ID: 954369924

View in Genome Browser
Species Human (GRCh38)
Location 3:50164893-50164915
Sequence GAGGATTAACTGTGTGAGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 161}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954369923_954369924 -6 Left 954369923 3:50164876-50164898 CCTCGTTGTGTTGTCAGGAGGAT 0: 1
1: 0
2: 1
3: 25
4: 362
Right 954369924 3:50164893-50164915 GAGGATTAACTGTGTGAGTATGG 0: 1
1: 0
2: 1
3: 4
4: 161
954369919_954369924 29 Left 954369919 3:50164841-50164863 CCTTTTCTGGAAAATGGGAGTAA 0: 1
1: 0
2: 40
3: 382
4: 1956
Right 954369924 3:50164893-50164915 GAGGATTAACTGTGTGAGTATGG 0: 1
1: 0
2: 1
3: 4
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954369924 Original CRISPR GAGGATTAACTGTGTGAGTA TGG Intronic
900759886 1:4463473-4463495 GAGCACTAACTGTGGGAGTGGGG - Intergenic
901318871 1:8327213-8327235 GAGGATTGAGTGTGTGTGCATGG + Intronic
904495522 1:30884326-30884348 GAGGCTTGAGTGTGTGAGTTGGG - Intronic
904555297 1:31358619-31358641 GAGAAGTAAGTGTGGGAGTAGGG + Intronic
904774264 1:32897021-32897043 GAGGATTAACCGAGTAAGTGAGG + Intronic
904890596 1:33776671-33776693 GAGGATTGACTGAGTGAGGGGGG + Intronic
905700812 1:40012261-40012283 GAGGTTTCACTGTGTTAGTCAGG + Intergenic
906421115 1:45668089-45668111 GAGGAATAAATGGGTGAGTGAGG - Intronic
907859146 1:58334179-58334201 GAGTTTTAACTGTGTTTGTATGG + Intronic
910927789 1:92413980-92414002 AAGAATTGACTGTGTGTGTAGGG - Intergenic
914455513 1:147833159-147833181 GAGCATCAACTGTGATAGTATGG + Intergenic
917597295 1:176542293-176542315 AAGGATTAATTATTTGAGTATGG + Intronic
918746431 1:188207095-188207117 GTGGATTAGCTGTGAGATTAGGG + Intergenic
922233365 1:223705013-223705035 GTGGATGAACTGGGGGAGTATGG - Intronic
1063951577 10:11227853-11227875 GAGGCTTAACTGAGTGACTGTGG + Intronic
1065166605 10:22985626-22985648 GAGAATTATCTGTGGGGGTAGGG - Intronic
1065959515 10:30723111-30723133 GAGAATTAACTGTATTGGTAGGG + Intergenic
1072268411 10:93752303-93752325 GAGGATTAAGTGAGTTAATATGG + Intergenic
1072820356 10:98550665-98550687 GAGGTTTCACTGTGTTAGTCAGG + Intronic
1075820412 10:125303290-125303312 AATGATTACCTGTGTGAGGAGGG - Intergenic
1076275482 10:129195152-129195174 CAATATTAACTGTGTGTGTAAGG + Intergenic
1077881335 11:6353031-6353053 CAGGAGCAAATGTGTGAGTAAGG - Intergenic
1080431945 11:32207533-32207555 GAGGAGGAACTCTGTGAGGACGG + Intergenic
1080648700 11:34205924-34205946 GAGGATTAACTGAGTAACTGGGG + Intronic
1082062872 11:47875496-47875518 GAGGTTTCACCGTGTTAGTAAGG + Intergenic
1082083941 11:48033608-48033630 ATGGATTAACTGTGTGGGTGTGG + Intronic
1086378471 11:86226110-86226132 GAGTATTAACAATGTTAGTAGGG + Intergenic
1087322549 11:96680461-96680483 CAGGATACACTGTGTGTGTAAGG - Intergenic
1090121946 11:124038966-124038988 GAGGATGAACGCTGTCAGTAGGG + Exonic
1090156196 11:124441044-124441066 GAGGATAAACTGTGTCACGAAGG + Exonic
1094278772 12:28710595-28710617 GAGGATTAAATGAGTGAATGAGG - Intergenic
1096172128 12:49479927-49479949 TAGGATTTACTGTGTGACTTTGG + Intronic
1097807590 12:63982956-63982978 GAGGATTAAATGTGTCAGTAAGG + Intronic
1098251648 12:68576217-68576239 CATGTTTAACTGTGTGAGCATGG + Intergenic
1105606228 13:21928507-21928529 GAGGTTTAACTGTGTTAGCCAGG - Intergenic
1108462878 13:50684724-50684746 GTGGATTCTCTGTGTGAGTCTGG - Intronic
1108756980 13:53514927-53514949 GAGAATTGACTGTCTGAGGATGG + Intergenic
1109491995 13:63114081-63114103 GAGGATTAACTGGGGGACAAAGG - Intergenic
1109855645 13:68123775-68123797 AAGGATTAACTGTGTAACTTTGG - Intergenic
1111980391 13:95009306-95009328 AAGTTTTAACTTTGTGAGTATGG - Intergenic
1118177538 14:63456637-63456659 GCTTATTAACTGTGTGACTATGG - Intronic
1125682418 15:41540253-41540275 GAGGATTAAATGAATGAATATGG - Intronic
1130578062 15:85110077-85110099 GAGGATTCAATGAGTGTGTATGG + Intronic
1131585824 15:93691699-93691721 GAGGATTAACTGAGGGAGGAGGG + Intergenic
1135653890 16:24230819-24230841 GAGGATTAACTGAGTTGTTATGG - Intergenic
1139070725 16:63378913-63378935 GTTGATTAAATGTGTGAGTTTGG + Intergenic
1139772714 16:69292024-69292046 GAGGTTTCACTGTGTTAGTCAGG - Intronic
1140971451 16:80016966-80016988 GAGCATTGACTGTTTGAGGAAGG - Intergenic
1140999590 16:80295995-80296017 GTAAATTAACTGTCTGAGTATGG + Intergenic
1144407330 17:14964717-14964739 GAGGATAAACTCTGTCAGGACGG - Intergenic
1144618348 17:16797585-16797607 GAGGATTCACTGTGTTAGCCAGG + Intronic
1144656149 17:17038147-17038169 GGGGTTTCACTGTGTGAGGATGG - Intergenic
1144894359 17:18518108-18518130 GAGGATTCACTGTGTTAGCCAGG - Intergenic
1145137872 17:20426135-20426157 GAGGATTCACTGTGTTAGCCAGG + Intergenic
1146367949 17:32244182-32244204 GGGGTTTCACTGTGTGAGTCAGG - Intronic
1148707651 17:49649634-49649656 GGGGTTTCACTGTGTGAGTCAGG - Intronic
1149600852 17:57892156-57892178 GAGGAGTAAATGAGTGTGTAGGG - Intronic
1150316919 17:64176639-64176661 GAGTTTGAACTGTGTAAGTATGG - Intronic
1150608265 17:66712849-66712871 GAGGATTAAATGAGTAAGTATGG + Intronic
1153400516 18:4679241-4679263 GAGCATCAGCTGTGTTAGTATGG - Intergenic
1155894466 18:31306838-31306860 GAGGTTTCACTGTGTTAGTCAGG + Intergenic
1164039793 19:21484124-21484146 GAGGATGACCTGGGTGAGTCCGG - Intronic
1164364714 19:27564469-27564491 AAGGTTTAACTCTGTGAGAAGGG - Intergenic
1165284374 19:34828160-34828182 CAGGATAAACTGTGTACGTACGG + Intergenic
1166007687 19:39918341-39918363 GGGGACTACCTGTGTGAGGATGG - Exonic
1167195876 19:48027998-48028020 GAGTATTAAATGTGTGAGCAAGG - Intergenic
1167701752 19:51052202-51052224 GAGGATCAACTGTGTCTGTGGGG - Intergenic
1168209120 19:54876570-54876592 GAGGATTATGTGTGTGGGGAGGG + Intronic
1168523984 19:57074219-57074241 GAGGTTTCACTGGGTGAGTCAGG - Intergenic
928290914 2:30036659-30036681 GTGGATTAAATGTGTGGGTTTGG - Intergenic
928460277 2:31465994-31466016 GAGAATTACCAGTGTGAGCAAGG + Intergenic
929289839 2:40177671-40177693 GAGAGTTAAGTGTGAGAGTAGGG + Intronic
930591305 2:53329478-53329500 AAGGTTTTACTGTGTGAGTGTGG - Intergenic
934107856 2:88712506-88712528 GAGGGTGAACTGTGAGAGCAAGG - Intronic
937877357 2:126835754-126835776 TAGGATTATCTGTGTGAGCTTGG + Intergenic
938719970 2:134058408-134058430 GAGGATTGAGGGTGGGAGTAGGG - Intergenic
938767522 2:134470162-134470184 GAGGTTTCACTGTGTTAGTCAGG - Intronic
939304200 2:140388744-140388766 GAGGGGGAACTGTATGAGTAAGG + Intronic
940440332 2:153707778-153707800 CTGGATTATATGTGTGAGTATGG + Intergenic
940771448 2:157843438-157843460 GAGGATTAAGTGTGGTAATATGG - Intronic
941073938 2:160986544-160986566 GAGGTTTCACTGTGTTAGTCAGG - Intergenic
943477033 2:188369556-188369578 GAGGATCAACTCTGTCACTAGGG - Intronic
943562278 2:189478019-189478041 GAGGCTCCACTCTGTGAGTAGGG + Intergenic
946436121 2:219656118-219656140 GGGGTTTCACTGTGTGAGTCAGG - Intergenic
947880046 2:233500207-233500229 AAGGATTAACTGTGTGTCTTTGG + Intronic
1169276778 20:4238498-4238520 GAGGAGTAACTGAAAGAGTAAGG + Intronic
1173457020 20:43211089-43211111 GAGGATGAAGTGTGTGTGCAGGG - Intergenic
1177135535 21:17302530-17302552 GAGAATTGACTGTGTAAATAGGG - Intergenic
950912787 3:16612333-16612355 GAGAAGTATGTGTGTGAGTAGGG - Intronic
953315652 3:41924255-41924277 GAGAATTCACTGTCTAAGTATGG - Intronic
953541071 3:43818678-43818700 GAGGATTCAGGGTGGGAGTAGGG - Intergenic
954369924 3:50164893-50164915 GAGGATTAACTGTGTGAGTATGG + Intronic
955214225 3:56971656-56971678 GAGGTTTTACTGTGTTAGTCAGG - Intronic
956097467 3:65732418-65732440 CAGGATTAGCTGTGCGAGAAAGG + Intronic
958206701 3:90407533-90407555 AAGGTTTAACTCTGTGAGTTGGG + Intergenic
959024524 3:101225308-101225330 GAGGATCCATTATGTGAGTAGGG + Exonic
959117989 3:102199861-102199883 GAGGATAAAATGTGCTAGTAGGG - Intronic
959279809 3:104323614-104323636 GAGCATCAGCTGTGTTAGTATGG - Intergenic
959715703 3:109430960-109430982 GAGCATTAGCTGTGGTAGTATGG + Intergenic
959997310 3:112693611-112693633 GAGTATCAACTGTGGTAGTATGG - Intergenic
965618246 3:170616591-170616613 GGGGATTCACTGTGTTAGTCAGG - Intronic
967100177 3:186209888-186209910 GAGGATTAGCTGGGGGAGTGGGG - Intronic
968190497 3:196663811-196663833 GAGCAGTAACTGTGGGAGCATGG + Intronic
970844718 4:20522880-20522902 GATGATTTACTGTGGGGGTAGGG + Intronic
971410896 4:26370885-26370907 GGGGTTTAACTGTGTTAGCAAGG - Intronic
973290243 4:48463869-48463891 GAGGTTCAAGTGTGGGAGTAGGG - Intergenic
973810636 4:54566706-54566728 GGGGATTAACTGTGTGTTAATGG - Intergenic
974062361 4:57046892-57046914 GAGAATTAATTGAGTGTGTAAGG - Intronic
974657540 4:64843812-64843834 GAACATTAAATGAGTGAGTAGGG + Intergenic
978202178 4:106035027-106035049 CAGGATTAACTGTGTTTGTAGGG + Intergenic
980851198 4:138384142-138384164 GAGGATTAAATGTGGGTGTCTGG + Intergenic
983193389 4:164778799-164778821 CAGAATTAACTGTGTGATCATGG + Intergenic
983235758 4:165177749-165177771 GAGGAATAACTGTCTCAGGATGG + Intronic
983518039 4:168677811-168677833 CAGGATTAACTGGCGGAGTAGGG - Intronic
983792901 4:171820706-171820728 GAGGATTTAGTCTGTTAGTATGG + Intronic
984604807 4:181772944-181772966 GAGAATGAACTGTGTTAGCAGGG - Intergenic
987577762 5:19752664-19752686 GAGCATCAGCTGTGTTAGTATGG - Intronic
988344643 5:30021259-30021281 GAGCATCAACTGTGGTAGTATGG - Intergenic
988461760 5:31445208-31445230 GAGGATTATCTTTGTGTGTGAGG - Intronic
992540911 5:77762869-77762891 GATGATTAAGTGAGTGAGTGTGG + Intronic
993512735 5:88792261-88792283 GAACATTAACTGTGTGAGCTGGG - Intronic
994555753 5:101300462-101300484 CAGGATTACATGTGTGAGAAGGG - Intergenic
994797900 5:104330126-104330148 GAGGATTTACTGTATTAATATGG + Intergenic
997055762 5:130442036-130442058 GAGGATTAAATGAGTTAATATGG + Intergenic
1000757879 5:165183969-165183991 GAGCATCAACTGTGGTAGTATGG + Intergenic
1005168827 6:22957646-22957668 GAGGGTTAACTGTCTGAGATAGG - Intergenic
1006647372 6:35523950-35523972 GGGGATTCACTGTGTGACTGTGG - Intergenic
1007565595 6:42847934-42847956 GAGGTTTCACTGTGTGAGCGAGG - Intronic
1010076335 6:71803216-71803238 GAGTATTAGCTGTGGTAGTATGG + Intergenic
1011099501 6:83707280-83707302 GAGGATTGTTTTTGTGAGTATGG - Intronic
1011830024 6:91360589-91360611 GAGGAATAAATGAATGAGTAGGG + Intergenic
1013109634 6:107054711-107054733 GAGGTTTCACTGTGTTAGTCAGG - Intergenic
1016229018 6:141778845-141778867 GAGGTTTAACTGTGTTAGCCAGG - Intergenic
1017471736 6:154744495-154744517 TAGTATTAACTTTGTGAGAATGG + Intronic
1017993708 6:159511995-159512017 GAGGATATATTGTGTGTGTATGG - Intergenic
1018698653 6:166410191-166410213 TATGATGAACTGTGTGAGGAAGG + Intronic
1023545451 7:41313550-41313572 GAGAACAAGCTGTGTGAGTAAGG + Intergenic
1024618045 7:51132507-51132529 CAGGATTAAGATTGTGAGTAGGG - Intronic
1027724248 7:81783460-81783482 GAGGATTTATTATGTGAGAATGG - Intergenic
1027974581 7:85134932-85134954 GAGGAATAACTGAGTGATTCAGG + Intronic
1027995965 7:85425574-85425596 GAGGATCATCTGTATGAGAAAGG - Intergenic
1028962200 7:96761660-96761682 GAGCATCAACTGTGGTAGTACGG + Intergenic
1029238104 7:99140477-99140499 GAGGTTTCACTGTGTTAGTCAGG + Intronic
1029400660 7:100343591-100343613 GAGGTTTCACTGTGTTAGTCAGG + Intronic
1031696989 7:124869362-124869384 GAGTGTTAGCTATGTGAGTATGG + Intronic
1032931553 7:136678099-136678121 GAGCATCAGCTGTGTTAGTATGG - Intergenic
1035274453 7:157739161-157739183 GAGGATTAACCGTGTGACCTTGG - Intronic
1035736435 8:1890560-1890582 GAGGAGTCACTGAGTGTGTAAGG + Intronic
1038138741 8:24819753-24819775 GAGGATTAAAAGAGAGAGTATGG - Intergenic
1038523991 8:28257626-28257648 GAGGAGTAACTGACTGAGTCTGG - Intergenic
1041711228 8:60896333-60896355 GAGGCTGAACAGTGGGAGTATGG - Intergenic
1042577248 8:70233994-70234016 GGGGATTAATTGTATGAGTTTGG - Intronic
1042897982 8:73692167-73692189 TAGGATGAAGTGTGTGAGAAGGG - Intronic
1046019015 8:108641339-108641361 GAGAATGAACTGTATCAGTAAGG - Intronic
1046613179 8:116447629-116447651 GAGAATTAATTGAGTTAGTATGG + Intergenic
1046634801 8:116662605-116662627 GAGGATAAACTGTGGGTGAAGGG - Intronic
1049072202 8:140364932-140364954 CAAAATTAACTGTGTGACTAGGG + Intronic
1056348790 9:85726469-85726491 GAGGATGAAGTGTGAGAATAGGG + Intronic
1058278423 9:103077862-103077884 CAGAATTAACTGTGTGTTTATGG - Intergenic
1059609818 9:115880324-115880346 GAGGATTAACTGCCTCTGTAAGG + Intergenic
1061063581 9:128263609-128263631 GAGGTTTCACTGTGTTAGCAAGG + Intronic
1186160905 X:6776151-6776173 GTGTATTAAGTGTGTGAATAAGG - Intergenic
1188544030 X:31282768-31282790 GAGGATTATGTGTGAGGGTATGG + Intronic
1196069606 X:111506176-111506198 GAGGATTAGCTGTGTAAAAATGG + Intergenic
1199503433 X:148535442-148535464 GAGGTATAGATGTGTGAGTAGGG - Intronic
1201765585 Y:17571058-17571080 CAGGATTAACTGAATGAGTGTGG - Intergenic
1201835967 Y:18334931-18334953 CAGGATTAACTGAATGAGTGTGG + Intergenic