ID: 954369170

View in Genome Browser
Species Human (GRCh38)
Location 3:50161222-50161244
Sequence ATGCATGCAAGTAAGCAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 287
Summary {0: 1, 1: 0, 2: 3, 3: 21, 4: 262}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954369161_954369170 20 Left 954369161 3:50161179-50161201 CCCCTGGGACCTTGCGTCCGCTC 0: 1
1: 0
2: 0
3: 3
4: 142
Right 954369170 3:50161222-50161244 ATGCATGCAAGTAAGCAGGAGGG 0: 1
1: 0
2: 3
3: 21
4: 262
954369162_954369170 19 Left 954369162 3:50161180-50161202 CCCTGGGACCTTGCGTCCGCTCT 0: 1
1: 0
2: 1
3: 2
4: 52
Right 954369170 3:50161222-50161244 ATGCATGCAAGTAAGCAGGAGGG 0: 1
1: 0
2: 3
3: 21
4: 262
954369167_954369170 3 Left 954369167 3:50161196-50161218 CCGCTCTGGGTGTTGTTTTTGTC 0: 1
1: 0
2: 3
3: 47
4: 446
Right 954369170 3:50161222-50161244 ATGCATGCAAGTAAGCAGGAGGG 0: 1
1: 0
2: 3
3: 21
4: 262
954369160_954369170 25 Left 954369160 3:50161174-50161196 CCACACCCCTGGGACCTTGCGTC 0: 1
1: 0
2: 2
3: 20
4: 167
Right 954369170 3:50161222-50161244 ATGCATGCAAGTAAGCAGGAGGG 0: 1
1: 0
2: 3
3: 21
4: 262
954369163_954369170 18 Left 954369163 3:50161181-50161203 CCTGGGACCTTGCGTCCGCTCTG 0: 1
1: 0
2: 1
3: 6
4: 98
Right 954369170 3:50161222-50161244 ATGCATGCAAGTAAGCAGGAGGG 0: 1
1: 0
2: 3
3: 21
4: 262
954369166_954369170 11 Left 954369166 3:50161188-50161210 CCTTGCGTCCGCTCTGGGTGTTG 0: 1
1: 0
2: 0
3: 4
4: 66
Right 954369170 3:50161222-50161244 ATGCATGCAAGTAAGCAGGAGGG 0: 1
1: 0
2: 3
3: 21
4: 262

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954369170 Original CRISPR ATGCATGCAAGTAAGCAGGA GGG Intronic
900550463 1:3252028-3252050 ATGCATGCTAGTGAGCCGGGTGG + Intronic
900704617 1:4072511-4072533 ATGCAGCCAGGTGAGCAGGAAGG + Intergenic
900844037 1:5081869-5081891 AGGCATGCTAGTAAGCAGACTGG - Intergenic
902274852 1:15331741-15331763 AAGCAGGCAAGCAGGCAGGAAGG + Intronic
905019648 1:34799940-34799962 ATGCATGGAAGAAGGCTGGAGGG - Intronic
905828339 1:41044431-41044453 AGGCAGGCAAGCAGGCAGGAAGG + Intronic
906844686 1:49179200-49179222 CTGAATGCAAGTAACCAGTAAGG + Intronic
907003879 1:50891086-50891108 ATGAATGAAATTAAGCAAGAAGG - Intronic
907981895 1:59490971-59490993 AAGCAAGCAAGCAAGCAGGCTGG - Intronic
910360070 1:86407050-86407072 CTGCCAGCAAGAAAGCAGGAAGG + Intergenic
910474477 1:87591990-87592012 ATGCGCCCAAGGAAGCAGGAAGG - Intergenic
911847192 1:102769040-102769062 AGGGATGCAAAAAAGCAGGATGG + Intergenic
914409555 1:147413093-147413115 AGGCATACAAAGAAGCAGGAAGG - Intergenic
914675883 1:149906939-149906961 ATGTATGAAAGTTAGTAGGAGGG + Intronic
916024651 1:160823279-160823301 ATGCTTGAAAGGAAGGAGGAAGG + Intronic
916794287 1:168151398-168151420 AGGCCTGTAAGTAAGCAGAAGGG - Intergenic
917677502 1:177333660-177333682 GTGAATACAAGAAAGCAGGAAGG + Intergenic
918154255 1:181830507-181830529 AGGTATCCAAGGAAGCAGGAGGG - Intergenic
919410470 1:197235900-197235922 TTGCATTCAAGTCACCAGGATGG - Intergenic
920265410 1:204717823-204717845 TTGCATGCAAGCAAGCTGGAAGG - Intergenic
920708192 1:208270584-208270606 ATGCTTGCCAGTAGCCAGGATGG - Intergenic
921382475 1:214538697-214538719 AAGCAAGCAAGCAAGCAGGCTGG - Intronic
923073480 1:230588253-230588275 AGCCATGTAAGTAAGCAGGTAGG + Intergenic
923586889 1:235281119-235281141 ATGCTTTAAAGTGAGCAGGAGGG + Intronic
1062838334 10:650732-650754 ATGCAGGGAAGTGAGCATGAGGG - Intronic
1063665873 10:8060291-8060313 GTACATGAAAGTAGGCAGGAGGG + Intronic
1063717224 10:8540004-8540026 AGGCATCCAAGTAATCAGAAAGG - Intergenic
1064480625 10:15736919-15736941 ATACATGCAAATAAGTAGGCAGG + Intergenic
1065778823 10:29147498-29147520 ATGCATGCAGTTAATCTGGAAGG + Intergenic
1066421616 10:35269301-35269323 AAGAAAGCAAGAAAGCAGGAAGG - Intronic
1066613925 10:37277667-37277689 AGGTATCCAAGGAAGCAGGAGGG + Intronic
1066674423 10:37873400-37873422 ATGCATGTATGTAAATAGGATGG - Intergenic
1068381459 10:56259187-56259209 ATGCAAAAAAGTAAGGAGGAGGG - Intergenic
1068500973 10:57839743-57839765 AGGTATCCAAGGAAGCAGGAGGG - Intergenic
1069032007 10:63606912-63606934 ATGATTGCAAGTATGCAGTATGG - Intronic
1069859241 10:71460253-71460275 ATGAAGGCAAGTAAGGAAGATGG - Intronic
1069901581 10:71709464-71709486 ATCCAGGCAAGCCAGCAGGAAGG + Intronic
1070156817 10:73840404-73840426 ATGGATGCAATCAAGAAGGAAGG - Intronic
1070364795 10:75726148-75726170 AGGCATGGATGAAAGCAGGAAGG + Intronic
1072268207 10:93750995-93751017 CTGCAGGGAAGGAAGCAGGAGGG - Intergenic
1072370992 10:94766307-94766329 AGGTATCCAAGGAAGCAGGAGGG + Intronic
1072615907 10:97048829-97048851 AGGCAGGCAAGTGAGCAGGCGGG + Intronic
1073618886 10:105026421-105026443 ATGCATGAAAGGAAGCAAAATGG + Intronic
1074694978 10:116042139-116042161 GTCCATGCAAGTAGGCAGGATGG - Intergenic
1075029110 10:119009254-119009276 AAGCAAGCAAGGAGGCAGGAGGG + Intergenic
1076890028 10:133278894-133278916 ACACATGCAGGTCAGCAGGAAGG + Exonic
1077956805 11:7029891-7029913 AGGCATGCTAGTTAGCAAGATGG - Intronic
1079952981 11:26827332-26827354 AGGCATGGAAGGAGGCAGGAAGG + Intergenic
1080421930 11:32118193-32118215 ATGGATGCAAGGAAGGAGGCGGG - Intergenic
1080985952 11:37465811-37465833 ATGAATGCAAGTAATCATCAGGG + Intergenic
1081013922 11:37851832-37851854 ATGCATGCAGGAAAGAAGGAAGG - Intergenic
1081144865 11:39550416-39550438 ATGCATGCAATGAAGAAAGAGGG - Intergenic
1081740908 11:45439810-45439832 ATTGAAGCAAGCAAGCAGGAGGG - Intergenic
1082008298 11:47433397-47433419 AGGCCTGTAAGTGAGCAGGAGGG - Intergenic
1082150314 11:48730672-48730694 ATGAATGCAATGAAGCAGGAAGG + Intergenic
1085901555 11:80706044-80706066 AGGCATGCAAGTAGGAAGGGGGG + Intergenic
1086233696 11:84600241-84600263 AAGCAAGCAAGCAAGCAGGCAGG + Intronic
1087091714 11:94280605-94280627 AAGCAAGCAAGCAAGCAGGTAGG + Intergenic
1087366776 11:97230114-97230136 ATCCATGCAAGTAGGTCGGAGGG + Intergenic
1087652706 11:100887036-100887058 ATGCATGTCAGTACTCAGGATGG + Intronic
1087682675 11:101233684-101233706 AGGTATCCAAGGAAGCAGGAGGG + Intergenic
1087797590 11:102471094-102471116 AAGCAAGCAAGCAAGCAAGAGGG - Intronic
1090041701 11:123297957-123297979 AATCATGCAAGGAGGCAGGAAGG + Intergenic
1093345924 12:18038256-18038278 AGGTATCCAAGAAAGCAGGAGGG - Intergenic
1093772723 12:23036352-23036374 ATGAATGACAGTAATCAGGATGG + Intergenic
1094303864 12:28995925-28995947 ATGCAGCCAAGCAAACAGGAAGG - Intergenic
1094731731 12:33184400-33184422 ATTCATCCAAGTAAACAGAAGGG - Intergenic
1095167349 12:38989080-38989102 ATGAATGCAATGAAGCGGGAAGG + Intergenic
1095367747 12:41428185-41428207 ATGCATGCATATAAGCAGGCAGG + Intronic
1095510653 12:42948257-42948279 ATGCATGCATGCATGCAGCATGG - Intergenic
1096121086 12:49089907-49089929 ATGCATGCCAGTCGGCTGGACGG + Exonic
1096874790 12:54619500-54619522 ATGTTTGCAAGTAAGAAAGATGG + Intergenic
1097706724 12:62876487-62876509 ATGAAGGCAAGTAATCAAGATGG + Intronic
1100187819 12:92156687-92156709 TTGTATGCCAGGAAGCAGGAGGG - Intergenic
1100745424 12:97640479-97640501 AGGCATGTGAGAAAGCAGGAAGG - Intergenic
1101705273 12:107215466-107215488 AGGTATCCAAGGAAGCAGGAGGG - Intergenic
1101752653 12:107595372-107595394 ATACAGGCAAGAAAGCAGTAGGG + Intronic
1104399057 12:128460683-128460705 ATGAATGCAAGTTTGCAGGGAGG + Intronic
1104813389 12:131631949-131631971 ATGCATGGAAGAAAGAAGAATGG + Intergenic
1106146648 13:27055197-27055219 TGCCATGGAAGTAAGCAGGAGGG - Intergenic
1106855229 13:33844467-33844489 AAGCAGGCAAGCAAGAAGGAGGG - Intronic
1106949148 13:34863351-34863373 ATGCATCAAAGTCAGCTGGAGGG + Intergenic
1107248109 13:38321825-38321847 AGGCATGCAAATCAGCAGCATGG - Intergenic
1107476035 13:40736196-40736218 ATGAATGAAATGAAGCAGGAAGG + Intronic
1107702782 13:43064778-43064800 ATGCATTCCAGCCAGCAGGAAGG + Intronic
1107843462 13:44484795-44484817 ATGCAGCCCAGTAAGCAGAAGGG - Intronic
1111816681 13:93162734-93162756 AGGCATGCAGGGAAGCATGATGG + Intergenic
1113550806 13:111191719-111191741 AGGTATCCAAGGAAGCAGGAGGG + Intronic
1114848584 14:26354440-26354462 ATGTATGCAAGATAGCATGAGGG - Intergenic
1116698027 14:48201521-48201543 ACGTATCCAAGGAAGCAGGAGGG - Intergenic
1120757168 14:88255233-88255255 ATTGATGCAAGTAAGCAGTATGG + Intronic
1120834723 14:89029323-89029345 ATGCTTGCAAGAAAGTAGCATGG - Intergenic
1121377557 14:93428241-93428263 ATGCATGTTTGCAAGCAGGATGG + Intronic
1121583961 14:95050229-95050251 ATGGATGGAAGGAAGAAGGAAGG + Intergenic
1122674483 14:103399877-103399899 TTGCATTCAAGGAAGGAGGAAGG + Intronic
1123901635 15:24883212-24883234 TTGCAGCCAAGTAAGCAGGGAGG + Intronic
1125688603 15:41578642-41578664 ATGCATGCACTTAAGCAGCAGGG - Exonic
1125698320 15:41658115-41658137 ATGCATGCAATTAAACAGTCTGG - Intronic
1126367205 15:47906569-47906591 AAGCAAGAAAGTAAGAAGGAAGG - Intergenic
1127812119 15:62573533-62573555 ATGCATGCAAGATAGAAGGAGGG - Intronic
1129692160 15:77720053-77720075 GTGGATGCAAGTCAGCAGGAGGG - Intronic
1131624469 15:94103056-94103078 AGGCATGCATGCAAGTAGGACGG + Intergenic
1132196729 15:99919239-99919261 AGGCAGGCAAGGAAGTAGGAGGG - Intergenic
1132200926 15:99954283-99954305 ATGCCTGAAAGAAAGCAGGAAGG - Intergenic
1134370101 16:13615360-13615382 CTGCATTCCAGTTAGCAGGAAGG - Intergenic
1135501372 16:22998916-22998938 AAGCATGCAAGCAAGAAGGAAGG + Intergenic
1137442863 16:48511084-48511106 ATGCAGGAAACAAAGCAGGATGG - Intergenic
1138748133 16:59387292-59387314 GTGCATGCAAGGATGGAGGATGG + Intergenic
1140317495 16:73913226-73913248 AGGCAGGCAGGTAAGCAGGTAGG - Intergenic
1140328947 16:74033939-74033961 ATGCTTGCAAGTAAATAGGCAGG + Intergenic
1142062073 16:88036741-88036763 ATGGATGGAAGGAAGCAGCAGGG + Intronic
1143085577 17:4413480-4413502 AAGCAAGCAAGCAAGCAGGTCGG - Intergenic
1148043893 17:44730426-44730448 ATACATGCAAGCAAGGAAGAAGG - Intronic
1148144558 17:45354764-45354786 AGGCAGGCAGGAAAGCAGGAAGG - Intergenic
1148789134 17:50163625-50163647 ATGGATGAAATTAATCAGGAGGG + Intergenic
1149153525 17:53597878-53597900 TTACATGCAAGTAGGAAGGAAGG + Intergenic
1153446436 18:5178187-5178209 ATGCATATCAATAAGCAGGAGGG - Intronic
1153867597 18:9287185-9287207 ATGCATGTAAATCAGCAGGACGG - Intergenic
1157603877 18:48913480-48913502 AAGGATTCAAGTAAGCATGAGGG + Intergenic
1157688505 18:49662168-49662190 AAGCATGACAGTAAGGAGGAAGG + Intergenic
1158669994 18:59466040-59466062 AAGCAGGCAAGTGGGCAGGAAGG - Intronic
1159554612 18:69932381-69932403 ATGCATCTAAGTAAGCATGTGGG + Intronic
1159711862 18:71770366-71770388 GCCCATGCAAGTAAACAGGAAGG + Intronic
1159948631 18:74462224-74462246 GGGAATGCAAGTGAGCAGGAGGG - Intergenic
1160060194 18:75522762-75522784 ATGCATGCAAAAAAACTGGAAGG + Intergenic
1161096001 19:2391058-2391080 AGGCAGGCAGGTAGGCAGGAAGG + Intronic
1162096382 19:8312256-8312278 AAGCAAGAAAGGAAGCAGGAGGG + Intronic
1164458602 19:28429052-28429074 ATGCATGATAGGAACCAGGAAGG + Intergenic
1164665797 19:30035483-30035505 AAGCATGCAAGTAAGAAGAGTGG - Intergenic
1164866380 19:31607537-31607559 TTGCATGCTTGTAAGCAGAAGGG - Intergenic
1165616627 19:37207370-37207392 ATGCATTCAAGTCACCTGGAGGG + Intronic
925205924 2:2005856-2005878 ATGCAGGAAAGAAAGCAGGCAGG - Intronic
926577416 2:14597436-14597458 ATGCCTGCAGGTAAGCTGGAAGG + Intergenic
927000650 2:18791087-18791109 AAGCAAGCAAGCAAGCAGGGAGG - Intergenic
928116211 2:28546692-28546714 ATGAATGGAAGCAAGGAGGATGG + Intronic
928365999 2:30703438-30703460 ATGCTCACAAGAAAGCAGGAGGG - Intergenic
928888231 2:36174601-36174623 ATACATGCAGGCAAGGAGGAGGG + Intergenic
929703810 2:44189339-44189361 ATGCCTGCAAGTAAGAATGAGGG - Intronic
931553322 2:63471045-63471067 AAGCAAGCAAGAAAGCATGATGG - Intronic
932744534 2:74322005-74322027 GTCCGTGCAAGAAAGCAGGAGGG - Intronic
933285189 2:80377791-80377813 CTGGATGCAAATAAGCAGGTTGG + Intronic
934604135 2:95681520-95681542 CTCCATGCCAGTAATCAGGAAGG + Intergenic
934701221 2:96441858-96441880 ATGAATGAAAGGAAGCAAGAAGG + Intergenic
935237084 2:101148542-101148564 ATGCATGTATGTAAGCAGGAGGG + Intronic
936537526 2:113323754-113323776 CTCCATGCCAGTAATCAGGAAGG + Intergenic
937407662 2:121645646-121645668 GTGAATCTAAGTAAGCAGGAAGG + Intronic
937714554 2:125016604-125016626 ATACATCCAAGCAAGCAAGATGG - Intergenic
941601512 2:167548522-167548544 ATGCATTCCAGGCAGCAGGAGGG - Intergenic
943320633 2:186438265-186438287 ATTCATGCAAGTCAGCCTGAGGG + Intergenic
944135834 2:196398163-196398185 ATGCATGCATGTGAGTAGGGAGG + Intronic
944834215 2:203562335-203562357 ATGAAAGCAGATAAGCAGGAAGG - Intergenic
945151532 2:206796871-206796893 AAGCAAGCAAGCAAGGAGGAGGG - Intergenic
945412657 2:209530175-209530197 ATGCATCCCAGATAGCAGGAGGG + Intronic
945896385 2:215487088-215487110 ATGCGGGTAAGTAAGCAGTAGGG + Intergenic
946484005 2:220083446-220083468 ATGCATGAAAGGAAGCTGGAAGG - Intergenic
946996442 2:225397783-225397805 AGGCAGGCAAGTAGGAAGGAAGG + Intergenic
947672275 2:231945675-231945697 ATACATGCAAATAACCAAGAAGG + Intergenic
948246416 2:236489585-236489607 ATGCATGGATGGAAGCAGAAGGG + Intronic
948573755 2:238936604-238936626 AGACATGCAATTAGGCAGGAAGG - Intergenic
948913474 2:241018256-241018278 ATGAATTCAAGTCAGCAAGATGG + Intronic
1168790452 20:572559-572581 ATGAATGAAGGTAAGAAGGAAGG - Intergenic
1169819977 20:9699787-9699809 ATGCATGCATGTAGAGAGGAAGG - Intronic
1170425684 20:16233149-16233171 ATGCATGCAACTGAGCAACATGG + Intergenic
1170628169 20:18045174-18045196 AAGGGTGGAAGTAAGCAGGATGG - Intronic
1170910443 20:20561399-20561421 ATGTATGAAAGGAGGCAGGAAGG - Intronic
1172052077 20:32125558-32125580 ATGCATGGAAATTACCAGGAGGG - Intronic
1172440682 20:34964342-34964364 ATGAATGCATGAAAGCAGAAGGG + Intergenic
1172591227 20:36119599-36119621 AAGAAAGCAAGAAAGCAGGAAGG + Intronic
1174328619 20:49799700-49799722 TAGCATGCAAGAAAGCATGATGG - Intergenic
1179681685 21:43026167-43026189 ATGAATGCAGAAAAGCAGGAGGG - Intronic
1184061612 22:42085940-42085962 TTGCATGTCAGTAAACAGGAAGG - Exonic
1184077565 22:42192369-42192391 ATGAATGCAAGTAGGAAGAAAGG - Intronic
1184180440 22:42820102-42820124 CTTCCTGCAAGTAAGCTGGATGG - Intronic
1184812354 22:46844727-46844749 ATGCCTGCAAGTGAGCAGGAGGG - Intronic
951158834 3:19390360-19390382 AGGCAGGCAAACAAGCAGGAAGG - Intronic
953563246 3:44011293-44011315 ATGCATACAAGTGAGGAGGGTGG - Intergenic
953777598 3:45835021-45835043 AAGCATGCCAGAAATCAGGAAGG - Intronic
954369170 3:50161222-50161244 ATGCATGCAAGTAAGCAGGAGGG + Intronic
954992482 3:54853519-54853541 ATGCTTGCAGGCAAGCAGGAGGG - Intronic
956127356 3:66023497-66023519 ATGCAGGCAGGAAAGCAAGAAGG + Intronic
960034792 3:113091633-113091655 ATGAATGAAAGAAAGAAGGAGGG + Intergenic
960293720 3:115917260-115917282 TTGCTTGCAAGTAAGAAGTATGG - Intronic
961229442 3:125289972-125289994 AGGCCTGCAAATAAGCATGAGGG - Intronic
961438025 3:126932706-126932728 ATGCCAGCAAGGCAGCAGGAAGG - Intronic
961473458 3:127132742-127132764 CTGCAGGCAAGTAAGCAGGATGG - Intergenic
962183264 3:133231023-133231045 ATGCATGTCAGTAATCAGGGTGG - Intronic
966993017 3:185253611-185253633 AAAGTTGCAAGTAAGCAGGAGGG + Intronic
967387239 3:188923795-188923817 ATGAAGGCAGGAAAGCAGGAGGG + Intergenic
967713591 3:192737885-192737907 CTGAATGCAACTAAGCTGGAAGG + Intronic
967921135 3:194615355-194615377 CTCCATGCCAGTAAACAGGAAGG + Intronic
968225903 3:196971852-196971874 ATGCCTGGAAGTAGGCGGGATGG + Intergenic
971211622 4:24623281-24623303 CTACATGCAAGTAACAAGGAAGG + Intergenic
971351130 4:25857188-25857210 AAGCATGCAATTAAGCAAAATGG + Intronic
971358512 4:25915586-25915608 GTGCATGCAGATAAGCTGGAAGG - Intronic
971789020 4:31143040-31143062 AGACATGCAAGTAACAAGGATGG - Intronic
972602549 4:40585927-40585949 CTGGAAGCAGGTAAGCAGGACGG + Intronic
974156953 4:58085869-58085891 ATTCATGGCAGAAAGCAGGAAGG + Intergenic
976326627 4:83779178-83779200 ATGAAGGCAAGCAAGCAGGCAGG + Intergenic
977884820 4:102243059-102243081 AGGTATCCAAGGAAGCAGGAGGG - Intergenic
979708021 4:123744807-123744829 ATACAGGCATGTGAGCAGGAAGG + Intergenic
979887467 4:126047001-126047023 ATGCATGAAAAGAAACAGGAAGG + Intergenic
980246644 4:130254121-130254143 ATGTATGCAGGTAAGTAGGTAGG + Intergenic
980848098 4:138348399-138348421 ATCAATGCACGTTAGCAGGATGG + Intergenic
981607672 4:146557647-146557669 ATGCATGAAATGAAGCAAGAAGG - Intergenic
984663997 4:182405837-182405859 AGGCAGGCAAGAAAGCTGGAGGG + Intronic
984698431 4:182801819-182801841 GTGCATGCATGTGTGCAGGAGGG - Exonic
984708042 4:182862258-182862280 AAGCAAGCAAGCAAGCAAGAGGG + Intergenic
984939274 4:184917279-184917301 AGGTATCCAAGGAAGCAGGAGGG + Intergenic
987366877 5:17156715-17156737 ATGGATGCAAGAAAGGAGTAAGG - Intronic
988412487 5:30904929-30904951 ATGAATGGAAGGAAGCAGGATGG + Intergenic
991633865 5:68683488-68683510 AGACATGCAAGCAACCAGGATGG + Intergenic
992050019 5:72933276-72933298 AGGTATCCAAGGAAGCAGGAGGG - Intergenic
993124882 5:83821667-83821689 ATACATGCAAAGAAGGAGGAGGG - Intergenic
993531455 5:89029796-89029818 ATGCATGCAAGAAATGTGGAAGG + Intergenic
994373835 5:98996077-98996099 ATGGTTGCAGGTAAACAGGAGGG - Intergenic
994506066 5:100644352-100644374 ATGCACACAATTAAGCAGAAAGG + Intergenic
994538367 5:101060487-101060509 ATGAATGAAATGAAGCAGGAAGG - Intergenic
995873412 5:116765612-116765634 AGGCATGCAGTAAAGCAGGAAGG - Intergenic
996059975 5:119022479-119022501 ATGCGTGTAAGTAAAGAGGAAGG + Intergenic
996680859 5:126227135-126227157 AGGTATCCAAGGAAGCAGGAGGG - Intergenic
997072949 5:130640005-130640027 AGGTATCCAAGGAAGCAGGAGGG - Intergenic
998397205 5:141826372-141826394 TTGCTTGCAAATAAACAGGAGGG - Intergenic
998638893 5:143987398-143987420 ATGCAGGCAGGAAGGCAGGAAGG - Intergenic
998713220 5:144849829-144849851 AGGTATCCAAGGAAGCAGGAGGG + Intergenic
999819574 5:155212781-155212803 AAGCAAGCAAGCAAGCAAGATGG - Intergenic
1001226113 5:169946006-169946028 ATGGATGCAAGGAAGCAGGGAGG - Intronic
1001465803 5:171965017-171965039 ATGCAGAGAAGTAGGCAGGAAGG + Intronic
1001620012 5:173075829-173075851 AGGCAGGGAAGTAGGCAGGAGGG - Intronic
1002633344 5:180595095-180595117 ATGCATGCAAGTGTGTAAGATGG + Intergenic
1006615144 6:35321152-35321174 AGGCAGGCAAGTAAGGAGAAAGG - Intronic
1008149176 6:47929779-47929801 ATACCTGGCAGTAAGCAGGATGG - Intronic
1011114325 6:83874090-83874112 AGGCAGGCAAGCAGGCAGGAAGG - Intronic
1012843333 6:104357900-104357922 CAGCATGTATGTAAGCAGGAAGG - Intergenic
1013881649 6:114909523-114909545 ATTCATGCAAATAAAGAGGATGG + Intergenic
1013907198 6:115234103-115234125 AGGTATCCAAGGAAGCAGGAGGG + Intergenic
1014745751 6:125198426-125198448 ATGCATGCAAGTATGTATGCAGG - Intronic
1016468132 6:144347140-144347162 CAGCAGGCAAGAAAGCAGGAAGG - Intronic
1017101600 6:150854083-150854105 AGGTATCCAAGGAAGCAGGAGGG - Intergenic
1017325689 6:153139316-153139338 ATGTATGCATGTGAGTAGGAAGG + Intergenic
1017577130 6:155817553-155817575 ATGCATGCAGTGAGGCAGGAGGG - Intergenic
1019769183 7:2872704-2872726 ATGCATGCAAATGGGAAGGAAGG - Intergenic
1022087836 7:27086453-27086475 GTTCATGAAAGTAAACAGGAAGG + Intergenic
1022160692 7:27708103-27708125 ATGCATGGAAATAATCTGGAAGG + Intergenic
1023862129 7:44223075-44223097 AAACATGCACATAAGCAGGACGG + Intronic
1023899772 7:44466803-44466825 AGGCATGCTAGTGGGCAGGAGGG + Intronic
1024986609 7:55199776-55199798 ATGCATGCAAGTGAGAGGGCTGG - Intronic
1024986614 7:55199804-55199826 ATGCATGCAAGTGAGAAGGCTGG - Intronic
1025798216 7:64759452-64759474 AGGTATCCAAGGAAGCAGGAGGG + Intergenic
1026231184 7:68485431-68485453 AAGGAAGCAAGCAAGCAGGAAGG + Intergenic
1028494600 7:91449302-91449324 AGGTATCCAAGGAAGCAGGAGGG + Intergenic
1031993293 7:128211557-128211579 AGGCAGGGAAGCAAGCAGGATGG + Intergenic
1032490568 7:132321150-132321172 GGGCATGCAAGTAAGCGCGAGGG - Intronic
1034369118 7:150579202-150579224 ATGAATGAAATGAAGCAGGAAGG - Intergenic
1035045988 7:155965920-155965942 ATGACTGCATCTAAGCAGGAGGG - Exonic
1037233238 8:16685802-16685824 AAGCAAGCAAGCAAGCAAGAAGG - Intergenic
1038387309 8:27160780-27160802 ATCCAGGCAAGTAAGAAGAATGG - Intergenic
1038920558 8:32078781-32078803 ATTCATGGAACTAAACAGGAGGG - Intronic
1040649564 8:49433175-49433197 AGGTATCCAAGGAAGCAGGAGGG - Intergenic
1041168873 8:55120064-55120086 ATGTGTGCAAGTCAGAAGGAGGG + Intronic
1041580643 8:59456106-59456128 AGGCAGGCAAGCAAGCAGGAAGG - Intergenic
1044817810 8:96131014-96131036 ATGCAGGCGAGGATGCAGGATGG - Intergenic
1046535314 8:115501363-115501385 AAGCATGCAAGTAAAAATGATGG + Intronic
1050372150 9:4932971-4932993 ATTACTGCAAGTAAGGAGGAGGG + Intergenic
1051647159 9:19280121-19280143 AGGCAGGCAGGTAGGCAGGAAGG - Intronic
1052057156 9:23918816-23918838 AAGTATCCAAGGAAGCAGGAGGG + Intergenic
1054721349 9:68607206-68607228 GTGCATGCAAATGAGCAGTAGGG + Intergenic
1055193245 9:73553260-73553282 ATGGATGGAAGGAAGGAGGAAGG - Intergenic
1056081205 9:83095699-83095721 ATAAATGCAAGTATGAAGGAAGG - Intergenic
1058669245 9:107346855-107346877 AAGCAAGCAAGCAAGCAGGCAGG + Intergenic
1058819073 9:108712532-108712554 CTGCATCCTAGTCAGCAGGAGGG - Intergenic
1186342547 X:8659565-8659587 AGGCAAGCAAGCAAGCAGGGAGG - Intronic
1187633815 X:21205118-21205140 ATGCATTGAAGAATGCAGGAAGG + Intergenic
1188388306 X:29589286-29589308 ATGCATGAAAGTATGAATGAAGG - Intronic
1190955126 X:55185774-55185796 TTGTATGCCAGTAAACAGGATGG - Intronic
1194763966 X:97827549-97827571 ATACATGAAAGTCAGTAGGAAGG + Intergenic
1195029989 X:100917485-100917507 GTGCATGCCTGTAAGGAGGAAGG + Intronic
1195439993 X:104888542-104888564 AGGTATCCAAGGAAGCAGGAAGG - Intronic
1195475348 X:105278871-105278893 AAGCAGGCAGGCAAGCAGGAAGG - Intronic
1195837974 X:109140941-109140963 AAGCAAGCAAGTAAGCAGGCAGG - Intergenic
1196309772 X:114150158-114150180 TAGCATGGAAGTCAGCAGGATGG - Intergenic
1196489366 X:116248740-116248762 AGGTATCCAAGGAAGCAGGAGGG - Intergenic
1197956557 X:131955710-131955732 AGGCATGCAAGGAAACAAGAAGG + Intergenic
1201404348 Y:13634971-13634993 AGGTATCCAAGGAAGCAGGAGGG - Intergenic
1201631827 Y:16078280-16078302 AGGTATCCAAGGAAGCAGGAGGG - Intergenic
1202243440 Y:22793071-22793093 AGGTATCCAAGGAAGCAGGAGGG - Intergenic
1202396427 Y:24426821-24426843 AGGTATCCAAGGAAGCAGGAGGG - Intergenic
1202474355 Y:25243271-25243293 AGGTATCCAAGGAAGCAGGAGGG + Intergenic