGAAAGAGCTGGAAGAAGG + Intergenic
1043386432 8:79752561-79752583 GAGGAAAAGGAGGAGGAAGAAGG + Intergenic
1043398861 8:79864470-79864492 GAGGAAAAAGAAAAGGAAGATGG - Intergenic
1043540328 8:81255137-81255159 GCGCTGAAAGAGCAGGAAGAGGG + Intergenic
1044239893 8:89876711-89876733 GTGGGTAAAAATAAGGAAGAGGG - Intergenic
1044426637 8:92059049-92059071 GAATGTAAAGAGAAGGGAGAGGG + Intronic
1044557930 8:93584850-93584872 GAGGGTGGAGGGCAGGAGGAGGG + Intergenic
1044654027 8:94529075-94529097 GAAGGTGAAGAGGATGAAGAAGG - Exonic
1044769366 8:95613888-95613910 CAGGGAAAAGGGCAGGAAGGGGG - Intergenic
1045017188 8:98010091-98010113 GAGGCTAAAGAAGTGGAAGAGGG - Intronic
1045242183 8:100412152-100412174 GAGCTCAAAGAGCAGGAAGAGGG - Intergenic
1045334357 8:101185554-101185576 GTGTGTCAATAGCAGGAAGAAGG - Intronic
1045591391 8:103602448-103602470 GAGGGTGAAGAGTGGGAGGAGGG - Intronic
1045618201 8:103942135-103942157 GAGGGTAGAGGGTAGGAGGAGGG - Intronic
1046282650 8:112053860-112053882 GAGGGTAGAGAGTGGGAGGAGGG - Intergenic
1046405044 8:113762431-113762453 GAGGGTGTAGAGCGGGAGGAGGG + Intergenic
1046520676 8:115321060-115321082 AAGAGAATAGAGCAGGAAGAAGG - Intergenic
1046744472 8:117862299-117862321 GGGGCTATAGAGCAGGAAGCAGG - Intronic
1047151689 8:122271299-122271321 GTGAGTAAAGTTCAGGAAGAAGG - Intergenic
1047321188 8:123785272-123785294 GACAGGAAAGAGCAGGAAAAGGG + Intronic
1047360264 8:124162642-124162664 GAGAGTAGGGAGCAGAAAGACGG - Intergenic
1047606568 8:126480496-126480518 GAAGGTGAAAAGTAGGAAGAAGG + Intergenic
1047829823 8:128617106-128617128 GGGAGCAAAGAGCAGGAGGAAGG + Intergenic
1048231981 8:132651381-132651403 GAGGTGACAGAGGAGGAAGATGG - Intronic
1048240678 8:132738697-132738719 GAGGGGAAAGAGCAGGGATGTGG - Intronic
1048512826 8:135078079-135078101 GAGGGCAGAGAGAAGGAAGAGGG - Intergenic
1048777217 8:137960407-137960429 GAGGAAGAAGAGAAGGAAGAGGG - Intergenic
1049356676 8:142192643-142192665 GAAGATGAAGAGCAGGAAGGAGG + Intergenic
1049356816 8:142193128-142193150 GAGAGGAGAGAGCAGGGAGAAGG + Intergenic
1049533931 8:143169361-143169383 GAGGGTAAGCAGTAGGATGATGG - Intergenic
1050039679 9:1476088-1476110 GAGGGTGGAGAGTGGGAAGAGGG - Intergenic
1050070780 9:1811068-1811090 GAGGGTGGAGAGCGGGAGGAGGG + Intergenic
1050077071 9:1876341-1876363 GAGGGCAAAGAGCAGCAACGTGG + Intergenic
1050803642 9:9646617-9646639 TAGTATAAAGAGGAGGAAGAAGG - Intronic
1051000739 9:12279139-12279161 TAGGGTAAAGAGGAGGAGTAAGG - Intergenic
1051301846 9:15660463-15660485 GAGGGAAAAGGGCAGGAAGGGGG - Intronic
1051494609 9:17705800-17705822 GAGGGTAGAGAGTGGGAGGAGGG + Intronic
1051740230 9:20244335-20244357 CATTGTAAAGAGCAGGAAGGAGG + Intergenic
1051849596 9:21490973-21490995 CAGAGCAAAGAGCAGGAGGATGG + Intergenic
1052044016 9:23773744-23773766 GAAGGAAAAGAGCAGGTAAAGGG + Intronic
1052059353 9:23941897-23941919 GAGAGGAAAGAGGAGGAAAAAGG + Intergenic
1052854071 9:33396134-33396156 GAGGATAAAGAGGAAGAAGAGGG + Intronic
1052854523 9:33398824-33398846 GAGGGTACAGACTAAGAAGAGGG + Intronic
1052918204 9:33940000-33940022 GAGGGGAAAGAGGAGGGGGAGGG + Intronic
1053100533 9:35368202-35368224 GAGGGTGAAGGGTAGGAGGAGGG - Intronic
1053150129 9:35737943-35737965 GAGGGGCAAGGGCAGGAACATGG + Intronic
1053570270 9:39297124-39297146 GAGGGTAAAGGGAGGGAAGACGG + Intergenic
1053682085 9:40492298-40492320 GAGGATAAAGAGGAAGAAGAGGG + Intergenic
1053836224 9:42138079-42138101 GAGGGTAAAGGGAGGGAAGACGG + Intergenic
1053874351 9:42528284-42528306 GAGGGTAAAGAGAGAGAAGGAGG + Intergenic
1053898262 9:42766304-42766326 GAGGGTAAAGAGAGAGAAGGAGG - Intergenic
1053932072 9:43120624-43120646 GAGGATAAAGAGGAAGAAGAGGG + Intergenic
1053932509 9:43123312-43123334 GAGGGTACAGACTAAGAAGAGGG + Intergenic
1054091892 9:60856134-60856156 GAGGGTAAAGGGAGGGAAGACGG + Intergenic
1054113306 9:61131724-61131746 GAGGGTAAAGGGAGGGAAGACGG + Intergenic
1054126879 9:61321882-61321904 GAGGGTAAAGGGAGGGAAGACGG - Intergenic
1054267984 9:62938470-62938492 GAGGGTAAAGAGAGAGAAGGAGG - Intergenic
1054281628 9:63132634-63132656 GAGGATAAAGAGGAAGAAGAGGG - Intergenic
1054295182 9:63327795-63327817 GAGGATAAAGAGGAAGAAGAGGG + Intergenic
1054295625 9:63330486-63330508 GAGGGTACAGACTAAGAAGAGGG + Intergenic
1054393202 9:64632301-64632323 GAGGATAAAGAGGAAGAAGAGGG + Intergenic
1054393645 9:64634990-64635012 GAGGGTACAGACTAAGAAGAGGG + Intergenic
1054427851 9:65137511-65137533 GAGGATAAAGAGGAAGAAGAGGG + Intergenic
1054428293 9:65140203-65140225 GAGGGTACAGACTAAGAAGAGGG + Intergenic
1054502086 9:65881340-65881362 GAGGGTACAGACTAAGAAGAGGG - Intronic
1054502525 9:65884027-65884049 GAGGATAAAGAGGAAGAAGAGGG - Intronic
1054594394 9:67050445-67050467 GAGGGTAAAGGGAGGGAAGACGG - Intergenic
1054744316 9:68839398-68839420 GAAGGTAAAGAGTGGGGAGAAGG + Intronic
1054901158 9:70370779-70370801 GAGGGGAAAGGGGAGGAGGAGGG + Intergenic
1055256170 9:74373731-74373753 GATGGTAAAGGGAAGGAATAGGG - Intergenic
1055324753 9:75117868-75117890 GAGGGTCAAGAGGAGAATGAAGG - Intronic
1055369032 9:75577022-75577044 GAGGCTAAGGAGAAGGCAGATGG - Intergenic
1055372851 9:75619349-75619371 GAGGGTAAAGGGTGGGAGGAGGG - Intergenic
1055385088 9:75753032-75753054 GAGGGTATAGAAGAGAAAGAAGG + Intergenic
1055624948 9:78166836-78166858 CAGGGAAAAAAGCAGGAAGAAGG - Intergenic
1055637211 9:78290573-78290595 GAATGTACAGGGCAGGAAGAAGG - Intergenic
1055782753 9:79837188-79837210 GAGGGTGGAGAGTAGGAGGAGGG - Intergenic
1055928598 9:81536474-81536496 GAGGGCATAGAGGAGGAAGAGGG + Intergenic
1056236095 9:84596201-84596223 GAGAGGAGAGAGGAGGAAGATGG - Intergenic
1056513363 9:87327130-87327152 GAGGGGGAGGAGGAGGAAGAAGG + Intergenic
1056587691 9:87939032-87939054 GAGGATTAGGAGAAGGAAGAGGG - Intergenic
1056597669 9:88021016-88021038 GAAGGAAAAGAGGAAGAAGAAGG - Intergenic
1057155878 9:92838848-92838870 GAGGGTGAAGAGTGGGAAGAAGG + Intergenic
1057167624 9:92941139-92941161 GAGGGAAAACAGCAGGGGGAAGG + Intergenic
1057529615 9:95832351-95832373 GAGGCTTGAGGGCAGGAAGAAGG - Intergenic
1057802134 9:98197085-98197107 GAGGGGAGAAAGGAGGAAGAAGG + Intergenic
1058174356 9:101720848-101720870 GAGGGTGAAGAGTGGGAGGAGGG + Intronic
1058234836 9:102476964-102476986 CAGGGTACAGAGCAGGGAGTGGG - Intergenic
1058721475 9:107768503-107768525 TAGGGTGGAGAGCAGGAAGGGGG - Intergenic
1058742183 9:107954904-107954926 GAGAGGAAAGAGGAGGAAGGAGG - Intergenic
1059551064 9:115229577-115229599 GAGGAGAAAGAGCAGGGAGGAGG + Intronic
1059578595 9:115519199-115519221 GAGAGAAATGAGGAGGAAGAAGG - Intergenic
1059732772 9:117073407-117073429 GAGGGTGGACAGTAGGAAGAGGG - Intronic
1059812026 9:117865957-117865979 AAGGGTAAAGGGGAGGAAGCAGG + Intergenic
1060026070 9:120172622-120172644 GAGGGGAAAGAGTGGGAAGGGGG + Intergenic
1060299619 9:122367623-122367645 GTAGGTAAAGAGGAGGAGGAAGG + Intergenic
1060554545 9:124501536-124501558 GAGGGGAAAGAGCAGGAGAGAGG + Intronic
1061061852 9:128254462-128254484 GAAGGGAAAGGGGAGGAAGATGG - Intronic
1061213404 9:129206399-129206421 GAGGGTAAAGAGTAGACAGAGGG - Intergenic
1061499044 9:130991794-130991816 GAGGGCAGAAAGCAGGCAGAAGG - Intergenic
1061648407 9:132025761-132025783 GAGGGTTAAGAACATGAAAAGGG + Intronic
1061738392 9:132679471-132679493 GACGATGAACAGCAGGAAGAAGG + Exonic
1061781198 9:132996935-132996957 GAGGGTTCAGAACAAGAAGAGGG - Intergenic
1061791737 9:133062757-133062779 GAGTGTGGAGAGCAGGCAGACGG + Intronic
1061795413 9:133083323-133083345 GAGTGTGGAGAGCAGGCAGACGG + Intronic
1062578155 9:137218033-137218055 GAGGGGAGAGAGCAGGCAGCAGG + Intergenic
1203779992 EBV:95963-95985 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203779998 EBV:95981-96003 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203780016 EBV:96026-96048 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203780022 EBV:96044-96066 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203780036 EBV:96080-96102 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203780042 EBV:96098-96120 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203780052 EBV:96125-96147 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203780066 EBV:96161-96183 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203780072 EBV:96179-96201 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203780082 EBV:96206-96228 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203780096 EBV:96242-96264 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203780120 EBV:96308-96330 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203780176 EBV:96461-96483 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203780186 EBV:96488-96510 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203780223 EBV:96587-96609 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203607684 Un_KI270748v1:70800-70822 GAGACTCAAGAGGAGGAAGAGGG + Intergenic
1185688302 X:1948368-1948390 GAGGGGAGAGGGGAGGAAGAGGG + Intergenic
1185708453 X:2282595-2282617 GAGGGGAGAGAGAAGAAAGAGGG + Intronic
1185961015 X:4545799-4545821 GGGAGCAAAGAGCAGGAGGACGG + Intergenic
1186117516 X:6320706-6320728 GTGGGGGAAGAGTAGGAAGATGG - Intergenic
1186135111 X:6511068-6511090 GAGGGTAGAGAGTGGGAGGAGGG + Intergenic
1186402333 X:9271342-9271364 GAGGGTGGAGGGCAGGAGGAGGG - Intergenic
1186452134 X:9682846-9682868 GAGGCAAATGAGCAGGAAGCAGG - Intronic
1186921003 X:14280247-14280269 GAGGGTAGAGGGCGGGAGGAAGG - Intergenic
1187046592 X:15653494-15653516 GAGGAAAAAGAGGAGGAAGAAGG - Intronic
1187047621 X:15662959-15662981 GAGAGTAAAGATTAGAAAGAGGG - Intronic
1187060260 X:15780239-15780261 GAGTGAAAAGAGCAGCAAAATGG - Intronic
1187607328 X:20899913-20899935 GAGGGTGGAGAGTAGGAGGAGGG - Intergenic
1187732023 X:22264926-22264948 GAGGGTGTAGAGCAAGCAGATGG + Intergenic
1187802009 X:23074425-23074447 GAGGGTAAACAGTGGGAGGAGGG + Intergenic
1188072086 X:25729483-25729505 GAGGGTGGAGAGTGGGAAGAGGG + Intergenic
1188192446 X:27188611-27188633 GAACTTAAAAAGCAGGAAGAGGG - Intergenic
1188735705 X:33712309-33712331 GAAGGGAAAGGGTAGGAAGAAGG + Intergenic
1188755986 X:33964333-33964355 GAGGGTGAAGAGTGGGAGGAGGG - Intergenic
1188879351 X:35472716-35472738 GAGGGTGGAGGGTAGGAAGAAGG - Intergenic
1188895715 X:35665905-35665927 AAGGGGAAAGAGCAAGCAGAAGG - Intergenic
1188959727 X:36476195-36476217 GAGGGTAGACAATAGGAAGAAGG + Intergenic
1189110706 X:38286414-38286436 GAAGGGAAAGGGGAGGAAGAAGG - Exonic
1189649655 X:43175841-43175863 AAGGGAAAAGAGAAAGAAGAGGG + Intergenic
1189921297 X:45905444-45905466 GAGGGTGAAGAGTGGGAATATGG - Intergenic
1190070723 X:47277080-47277102 GAGTGAGAAAAGCAGGAAGAAGG + Intergenic
1190287859 X:48972400-48972422 GAGGGTAAAGGGAATGTAGAGGG + Intergenic
1190575507 X:51832607-51832629 GAGGGGAAAGAGAAGGGAAAAGG + Intronic
1190942975 X:55061386-55061408 GAGAGTAGAGAGCAGGAGGAGGG - Intergenic
1191679521 X:63826323-63826345 GAGGGAGAAGGACAGGAAGAGGG + Intergenic
1191715373 X:64190474-64190496 GAGGACGAAGAGGAGGAAGAAGG - Exonic
1191820665 X:65303212-65303234 GAGGGTAAAGGACGGGAGGAAGG + Intergenic
1191896688 X:66000299-66000321 GAAGAAAAAGAGAAGGAAGAAGG - Intergenic
1191929816 X:66358848-66358870 GAGGGTGGAGGGTAGGAAGAGGG + Intergenic
1191994937 X:67083309-67083331 GAAGGTAAAGAATAGAAAGATGG - Intergenic
1192161402 X:68790832-68790854 GGTGGTAAAGAGGAGAAAGAGGG - Intergenic
1192510209 X:71716887-71716909 GAGGGTAAAGAGGGAGAGGAGGG + Intronic
1192516488 X:71764666-71764688 GAGGGTAAAGAGGGAGAGGAGGG - Intronic
1192664689 X:73077609-73077631 CAGGGAAAAGGACAGGAAGAGGG + Exonic
1192675826 X:73195251-73195273 GAGGATAGAGAGTGGGAAGAAGG - Intergenic
1192968401 X:76204940-76204962 GAGGGTACAGAGAAAGAAGTGGG - Intergenic
1193005397 X:76612797-76612819 AAGGGTAAAGGGGAGGAAGACGG + Intergenic
1193407104 X:81114857-81114879 GATGGAAAAGAGAATGAAGATGG - Exonic
1193747993 X:85306701-85306723 AGGAGTAAAGATCAGGAAGAGGG + Intronic
1193797936 X:85899252-85899274 GGGGGTAAGGAGAAAGAAGAGGG + Intronic
1193932179 X:87566913-87566935 GAGGGTGGAGGGCAGGAGGAGGG + Intronic
1193947611 X:87757401-87757423 GAGGGTGGAGAGCGGGAGGAGGG - Intergenic
1194140547 X:90203739-90203761 GAAGGTAAAGAGAAAGAAGGAGG - Intergenic
1194200357 X:90947469-90947491 GAGGGAAAAGAAAAGAAAGAAGG - Intergenic
1194369062 X:93047945-93047967 GAGAGTAAAGGGTGGGAAGAGGG + Intergenic
1194563628 X:95454060-95454082 GAGGGTGAAGGGCAGTAGGAGGG - Intergenic
1194596245 X:95862151-95862173 GAGGGTATCAAGCAGGAGGAAGG + Intergenic
1194673181 X:96760907-96760929 GAGGATAAAATGCAGAAAGAAGG - Intronic
1194728666 X:97428656-97428678 GAGGGTTAAGAGAAGAAGGAGGG - Intronic
1195110106 X:101639786-101639808 AAGGGCAGAGAGCAGGGAGATGG + Intergenic
1195159084 X:102154306-102154328 GAAGATAAAAAGCAAGAAGAGGG + Intronic
1195394983 X:104400703-104400725 GAGGGTAAAGAGGTCTAAGAAGG - Intergenic
1195586614 X:106572192-106572214 GAGGGTAGAGGGTAGGAAAAGGG + Intergenic
1195907349 X:109857914-109857936 TAGGGTAAAGAACACAAAGAAGG - Intergenic
1196003540 X:110811597-110811619 TAGGGAAAAGATCAGGTAGATGG + Intergenic
1196764621 X:119231713-119231735 GAGGATGAGGAGTAGGAAGAAGG + Intergenic
1196899204 X:120366657-120366679 GAGGAAAAGGAGGAGGAAGAGGG + Exonic
1196943745 X:120803634-120803656 GAGGGTGGAGGGCAGGAGGAGGG - Intergenic
1197625583 X:128798572-128798594 GAGGGTGGAGGGTAGGAAGAGGG + Intergenic
1197753342 X:129980231-129980253 GAGGGGAAGGAGGAGGAGGAAGG - Intergenic
1197825692 X:130588081-130588103 GAAGGGAAAGACCAGGAAGTTGG - Intergenic
1197862596 X:130986337-130986359 GAGGGTAGAGAGTTGGAGGAGGG - Intergenic
1198197015 X:134373404-134373426 GAGGGTAAAGAGAAAGAAGTCGG - Exonic
1198453758 X:136794672-136794694 GAGGATGGAGAGCAGGAGGAGGG - Intergenic
1198702118 X:139408052-139408074 GAAGGTAGAGAGCAGAAGGATGG - Intergenic
1198778754 X:140210709-140210731 GAGGGTGAAGCGTAGGAGGAGGG + Intergenic
1199407546 X:147480166-147480188 GAGGGTGGAGAGTGGGAAGAGGG - Intergenic
1199474998 X:148235397-148235419 GGAGGTAAAGAGCAGAAGGATGG + Intergenic
1199680836 X:150223577-150223599 GAGAGAAAAGAGAAGGAACATGG + Intergenic
1199770382 X:150971490-150971512 AAGGGTGGAGAGCAGGAGGAGGG + Intergenic
1199878446 X:151953892-151953914 GGGGTCAAAGAGAAGGAAGAGGG + Exonic
1200037624 X:153343668-153343690 GAGGGAAGAGAGCAGGAATGGGG - Intronic
1200078437 X:153563691-153563713 GAGCTTGAAGAGCAAGAAGAGGG - Intronic
1200486306 Y:3772844-3772866 GAAGGTAAAGAGAAAGAAGGAGG - Intergenic
1200546352 Y:4523864-4523886 GAGGGAAAAGAAAAGAAAGAAGG - Intergenic
1200677267 Y:6164279-6164301 GAGAGTAAAGGGTGGGAAGAGGG + Intergenic
1201453008 Y:14136324-14136346 AAGGGAAAAGAGAAGGAAAATGG - Intergenic
1201479825 Y:14427608-14427630 GTGGGGAAAGAGCAGGGAGATGG + Intergenic
1202376919 Y:24246373-24246395 GAAGGGAAAGGGGAGGAAGATGG - Intergenic
1202493861 Y:25423748-25423770 GAAGGGAAAGGGGAGGAAGATGG + Intergenic